Introduction

Top Abstract Introduction Materials & Methods Results Discussion References

Elastin is an elastic structural protein that is a major component of the pulmonary interstitium and confers expansile properties on the lung. Tropoelastin, the soluble protein product of elastin gene expression, polymerizes to form insoluble elastin. Elastin gene expression is subject to developmental and tissue-specific regulation at the transcriptional and posttranscriptional levels, both in the lung and in cultured cells. The effects of various peptide growth factors on elastin gene expression have been studied in cultured cells. Interleukin-1 (IL-1) and tumor necrosis factor- (TNF-) have been shown to decrease elastin gene transcription in human dermal fibroblasts and rat vascular smooth-muscle cells (1, 2). Insulin-like growth factor-1 (IGF-1) increases elastin gene transcription in smooth-muscle cells by causing the displacement of negative regulatory factors from the elastin promoter-enhancer region (3, 4). Posttranscriptional regulatory mechanisms are also operative in cultured cells. Phorbol ester posttranscriptionally depresses tropoelastin mRNA in cultured bovine auricular chondrocytes, and vitamin D₃ has similar effects on both chondrocytes and RFL-6 cells, a continuous line of fetal rat pulmonary fibroblasts (5, 6). Studies by Swee and associates (7) indicate that an increase in elastin gene transcription accounts for the increase in the steady-state levels of tropoelastin mRNA in rat lungs between gestational day 19 and postnatal day 3. However, the stability of tropoelastin mRNA largely dictates the difference between the high steady-state levels of tropoelastin mRNA in neonatal and the low levels in adult rat lungs. Transforming growth factor-₁ (TGF-₁) increases transcription from a heterologous human elastin promoter- reporter construct in chick aortic smooth-muscle cells, but not in chick tendon fibroblasts (8). Since others have shown that exogenous TGF-₁ increases the half-life of tropoelastin mRNA in cultured human dermal fibroblasts, we hypothesized that a similar mechnism may be active in cultured neonatal rat lung fibroblasts (LF) (9). Furthermore, if endogenous TGF- controls LF elastin expression, then a posttranscriptional mechanism may account for this control. To approach these hypotheses we posed two questions: (1) Does exogenous TGF-₁ increase tropoelastin mRNA in cultured neonatal rat LF by a posttranscriptional mechanism? and (2) Can elastin gene expression be regulated by TGF- through an autocrine mechanism?

Mammals possess three genes, encoding TGF-₁, TGF-₂, and TGF-₃, respectively, that are widely expressed (10). The three gene products are highly homologous in their receptor binding and carboxyl terminus (approximately 12.5 kD), but differ more extensively in their amino-terminal latency-associated peptide (LAP, approximately 40 kD). Prepro-TGF- is secreted from cells as a disulfide-linked dimer. Prior to initiating a biologic effect, the 25-kD receptor-binding region must dissociate from the LAP, a process referred to as "biologic activation." Studies have shown that although TGF- isoforms exhibit 80% homology and function similarly in vitro, they are differentially expressed through physiologic processes, including embryogenesis (11). TGF-₂ has a more generalized distri-bution, whereas TGF-₃ shows minimal expression. TGF-₁ is prominently localized to the clefts of branching airways in the mouse lung on gestational days 11 through 15, and TGF-₂ and -₃ are more heavily expressed in the proximal than in the distal airways. TGF-₃ mRNA is very prominent in the mesothelial region at day 12.5. In postnatal mouse whole-lung tissue, each isoform has a distinct time of maximal expression. For example, with TGF-₂, mRNA is most abundant at day 3, whereas TGF-₁ mRNA expression peaks at postnatal days 8 through 12, and TGF-₃ mRNA expression is maximal at postnatal day 8 (14).

We have previously shown that exogenous TGF-₁ increases tropoelastin mRNA and tropoelastin in primary cultures of neonatal rat lung fibroblasts, and that these cells produce TGF- (15, 16). To further define the action of TGF-₁ on elastin gene expression in these cells, we have examined elastin gene transcription and mRNA half-life in LF incubated in the presence or absence of TGF-₁. Defining the effects of TGF-₁ in these cells, in particular, is important for several reasons. First, the mechanisms whereby a particular peptide growth factor regulates elastin gene expression differ in various types of cells. For example, IL-1 increases elastin gene transcription in human dermal fibroblasts, in which basal elastin expression is relatively low, whereas it decreases tropoelastin mRNA in neonatal rat lung fibroblasts, which have a high basal level of elastin expression (1, 17). In addition, glucocorticoids increase elastin expression in cultured bovine nuchal ligament fibroblasts and in fetal rat lung, but decrease elastin expression in human dermal fibroblasts (18). Second, our long-term objective is to identify regulatory factors that promote elastin synthesis in developing or injured lung parenchyma. Therefore, it seemed important to define these factors in pulmonary fibroblasts, which are a major source of alveolar septal elastin. To better characterize the elastogenic potential of endogenous TGF- produced by LF in culture, we have examined TGF- isoforms and their effects on tropoelastin production. We also defined the TGF- isoforms that are present in developing rat pulmonary alveoli during the period of maximal elastin synthesis. These studies have shown that TGF-s influence elastin gene expression posttranscriptionally, and that they are autocrine regulators of elastin production by cultured LF.

	Materials and Methods

Top Abstract Introduction Materials & Methods Results Discussion References

Isolation and Culture of Rat Lung Fibroblasts

Specific pathogen-free, timed-pregnant female Sprague- Dawley rats were obtained from Harlan-Sprague-Dawley (Madison, WI) and maintained in Thorne cages to filter the incoming air. Sentinel animals were monitored for respiratory pathogens, and none were detected during the course of the study. Animals were fed standard Purina rat chow and water ad libitum. Lipid-laden fibroblasts (lipid interstitial cells) were isolated from the animals' lungs at 8 days after birth and cultured as previously described (21). Twelve hours prior to adding TGF-₁ (isolated from porcine platelets; R&D Systems, Minneapolis, MN), the cell layers were washed to remove residual serum and the medium was changed to MCDB-201 containing 2 mg of human serum albumin, 100 U of penicillin, and 100 µg of streptomycin per milliliter. Using this serum-free medium minimized the effects of TGF-₁ that is present in serum.

Oligodeoxynucleotide Synthesis

Antisense and missense (scrambled sequence) oligodeoxynucleotides were designed to correspond to the sequence flanking the translational start site of rat TGF-₁ and mouse TGF-₂ and TGF-₃ (22, 23). Automated solid-phase synthesis of oligodeoxynucleotides, using phosphoramidite chemistry and an Applied Biosystems (Foster City, CA) synthesizer, was done in the University of Iowa DNA core laboratory (24). The oligodeoxynucleotides contained phosphorothioate linkages in the first three and last five phosphodiester linkages, to confer greater resistance to degradation by nucleases. The sequences were as follows: antisense TGF-₁: 5'AGCCCCGAGGGCGGCATG; antisense TGF-₂: 5'CAGACAGTAGTGCATGTTTTT; antisense TGF-₃: CCTTTGCAAGTGCATCTTCAT; and missense: GGCGAGCGAGTGAGCGCGCGG. The oligodeoxynucleotides were deprotected, desalted, and dissolved in water. Prior to addition to cell cultures, the oligodeoxynucleotides were dried in a Speed-Vac apparatus (Savant Instruments, Farmingdale, NY), washed three times with 90% ethanol, dried, and resuspended in sterile water.

Blocking TGF- Activity with Isoform-specific Anti-TGF- Antibodies or TGF- Antisense Oligodeoxynucleotides

To demonstrate whether endogenous TGF-s regulate tropoelastin production, LF cultures were used 6 days after subcultivation into 24-well plates. The culture medium was changed to serum-free MCDB-201 and the wells were supplemented with 40 µg/ml of chicken anti-TGF-₁, rabbit anti-TGF-₂, a pan-specific rabbit anti-TGF- neutralizing antibody (all from R&D Systems), or the corresponding nonimmune IgGs, and cultured for 12 h at 37°C in 5% CO₂. The media were changed and fresh media were added that had the same composition as those used during the preceding 12 h, except that they also contained 25 µg/ml of -aminoproprionitrile. -aminoproprionitrile decreases the incorporation of soluble tropoelastin into insoluble elastin, and therefore facilitates quantitation of soluble elastin in cell cultures. After incubating for an additional 24 h, the media and cell layers were collected for analysis of soluble elastin with an enzyme-linked immunosorbent assay (ELISA) (16). The ELISA detects 75-kD tropoelastin and other, smaller immunoreactive elastin peptides. These will collectively be referred to as soluble elastin. To normalize the data to the quantity of DNA per well, the DNA content in an aliquot of the cell layer was assayed (25). When tropoelastin mRNA was analyzed, the incubations with antibodies proceeded for 24 h in 12-well tissue culture plates.

To determine how limiting TGF- synthesis alters tropoelastin levels, LF were incubated with TGF- oligodeoxynucleotides on and after the fifth day following the second subcultivation. The cell layers, in 12-well plates, were washed and the medium was changed to 0.6 ml of Opti-MEM (GIBCO-BRL, Grand Island, NY) containing 20 µg/ml of Lipofectamine cationic liposomes (GIBCO-BRL) in the presence or absence of 1 µM oligonucleotides, without serum or antibiotics. Initially, various concentrations of oligonucleotides were used to establish the concentration that maximally reduced TGF- and elastin proteins. These studies established that 1 µM antisense TGF-₁ produced the optimum reduction in the biologic activity of TGF- in the mink lung epithelial cell growth-inhibition assay, with the least toxicity (lactic dehydrogenase release into the culture medium). After 4 h at 37°C, the wells were supplemented with 0.6 ml of Opti-MEM containing 200 U of penicillin and 200 µg of streptomycin per milliliter, and 5% platelet-depleted, plasma-derived bovine serum (Biomedical Technologies Inc., Stoughton, MA). Since the serum is prepared after the platelets are removed, it contains less TGF-₁ than the usual bovine calf serum. The incubations were continued for an additional 24 h. The cell layers were then washed and the media were changed to MCDB-201 containing 2 mg of human serum albumin and 25 µg of -aminoproprionitrile per milliliter. The media were conditioned for another 12 h and then collected for quantitation of soluble elastin protein and TGF- biologic activity by analysis of the growth-inhibition of mink lung epithelial cells (26). The cell layers were used to isolate RNA (21).

Analysis of the Steady-state Level of Tropoelastin mRNA in Response to TGF-₁

Total RNA was isolated from LF that were either exposed to 100 pM TGF-₁ for 12 h or remained unexposed (control), using guanidinium thiocyanate (21). Eight micrograms of total RNA was subjected to Northern blot analysis (21). The nylon membranes were probed successively with complementary DNAs (cDNAs) for rat tropoelastin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) that were labeled by random priming (15). Because GAPDH expression is unaffected by TGF-, GAPDH mRNA was used to normalize for differences in the quantities of RNA that were loaded onto the gels (15). The autoradiograms were analyzed using a Shimadzu CS-9000U densitometer (Shimadzu, Columbia, MD) in the "zigzag" mode in order to accurately quantitate irregularly shaped bands. The ratios of the density of tropoelastin mRNA to GAPDH mRNA for samples from cells that had been exposed to TGF-₁ were expressed as the fold increase over the ratio for control samples.

Transfection of LF with a Human Elastin Promoter Construct

Transient transfections of LF were done with calcium phosphate-DNA coprecipitation (27). A heterologous construct (pEP62-5CAT), which contained 2,260 bp of the human elastin gene located 5' to the translational start site linked to the chloramphenicol transferase (CAT) coding region, was introduced into LF (27). Following a 12-h exposure to calcium phosphate, the cells were maintained for 2 h in 5% newborn bovine calf serum (Hyclone, Logan, UT). The cells were then washed and maintained for an additional 48 h in MCDB-201 containing 2 mg of human serum albumin with or without 100 pM TGF-₁. An expression plasmid containing the SV40 early promoter and the -galactosidase gene was cotransfected with the pEP62-5CAT reporter construct to normalize for transfection efficiency. CAT and -galactosidase assays were performed as previously described, except that the reactions proceeded for 2 h rather than 1 h (27).

Analysis of the Initiation Rate of Elastin Gene Transcription in Isolated Nuclei

For experiments on the initiation rate of elastin gene transcription in isolated nuclei, LF were cultured in 100-mm culture dishes for 10 days after the first subcultivation. During the last 12 h, groups of four plates were supplemented with 40 or 100 pM TGF-₁ or remained unsupplemented as controls. After this 12-h period, nuclei were isolated as previously described (25). The nuclear RNA was extended by in vitro transcription, following a modified procedure as described by Greenberg and Ziff, which has been provided in detail (25, 28).

Cationic nylon (Nytran; Schleicher and Schuell, Keene, NH) filters were prepared containing 5 µg of plasmid DNA incorporating a cDNA insert for rat GAPDH or rat elastin (RE2), or 5 µg of the parent plasmids PBR322 and pBluescript, respectively. Autoradiograms were exposed for 48 to 120 h and densitometry was performed. In order to obtain the specific density, the densitometric reading for slots containing only the plasmids was subtracted from the densitometric reading for slots that contained the plasmid plus the insert. For the control and RA-exposed cells, the specific densities of the slots containing elastin cDNA were divided by the specific densities of the slots containing the GAPDH insert for the respective treatment condition. This normalization compensated for differences in overall transcription related to minor inequalities in the number of nuclei used.

Analysis of Effect of TGF-₁ on Tropoelastin mRNA Stability

The effect of TGF-₁ on the half-life of tropoelastin mRNA was examined by pulsing LF with (³H)-uridine followed by chasing for various periods in the presence or absence of TGF-₁. Two 100-mm dishes of cells were used for each condition at each collection. The LF were cultured as previously described for 8 days following subcultivation. At this time, the medium was removed, the cell layers were washed with phosphate-buffered saline (PBS), and new medium containing 1.5% platelet-depleted, plasma-derived bovine serum, instead of bovine calf serum, was added. Certain plates received 40 pM TGF-₁, whereas others received an equivalent volume of the diluent as a control. Twelve hours later, the medium was changed to Dulbecco's modified Eagle's medium (DMEM) containing 5 mM glucosamine hydrochloride, 100 µg of streptomycin, 100 U of penicillin, 0.5 X minimal essential medium (MEM) nonessential amino acids (Sigma Chemical, St. Louis, MO), and prepulse medium. To deplete the intracellular pool of uridine, the cell layers were incubated for 1 h with glucosamine and washed, after which the medium was replaced with pulse medium that had the same composition as the prepulse medium except that it lacked glucosamine and instead contained 25 µCi/ml of [5,6-³H]-uridine/ml (35 to 50 Ci/mmol; DuPont-NEN, Wilmington, DE) and 1.5% platelet-depleted, plasma-derived bovine serum. The cultures that were previously exposed to TGF-₁ were maintained in medium containing 40 pM TGF-₁ and controls were maintained without TGF-₁. The pulse was continued for 8 h, the medium was removed, and after washing, DMEM (containing 5 mM cytidine, 5 mM unlabeled uridine, 100 µg of streptomycin, 100 U of penicillin, and 0.5 X MEM non-essential amino acids, with or without 40 pM TGF-₁ [chase medium]) was added. At various times after the chase was initiated, cytoplasmic RNA was isolated (29, 30). Each sample (obtained from two 100-mm plates) contained from 2 to 3 × 10⁷ cpm.

Plasmids containing 3 µg of RE2 cDNA, 3 µg of pBluescript vector, 15 µg of human 28S ribosomal RNA, or 15 µg of pGEM4Z vector were denatured, neutralized, and applied to nitrocellulose, using a slot-blot apparatus. After baking, strips of nitrocellulose containing the cDNAs for elastin, 28S rRNA, and the Bluescript SK and pGEM4Z vectors were rolled between two pieces of 125-µ nylon mesh and placed in 1.8-ml polypropylene vials (Costar Corp., Cambridge, MA) with rubber O rings.

Following prehybridization and hybridization, the filters were washed and treated with ribonuclease A (RNase A) (25). The slots containing the ³H-labeled RNA that had hybridized to a specific cDNA were excised and placed in 3a70 liquid scintillation fluid (Research Products International, Mt. Prospect, IL) and analyzed in a liquid scintillation spectrometer. In a typical experiment, the slots for elastin cDNA contained from 300 to 1,200 cpm, whereas the slots for 28S ribosomal RNA contained from 9,000 to 14,000 cpm. The slots for the plasmids alone contained from 90 to 150 cpm. To assess the quantity of ³H-uridine that was specifically bound to the elastin or 28S ribosomal cDNA, the ³H-uridine in the slots containing only the plasmids was subtracted from that in the slots containing the cDNA for each sample. The quantity of specifically bound ³H-uridine was divided by the quantity of ³H-uridine that was added to the hybridization, and the result was expressed as parts per million (ppm). To normalize for differences in the recovery of RNA, the ³H-uridine that was specifically bound to elastin was divided by the ³H-uridine that was specifically bound to 28S rRNA for each  sample.

Extraction of Lung Tissue for TGF- Bioassay

After perfusion with PBS, the lungs were dissected from neonatal rats on postnatal day 8 and from adult rats at 6 mo of age. The tissue was blotted on filter paper to remove excess PBS from the surface, and was weighed. The tissues were extracted with acid-ethanol following the procedure described by Khalil and associates (31). The protein content was assayed, and after neutralization followed by an appropriate dilution, the extracts were assayed for TGF- (26). Because the TGF- was activated during the extraction, latent TGF- was not quantified.

TGF- Bioassay as Mink Lung Cell Growth-inhibitory Activity

Mink lung epithelial cells (Mv1Lu, ATCC No. CCL64) were obtained from the American Type Culture Collection (Rockville, MD). The cells were maintained in Eagle's MEM containing 10% bovine calf serum, 1% nonessential amino acids (Sigma Chemical), 100 U of penicillin G, and 100 µg of streptomycin per milliliter. Subconfluent cells were harvested by trypsinization and aliquotted at 7 × 10³ cells per well in 96-well tissue culture plates (Costar Corp.). The cells were allowed 6 h to adhere and the media were replaced with conditioned media from LF cultures. The conditioned media were prepared for the TGF- bioassay by transient (30 min at 25°C) acidification (pH 2 to 3) followed by neutralization. Aliquots of the media were then mixed with Eagle's MEM containing 0.6% bovine calf serum, 1% nonessential amino acids, 10 mM 4-(2-hydroxyethyl)-1-piperazine-N'-2-ethanesulfonic acid (Hepes), and antibiotics. Previous studies showed that approximately 98% of the TGF-s in the conditioned media from cell cultures were in the latent form. Pilot assays using at least three dilutions of the conditioned media for every experiment were performed to establish the volumes of conditioned media required to decrease growth in a range that fell within the linear portion of the standard curve. Once these volumes were established, each sample was assayed in quadruplicate at two concentrations. To generate a standard curve, known quantities of TGF-₁ were mixed with medium of the same composition as the conditioned media. The medium was removed from the Mv1Lu cells and replaced with the samples of conditioned media or TGF-₁. After incubating for 40 h, the cells were pulsed for 6 h with 5 µCi/ml of [³H-methyl]thymidine with a specific radioactivity of 6.7 Ci/mmol (Dupont-NEN). After the pulse, the media were removed and the cells were fixed in situ, washed, lysed with 0.25 M NaOH, neutralized, and subjected to liquid scintillation spectrometry (26). Addition of an anti-TGF- neutralizing antibody to the conditioned media reduced growth inhibition by 99.5 ± 0.3% (mean ± SEM, n = 3), indicating that TGF- was responsible for the inhibition.

Immunohistochemical Staining of TGF-s

For LF cultures, cells were subcultured on glass chamber-slides that had been pretreated with 8 µg/ml of human fibronectin for 1 h at room temperature. Subconfluent cells were rinsed four times with PBS and fixed for 20 min at room temperature with 4% paraformaldehyde in 0.1 M sodium phosphate buffer, pH 7.5. To obtain lung tissue, rats were euthanized with ketamine and xylazine on postnatal days 2, 4, 8, and 14, their thoracic cavities were opened, and the heart and lungs were perfused with PBS followed by 4% paraformaldehyde in 0.1 M sodium phosphate buffer, pH 7.5. The trachea was cannulated and instilled with fixative at a pressure of 20 cm H₂O. After ligation of the trachea, the lungs, heart, and mediastinal structures were removed and fixed overnight at 4°C. The lobes of the fixed lungs were separated, embedded in paraffin, and 4 µm sections were cut. The sections were deparaffinized and incubated for 15 min in 0.3% Triton X-100 in 0.01 M Tris, pH 7.4, with 0.14 M NaCl (TBS). After briefly rinsing in TBS and absolute methanol, the endogenous peroxidase activity was quenched with 0.6% H₂O₂. The tissue sections, but not the cultured LF, were then treated for 30 min at 37°C with 1 mg/ml of hyaluronidase in 0.1 M sodium acetate, pH 5.5, with 0.14 M NaCl. After washing and incubating with 0.5% goat blocking serum, 2.5 µg/ml of isoform-specific TGF- antibodies (raised in rabbits and previously described), or an equivalent quantity of nonimmune rabbit IgG, were added in blocking serum (Vectastain Elite ABC Kit; Vector Laboratories, Burlingame, CA) (14). The specificity of each anti-TGF- antibody has been demonstrated in Western blot analyses using recombinant TGF-₁, TGF-₃, and native porcine TGF-₂ (14). The slides were incubated overnight at 4°C, rinsed, and then incubated with a biotin-conjugated goat anti-rabbit IgG, followed by avidin-biotin-complexed (ABC) horseradish peroxidase according to the instructions in the Vectastain kit. The peroxidase reaction was developed with 0.05% 3,3-diaminobenzidine HCl in 0.05 M Tris, pH 7.4, with 0.14 M NaCl, and 0.01% hydrogen peroxide for 2 to 2.5 min. The sections were counterstained with Harris or Gill's hematoxylin, dehydrated, and mounted. To allow a comparison of the TGF-s in lungs obtained from rats of different ages, sections from animals of several different ages were stained at the same time with the various antibodies, using the same procedure.

Statistical Analyses

The data from the study are expressed as means ± SEM. Comparisons of cultures in the absence of TGF-₁ with those in the presence of TGF-₁ were made by using Student's t test for paired variables (32). The half-life of elastin cytoplasmic mRNA was calculated through linear regression analysis. Multigroup analyses were done through a two-way analysis of variance (ANOVA) followed by a post hoc test using the multivariate general linear hypothesis module of Systat (Systat Inc., Evanston, IL). Differences were considered significant when P was less than 0.05.

	Results

Top Abstract Introduction Materials & Methods Results Discussion References

TGF-₁ Increases Tropoelastin mRNA in Lung Fibroblasts

The steady-state level of tropoelastin mRNA was quantified in cultures of lipid-laden interstitial pulmonary fibroblasts that were exposed to TGF-₁ for 12 h. The results from a representative experiment are shown in Figure 1. Densitometry of the Northern blots demonstrated that 100 pM TGF-₁ increased the steady-state level of tropoelastin mRNA by 1.8-fold. When the data from six experiments were combined, TGF-₁ was found to have increased the steady-state level of tropoelastin mRNA by 1.8 ± 0.7-fold (mean ± SEM, P < 0.05, Students t test for paired variables). These findings, using the lipid-laden subpopulation of lung fibroblasts, confirm our previous studies of a more heterogeneous population of neonatal rat lung fibroblasts that were isolated by adherence to tissue culture plastic rather than by density sedimentation (15).

View larger version (26K): [in this window] [in a new window]   Figure 1.   Effect of TGF-1 on the steady-state level of tropoelastin mRNA. Neonatal rat pulmonary lipid interstitial fibroblasts (LF) were exposed to 100 pM TGF-1 for 12 h or remained unexposed as controls. Northern blot analysis revealed a 3.5-kb mRNA when probed with a cDNA for rat elastin. The membrane was reprobed with a cDNA for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1.4 kb) to normalize for differences in the quantities of total RNA that were loaded.

Effect of TGF-₁ on Human Elastin Promoter Activity in Rat Lung Fibroblasts

To determine whether TGF-₁ increases elastin gene transcription, we evaluated the effects of 100 pM TGF-₁ (the concentration that our previous studies had shown to produce a maximal increase in the steady-state level of tropoelastin mRNA) on the activity of the human elastin promoter in transiently transfected LF (15). The elastin promoter was constitutively active in rat LF, but its activity was not altered by TGF-₁ (Figure 2). The data shown in Figure 2 are representative of three experiments that were averaged following densitometry. When LF were exposed to 100 pM TGF-₁, the quantity of acetylated chloramphenicol was 88.2 ± 4.2% of that in control cells (not significant, n = 3). These findings suggest that the TGF-₁-mediated increase in tropoelastin mRNA in LF does not result from an increase in transcription. Alternatively, the data may indicate that a TGF--responsive element is not contained within the first 2,260 bp upstream from the translational start site of the human elastin gene. To address the second possibility, we quantified endogenous elastin gene transcription in LF that had been exposed to TGF-₁.

View larger version (53K): [in this window] [in a new window]   Figure 2.   TGF-1 does not alter human elastin promoter activity in rat lung fibroblasts. Neonatal rat pulmonary fibroblasts were transfected with a reporter construct containing the 2,260 bp located 5' to the translation start site of the human elastin gene, linked to the chloramphenicol acetyl transferase (CAT) gene. Following transfection, the cells were exposed to 100 pM TGF-1 or remained unexposed (control) for 48 h. The cell layers were isolated and CAT and -galactosidase enzymatic assays were performed. The acetylated and unacetylated forms of chloramphenicol were separated by thin-layer chromatography.

TGF-₁ Does Not Increase the Initiation Rate of Elastin Gene Transcription

The results of a representative analysis of the in vitro transcription of nuclear RNA are shown in Figure 3. They demonstrate that elastin gene transcription is not increased when LF are exposed to 40 pM TGF-. The results from this analysis were combined with those from two similar experiments. Elastin gene transcription in the presence of TGF- was 87 ± 7% (mean ± SEM, n = 3, not significant) of that for control LF that were maintained in the absence of TGF-. Additional studies (not shown) demonstrated that elastin gene transcription is not significantly increased by 100 pM TGF-.

View larger version (22K): [in this window] [in a new window]   Figure 3.   TGF-1 does not alter the rate of elastin gene transcription. In vitro transcription of nuclear RNA isolated from neonatal rat pulmonary fibroblasts exposed to 40 pM TGF-1 or that remained unexposed as controls. The nuclear RNA was labeled with 32P-UTP and then hybridized with cDNA for rat elastin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), or the parent plasmids that contained the cDNA inserts (Bluescript and pBR322, respectively). The autoradiogram was exposed for 120 h.

TGF-₁ Increases Tropoelastin mRNA Stability

The results of a representative study of the effects of TGF-₁ on tropoelastin mRNA stability are shown in Figure 4. When the data from this experiment were combined with those from two similar experiments, the mean half-lives of tropoelastin cytoplasmic mRNA were 25 ± 3 h and 17 ± 1 for LF that were exposed to TGF-₁ and unexposed controls, respectively (mean ± SEM, n = 3, P < 0.02, t test for paired variables). These findings indicate that TGF-₁ stabilizes tropoelastin mRNA and thereby increases the steady-state level of tropoelastin mRNA. The half-life of tropoelastin mRNA is similar to that observed by others (approximately 20 h) in bovine auricular chondrocytes, but is longer than the reported half-life of tropoelastin mRNA in human dermal fibroblasts (5, 9).

View larger version (13K): [in this window] [in a new window]   Figure 4.   TGF-1 increases tropoelastin mRNA stability. Pulmonary fibroblast cultures exposed to 40 pM TGF-1 (dotted line) or that remained unexposed as controls (solid line) were pulsed with 3H-uridine and then chased for up to 50 h. Cytoplasmic RNA was isolated after increasing chase times, and was then hybridized with cDNAs for rat elastin or human 28S rRNA. The 3H-uridine present in tropoelastin mRNA was expressed as parts per million (ppm) of the initial counts per minute (cpm) of RNA that were added to the hybridization reaction (see MATERIALS AND METHODS). The quantity of 3H-uridine that hybridized to 28S rRNA was used to normalize for differences in the recovery of RNA.

Endogenous TGF-₁ and TGF-₂ Modulate Tropoelastin Gene Expression in LF

Immunostaining of cultured LF with TGF- isoform-specific antibodies demonstrated the presence of endogenous TGF-₁ and TGF-₂ (see Figure 5a through c), but not TGF-₃ (data not shown). To determine whether endogenously produced TGF-s stimulate elastin production by these cells, we disrupted the biologic effects of TGF-s by adding neutralizing antibodies or antisense oligodeoxynucleotides to the culture. Tropoelastin protein in the conditioned medium was assayed with an ELISA, whereas Northern blot analysis was used to quantify tropoelastin and GAPDH mRNAs. Addition of a pan-specific neutralizing antibody significantly diminished both tropoelastin protein (Figure 6A) and mRNA (Figure 6B). The isoform-specific antibodies against both TGF-₁ and TGF-₂ produced significant reductions in tropoelastin protein. However, only anti-TGF-₁ significantly reduced tropoelastin mRNA (Figure 6B). The reduction observed with anti-TGF-₂ was not statistically significant. The pan-specific antibody produced an additional reduction in tropoelastin protein as compared either with the specific anti-TGF-₁ or the TGF-₂ antibody. It is noteworthy that the pan-specific antibody did not completely abrogate tropoelastin mRNA and protein, suggesting that other endogenous factors contribute to elastin gene expression in LF.

View larger version (114K): [in this window] [in a new window]   Figure 5.   Identification of TGF- isoforms in cultured rat lung fibroblasts (LF) (a through c) and lung tissues (d through h) using immunohistochemistry. Lungs from rats at postnatal day 8 (d, f through h) and from adults (e) were fixed and processed and LF were cultured, as described in the MATERIALS AND METHODS section. After quenching of endogenous peroxidase and treatment of the tissue sections with hyaluronidase, the cultured LF and lung tissue were incubated overnight with 2.5 µg/ml rabbit anti-TGF-1 (a, e, and f  ), 2.5 µg/ ml rabbit anti-TGF-2 (b and g), 2.5 µg/ml rabbit anti-TGF-3 (h) or 2.5 µg/ml of rabbit IgG (c and d). The slides were then washed and incubated with the reagents in the Vectastain ABC kit, and the peroxidase reaction was developed with diaminobenzidine to yield an insoluble brown product. The slides were counterstained with hematoxylin. SA = small airway, LA = large airway, P = pleural mesothelial surface. Bar is 50 µ long.

View larger version (47K): [in this window] [in a new window]   View larger version (63K): [in this window] [in a new window]   Figure 6.   Neutralizing anti-TGF- antibodies decrease soluble elastin in lung fibroblast (LF) cultures. (a) Postconfluent LF cultures in 24-well plates were incubated in serum-free medium for 36 h in the presence and absence of a neutralizing anti-TGF-1 (from chicken), an equivalent amount of nonimmune chicken IgG (chick IgG), neutralizing anti-TGF-2, neutralizing anti-pan TGF- (which neutralizes TGF-1, TGF-2, and TGF-3), or an equivalent amount of nonimmune rabbit IgG. Controls were incubated in serum-free medium without antibodies and nonimmune IgG. During the last 24 h the culture medium was collected and subsequently assayed for soluble elastin with an ELISA. Bars are the means and vertical brackets are 1 SEM. **P < 0.01, n = 3 wells from one experiment that was representative of the three experiments that were performed. (b) Cultures of postconfluent LF were maintained as described in (a) in 12-well plates. The cell layers were collected and total RNA was isolated. Northern blot analysis was performed as outlined in the legend to Figure 1 and in MATERIALS AND METHODS. GAPDH = glyceraldehyde 3-phosphate dehydrogenase. *P < 0.05, n = 3 for all conditions.

Antisense oligonucleotides were used as an alternate strategy to disrupt endogenous TGF- production, and the effects of this disruption on elastin gene expression were analyzed. The oligodeoxynucleotides were designed to decrease the synthesis of TGF-₁, TGF-₂, or TGF-₃ proteins by the LF. The combined activities of all TGF-s in the conditioned media, including the latent and endogenously active forms of both TGF-₁ and TGF-₂, were assayed for their growth-inhibitory activity in Mv1Lu cell cultures. The results of a representative analysis are shown in Figure 7A. Either 1 or 2.5 µM antisense TGF-₁ significantly decreased TGF- biologic activity in the transiently acidified conditioned medium. However, neither antisense TGF-₂ nor antisense TGF-₃ (data not shown) produced a significant reduction in TGF- as compared with the missense control. Only antisense TGF-₁ produced a significant reduction in soluble elastin protein, as is shown in Figure 7B. Antisense TGF-₂ and TGF-₃ did not reduce soluble elastin (data not shown). The effects of antisense TGF-₁ on tropoelastin mRNA are shown in Figure 8A. Addition of 1 µM antisense TGF-₁ caused a mean reduction in tropoelastin mRNA of 33% from the missense control in three separate experiments. A representative Northern blot analysis from one of these experiments is shown in Figure 8B. The magnitude of the reduction in tropoelastin mRNA (33%) was similar to the reduction observed in tropoelastin protein in the presence of 1 µM antisense TGF-₁. Since antisense TGF-₂ and TGF-₃ oligonucleotides did not significantly reduce TGF- biologic activity, their effects on tropoelastin mRNA were not analyzed.

View larger version (28K): [in this window] [in a new window]   View larger version (29K): [in this window] [in a new window]   Figure 7.   TGF-1 antisense oligodeoxynucleotides decrease TGF- and soluble elastin in lung fibroblast (LF) cultures. (a) Confluent cultures of LF in 48-well plates were transfected with oligodeoxynucleotides (antisense, containing the nucleotides in the antisense strand flanking the translation start site for TGF-1 or TGF-2; or missense, a scrambled sequence used as an irrelevant DNA control) or medium only, in the absence of any oligonucleotides or liposomes. During the final 12 h, serum-free media were conditioned. They were then transiently acidified (activated) and used to assay TGF- biologic activity by inhibiting mink lung epithelial cell (Mv1Lu) growth. Bars are the means and vertical brackets are 1 SEM. **P < 0.01, n = 3 wells from one experiment that was representative of four that were performed. (b) The soluble elastin in the conditioned media was quantified with an ELISA and normalized to the DNA content per well (see MATERIALS AND METHODS). *P < 0.05, n = 3 experiments in which each condition had three wells.

View larger version (28K): [in this window] [in a new window]   View larger version (32K): [in this window] [in a new window]   Figure 8.   TGF-1 antisense oligodeoxynucleotides decrease tropoelastin mRNA in lung fibroblast (LF) cultures. (a) Confluent cultures of LF in 12-well plates were transfected as described in the legend to Figure 7. Cell layers were collected, total RNA isolated, and Northern blot analyses performed as described in MATERIALS AND METHODS and the legend to Figure 1. Bars are the means and vertical brackets are 1 SEM. *P < 0.05, n = 3 experiments. (b) A representative autoradiogram for a Northern blot analysis from one of the three experiments included in (a). Lane 1: control containing medium only; lane 2: 1 µM TGF-1 antisense oligodeoxynucleotide; Lane 3, 1 µM missense oligodeoxynucleotide.

TGF- Isoforms in Neonatal and Adult Rat Lung Tissues

The temporal and spatial distributions of TGF-₁, TGF-₂, and TGF-₃ were compared on several days during early postnatal life and in adults. Representative results are shown in Figure 5 for lung tissue obtained at postnatal day 8 and from an adult. The spatial distribution and intensity of staining of each isotype were similar at postnatal days 2, 4, 8, and 12. Therefore, data are shown only for lungs obtained at day 8 and from an adult. TGF-₁ was present generally in the small airways and alveolar septa, and was abundant in the mesothelium and subpleural alveoli. TGF-₂ was also observed in these regions; however, immunoreactivity was most intense in the airways. TGF-₃ stained prominently in airways and alveoli, and was most abundant in the mesenchyme surrounding airways and blood vessels. In adult lungs, the three isoforms showed spatial distributions that were similar to those observed in the neonate, and only the data for TGF-₁ are shown. The combined biologic activities of the TGF- isoforms were quantified in neonatal and adult lungs using the mink lung epithelial cell growth-inhibition assay. Lungs that were isolated on the 8th postnatal day contained 4.1 ± 1.1 pg of TGF-/µg protein (n = 3), whereas adult lungs contained only 0.9 ± 0.1 pg/µg protein (n = 3) (P < 0.01). These data represent the antipan-TGF- antibody-inhibitable suppression of mink lung cell growth, which accounted for 54.5 ± 9.6% of the total growth suppression. Since all of the latent TGF- was activated during the extraction procedure, endogenously active TGF-s could not be quantified.

	Discussion

Top Abstract Introduction Materials & Methods Results Discussion References

We have demonstrated that exogenous TGF-₁ increases elastin gene expression in neonatal rat LF by increasing the stability of tropoelastin mRNA, rather than by increasing the level of transcriptional initiation. The approximately 1.5-fold increase in tropoelastin mRNA stability observed in cultured LF is similar to the 1.8-fold increase in the steady-state level of tropoelastin mRNA that we observed in LF exposed to TGF-₁. Although the magnitude of the TGF--related change in elastin expression is relatively small, it is comparable with the levels of induction (1.5- to 3-fold) of tropoelastin mRNA that others have observed using peptide growth factors, including TGF-₁ (15, 17). We have also shown that LF cultures contain TGF-₁ and TGF-₂, and that endogenous TGF-s produced by these cells regulate elastin gene expression in an autocrine manner.

We confirmed our previously published findings to establish that the TGF-₁-mediated increase in the steady-state level of tropoelastin mRNA in the lipid-laden subpopulation of neonatal rat lung fibroblasts is similar to that in the more heterogeneous population that we studied earlier (15). Confirmation of this was important, because others have reported that TGF-₁ does not increase tropoelastin mRNA in this subpopulation of lipid-laden fibroblasts (1). The divergence of our findings from those of Berk and associates (1) may reflect differences in culture conditions. We used cells that had been confluent for 4 or 5 days and were maintained under serum-free conditions immediately prior to and during exposure to TGF-₁. Berk and coworkers (1) studied the same subpopulation of fibroblasts approximately 24 h after they reached confluence, and the fetal bovine serum concentration was reduced to 0.4%.

The antisense TGF- oligodeoxynucleotides used in our study were less effective than the anti-TGF- antibodies in reducing elastin gene expression. The failure of the antisense TGF-₂ oligonucleotide to measurably reduce the total biologic activity of TGF- may be partly due to the observation that TGF-₁ is more abundant in LF cultures and accounts for more of the biologic activity of TGF-. However, TGF-₂ does apparently influence elastin production, since we observed that anti-TGF-₂ antibody significantly decreased soluble elastin protein. Additional studies in our laboratory have shown that exogenous TGF-₂ increases tropoelastin mRNA when added to LF cultures (unpublished data). The antisense TGF-₂ construct was complementary to the mouse TGF-₂ nucleotide sequence instead of to a rat sequence, whereas the nucleotide for TGF-₁ was complementary to the rat sequence. Thus, the mouse TGF-₂ oligonucleotide may hybridize less efficiently with the rat mRNA, and may therefore be less effective than the antisense TGF-₁ nucleotide in disrupting TGF- synthesis.

The TGF-₁ antisense oligonucleotide was also less effective than the anti-TGF-₁ neutralizing antibody in reducing elastin production. The lower efficacy of the TGF-₁ antisense construct may relate to the longer time required for the oligonucleotides to alter elastin expression. The antisense oligonucleotides must interrupt TGF- protein production to exert their effect on elastin. Thus, the level of previously synthesized TGF- would have to decay before the effect on elastin gene expression could be detected. The half-life of TGF- proteins in LF cultures is not known, but it is likely to be considerably longer than 24 h. TGF-₁ that is produced by erythroleukemia cells during a 1.5-h pulse is still very abundant in the culture medium after a 72 h chase (33). In contrast, the neutralizing antibodies could immediately interfere with TGF- function and thereby reduce elastin expression. In our experimental protocol, the cells were incubated for 40 h after exposure to the antisense oligonucleotides before RNA isolation. Since the half-life of tropoelastin mRNA is approximately 17 h, it is likely that no more than one half-life transpired after TGF- protein levels decreased. This would produce, at most, a 50% reduction in elastin. The observed level of reduction, after exposure to antisense TGF-₁ nucleotides, was approximately 33% for both tropoelastin mRNA and protein. This is comparable to the reductions in TGF--mediated biologic effects that others have observed in vascular smooth-muscle cells with antisense TGF-₁ constructs, and in glucocorticoid-stimulated fetal rat lung fibroblasts with antisense TGF-₃ (34-36). Thus, although the antisense-mediated reductions in tropoelastin are relatively small, they are consistent with our results obtained with neutralizing antibodies. Taken together, these studies indicate that endogenous TGF-s can regulate tropoelastin production by neonatal LF in vitro.

Our immunohistochemical studies demonstrated that the TGF-₁ and TGF-₂ isoforms are the most abundant in cultured LF, whereas all three TGF- isoforms are present in the neonatal and adult rat lung. All three isoforms are found in the alveolar walls, and therefore are in close proximity to alveolar fibroblasts. Our observation that TGF-₁ is present in neonatal and adult rat pulmonary alveoli, as in cultured LF, indicates that TGF-₁ expression by cultured LF is not an artifact of the culture system (37). Our findings are in accord with those of others who have studied rodent lung fibroblasts and lungs (38, 39). However, our findings in rats differ from those in humans, in whom TGF-₁ is observed only in diseased lungs (40). The higher quantities of TGF-s in the subpleural region are an interesting finding in that this region corresponds to the region of maximal alveolar growth observed by Massaro and Massaro (41).

Further experimentation is required to determine whether TGF-s can also posttranscriptionally regulate elastin gene expression in the lung. However, on the basis of the current data, we hypothesize that age-related differences in the quantities of biologically active TGF-s in rat lungs could contribute to the age-related differences in tropoelastin mRNA stability that were observed by Swee and colleagues (7). This hypothesis is supported by our observation that the mean amount of total TGF-s (latent plus endogenously active) in the lungs of 8-day neonates is 4.5-fold greater than that in adult rat lungs. However, only a portion of these TGF-s would be endogenously active in vivo. Therefore, the relationship between endogenously active TGF-s and elastin gene expression must be elucidated. Our future studies will more directly address this hypothesis in order to further define the mechanisms of posttranscriptional regulation of elastin gene expression in the lung.