Am. J. Respir. Cell Mol. Biol., Volume 21, Number 6, December, 1999 728-737

Homologous Human and Murine Antisense Oligonucleotides Targeting Stat6
Functional Effects on Germline C Transcript

Sandra Hill, Ellen Herlaar, Agnès Le Cardinal,^* Gino van Heeke, and Paul Nicklin

Molecular and Cell Biology Unit, Novartis Horsham Research Centre, West Sussex, United Kingdom

Interleukin (IL)-4 and (IL)-13 induce immunoglobulin (Ig)E synthesis via activation of the transcription factor signal transducer and activator of transcription (Stat)6. The present study describes the identification and characterization of antisense oligonucleotides to Stat6 as an approach to interrupt IL-4 and IL-13 signaling and thereby to attenuate germline C transcription, a prerequisite to IgE synthesis. A limited gene-walk was performed with chemically modified oligonucleotides to identify sequences capable of downregulating both human and murine Stat6. A chimeric oligonucleotide (9b, base sequence GTGAGGTCCTGTTCAGTGGG) demonstrated high levels of antisense activity in both species. Further characterization of 9b showed a dose-dependent Stat6 messenger RNA (mRNA) and protein downregulation (concentration that produces 50% inhibition of effect = 168 and 215 nM, respectively) through a ribonuclease H-dependent antisense mechanism with no effect on closely related members of the Stat family. Further, pretreatment of DND39 cells (human Burkitt lymphoma cell line) with oligonucleotide 9b before IL-4 stimulation successfully downregulated germline C transcription. Because Stat6 represents an attractive but technically challenging drug discovery target, antisense oligonucleotides may provide an alternative approach to low molecular-weight compounds for inhibiting IL-4 and IL-13 signaling.

This article has been cited by other articles:

				L. Cannarile, F. Fallarino, M. Agostini, S. Cuzzocrea, E. Mazzon, C. Vacca, T. Genovese, G. Migliorati, E. Ayroldi, and C. Riccardi Increased GILZ expression in transgenic mice up-regulates Th-2 lymphokines Blood, February 1, 2006; 107(3): 1039 - 1047. [Abstract] [Full Text] [PDF]

				M. Jinnin, H. Ihn, K. Yamane, and K. Tamaki Interleukin-13 Stimulates the Transcription of the Human {alpha}2(I) Collagen Gene in Human Dermal Fibroblasts J. Biol. Chem., October 1, 2004; 279(40): 41783 - 41791. [Abstract] [Full Text] [PDF]

				R. Nagarkatti, C. B-Rao, V. Vijayan, S. K. Sharma, and B. Ghosh Signal Transducer and Activator of Transcription 6 Haplotypes and Asthma in the Indian Population Am. J. Respir. Cell Mol. Biol., September 1, 2004; 31(3): 317 - 321. [Abstract] [Full Text] [PDF]

				Q. Peng, T. Matsuda, and S. J. Hirst Signaling Pathways Regulating Interleukin-13-stimulated Chemokine Release from Airway Smooth Muscle Am. J. Respir. Crit. Care Med., March 1, 2004; 169(5): 596 - 603. [Abstract] [Full Text] [PDF]

				Z. Chen, R. Lund, T. Aittokallio, M. Kosonen, O. Nevalainen, and R. Lahesmaa Identification of Novel IL-4/Stat6-Regulated Genes in T Lymphocytes J. Immunol., October 1, 2003; 171(7): 3627 - 3635. [Abstract] [Full Text] [PDF]

				G. B. Ehret, P. Reichenbach, U. Schindler, C. M. Horvath, S. Fritz, M. Nabholz, and P. Bucher DNA Binding Specificity of Different STAT Proteins. COMPARISON OF IN VITRO SPECIFICITY WITH NATURAL TARGET SITES J. Biol. Chem., February 23, 2001; 276(9): 6675 - 6688. [Abstract] [Full Text] [PDF]