help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McGowan, S. E.
Right arrow Articles by Gold, L. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McGowan, S. E.
Right arrow Articles by Gold, L. I.
Am. J. Respir. Cell Mol. Biol., Volume 17, Number 1, July 1997 25-35

Exogenous and Endogenous Transforming Growth Factors-beta Influence Elastin Gene Expression in Cultured Lung Fibroblasts

Stephen E. McGowan, Sheila K. Jackson, Paula J. Olson, Trilok Parekh, and Leslie I. Gold

Department of Veterans Affairs Research Service, Washington, District of Columbia; University of Iowa College of Medicine, Iowa City, Iowa; and Department of Pathology, New York University, New York City, New York


    Abstract
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Elastin, an important structural protein of the extracellular matrix, confers elastic properties on the pulmonary alveolar interstitium. In the alveolar wall, elastin is primarily produced postnatally by fibroblasts. The mechanisms that regulate lung fibroblast (LF) elastin gene expression have not been completely defined, although both transcriptional and posttranscriptional mechanisms appear to be involved. Transforming growth factors-beta (TGF-beta s) have been shown to increase elastin production by cultured neonatal rat LF. Analyses of elastin gene transcription and mRNA stability indicate that exogenous TGF-beta 1 increases the half-life of tropoelastin mRNA by 1.5-fold and does not alter elastin gene transcription. Interference with the functions of endogenous TGF-beta 1 in cultured LF, through the addition of neutralizing antibodies or antisense oligodeoxynucleotides, decreases tropoelastin and tropoelastin mRNA production by these cells. The content of total (latent plus active) TGF-beta s was approximately 4.5-fold greater in lungs obtained from rats on postnatal day 8 than in lungs obtained from adults. These findings indicate that endogenous TGF-beta s, in cultured LF, regulate elastin gene expression, most likely by a posttranscriptional mechanism. Since others have shown that elastin mRNA appears to have a longer half-life in neonatal than in adult rat lungs, we hypothesize that the higher content of TGF-beta s could contribute to the greater elastin mRNA stability in neonatal lungs.


    Introduction
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Elastin is an elastic structural protein that is a major component of the pulmonary interstitium and confers expansile properties on the lung. Tropoelastin, the soluble protein product of elastin gene expression, polymerizes to form insoluble elastin. Elastin gene expression is subject to developmental and tissue-specific regulation at the transcriptional and posttranscriptional levels, both in the lung and in cultured cells. The effects of various peptide growth factors on elastin gene expression have been studied in cultured cells. Interleukin-1beta (IL-1beta ) and tumor necrosis factor-alpha (TNF-alpha ) have been shown to decrease elastin gene transcription in human dermal fibroblasts and rat vascular smooth-muscle cells (1, 2). Insulin-like growth factor-1 (IGF-1) increases elastin gene transcription in smooth-muscle cells by causing the displacement of negative regulatory factors from the elastin promoter-enhancer region (3, 4). Posttranscriptional regulatory mechanisms are also operative in cultured cells. Phorbol ester posttranscriptionally depresses tropoelastin mRNA in cultured bovine auricular chondrocytes, and vitamin D3 has similar effects on both chondrocytes and RFL-6 cells, a continuous line of fetal rat pulmonary fibroblasts (5, 6). Studies by Swee and associates (7) indicate that an increase in elastin gene transcription accounts for the increase in the steady-state levels of tropoelastin mRNA in rat lungs between gestational day 19 and postnatal day 3. However, the stability of tropoelastin mRNA largely dictates the difference between the high steady-state levels of tropoelastin mRNA in neonatal and the low levels in adult rat lungs. Transforming growth factor-beta 1 (TGF-beta 1) increases transcription from a heterologous human elastin promoter- reporter construct in chick aortic smooth-muscle cells, but not in chick tendon fibroblasts (8). Since others have shown that exogenous TGF-beta 1 increases the half-life of tropoelastin mRNA in cultured human dermal fibroblasts, we hypothesized that a similar mechnism may be active in cultured neonatal rat lung fibroblasts (LF) (9). Furthermore, if endogenous TGF-beta controls LF elastin expression, then a posttranscriptional mechanism may account for this control. To approach these hypotheses we posed two questions: (1) Does exogenous TGF-beta 1 increase tropoelastin mRNA in cultured neonatal rat LF by a posttranscriptional mechanism? and (2) Can elastin gene expression be regulated by TGF-beta through an autocrine mechanism?

Mammals possess three genes, encoding TGF-beta 1, TGF-beta 2, and TGF-beta 3, respectively, that are widely expressed (10). The three gene products are highly homologous in their receptor binding and carboxyl terminus (approximately 12.5 kD), but differ more extensively in their amino-terminal latency-associated peptide (LAP, approximately 40 kD). Prepro-TGF-beta is secreted from cells as a disulfide-linked dimer. Prior to initiating a biologic effect, the 25-kD receptor-binding region must dissociate from the LAP, a process referred to as "biologic activation." Studies have shown that although TGF-beta isoforms exhibit 80% homology and function similarly in vitro, they are differentially expressed through physiologic processes, including embryogenesis (11). TGF-beta 2 has a more generalized distri-bution, whereas TGF-beta 3 shows minimal expression. TGF-beta 1 is prominently localized to the clefts of branching airways in the mouse lung on gestational days 11 through 15, and TGF-beta 2 and -beta 3 are more heavily expressed in the proximal than in the distal airways. TGF-beta 3 mRNA is very prominent in the mesothelial region at day 12.5. In postnatal mouse whole-lung tissue, each isoform has a distinct time of maximal expression. For example, with TGF-beta 2, mRNA is most abundant at day 3, whereas TGF-beta 1 mRNA expression peaks at postnatal days 8 through 12, and TGF-beta 3 mRNA expression is maximal at postnatal day 8 (14).

We have previously shown that exogenous TGF-beta 1 increases tropoelastin mRNA and tropoelastin in primary cultures of neonatal rat lung fibroblasts, and that these cells produce TGF-beta (15, 16). To further define the action of TGF-beta 1 on elastin gene expression in these cells, we have examined elastin gene transcription and mRNA half-life in LF incubated in the presence or absence of TGF-beta 1. Defining the effects of TGF-beta 1 in these cells, in particular, is important for several reasons. First, the mechanisms whereby a particular peptide growth factor regulates elastin gene expression differ in various types of cells. For example, IL-1beta increases elastin gene transcription in human dermal fibroblasts, in which basal elastin expression is relatively low, whereas it decreases tropoelastin mRNA in neonatal rat lung fibroblasts, which have a high basal level of elastin expression (1, 17). In addition, glucocorticoids increase elastin expression in cultured bovine nuchal ligament fibroblasts and in fetal rat lung, but decrease elastin expression in human dermal fibroblasts (18). Second, our long-term objective is to identify regulatory factors that promote elastin synthesis in developing or injured lung parenchyma. Therefore, it seemed important to define these factors in pulmonary fibroblasts, which are a major source of alveolar septal elastin. To better characterize the elastogenic potential of endogenous TGF-beta produced by LF in culture, we have examined TGF-beta isoforms and their effects on tropoelastin production. We also defined the TGF-beta isoforms that are present in developing rat pulmonary alveoli during the period of maximal elastin synthesis. These studies have shown that TGF-beta s influence elastin gene expression posttranscriptionally, and that they are autocrine regulators of elastin production by cultured LF.

    Materials and Methods
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Isolation and Culture of Rat Lung Fibroblasts

Specific pathogen-free, timed-pregnant female Sprague- Dawley rats were obtained from Harlan-Sprague-Dawley (Madison, WI) and maintained in Thorne cages to filter the incoming air. Sentinel animals were monitored for respiratory pathogens, and none were detected during the course of the study. Animals were fed standard Purina rat chow and water ad libitum. Lipid-laden fibroblasts (lipid interstitial cells) were isolated from the animals' lungs at 8 days after birth and cultured as previously described (21). Twelve hours prior to adding TGF-beta 1 (isolated from porcine platelets; R&D Systems, Minneapolis, MN), the cell layers were washed to remove residual serum and the medium was changed to MCDB-201 containing 2 mg of human serum albumin, 100 U of penicillin, and 100 µg of streptomycin per milliliter. Using this serum-free medium minimized the effects of TGF-beta 1 that is present in serum.

Oligodeoxynucleotide Synthesis

Antisense and missense (scrambled sequence) oligodeoxynucleotides were designed to correspond to the sequence flanking the translational start site of rat TGF-beta 1 and mouse TGF-beta 2 and TGF-beta 3 (22, 23). Automated solid-phase synthesis of oligodeoxynucleotides, using phosphoramidite chemistry and an Applied Biosystems (Foster City, CA) synthesizer, was done in the University of Iowa DNA core laboratory (24). The oligodeoxynucleotides contained phosphorothioate linkages in the first three and last five phosphodiester linkages, to confer greater resistance to degradation by nucleases. The sequences were as follows: antisense TGF-beta 1: 5'AGCCCCGAGGGCGGCATG; antisense TGF-beta 2: 5'CAGACAGTAGTGCATGTTTTT; antisense TGF-beta 3: CCTTTGCAAGTGCATCTTCAT; and missense: GGCGAGCGAGTGAGCGCGCGG. The oligodeoxynucleotides were deprotected, desalted, and dissolved in water. Prior to addition to cell cultures, the oligodeoxynucleotides were dried in a Speed-Vac apparatus (Savant Instruments, Farmingdale, NY), washed three times with 90% ethanol, dried, and resuspended in sterile water.

Blocking TGF-beta Activity with Isoform-specific Anti-TGF-beta Antibodies or TGF-beta Antisense Oligodeoxynucleotides

To demonstrate whether endogenous TGF-beta s regulate tropoelastin production, LF cultures were used 6 days after subcultivation into 24-well plates. The culture medium was changed to serum-free MCDB-201 and the wells were supplemented with 40 µg/ml of chicken anti-TGF-beta 1, rabbit anti-TGF-beta 2, a pan-specific rabbit anti-TGF-beta neutralizing antibody (all from R&D Systems), or the corresponding nonimmune IgGs, and cultured for 12 h at 37°C in 5% CO2. The media were changed and fresh media were added that had the same composition as those used during the preceding 12 h, except that they also contained 25 µg/ml of beta -aminoproprionitrile. beta -aminoproprionitrile decreases the incorporation of soluble tropoelastin into insoluble elastin, and therefore facilitates quantitation of soluble elastin in cell cultures. After incubating for an additional 24 h, the media and cell layers were collected for analysis of soluble elastin with an enzyme-linked immunosorbent assay (ELISA) (16). The ELISA detects 75-kD tropoelastin and other, smaller immunoreactive elastin peptides. These will collectively be referred to as soluble elastin. To normalize the data to the quantity of DNA per well, the DNA content in an aliquot of the cell layer was assayed (25). When tropoelastin mRNA was analyzed, the incubations with antibodies proceeded for 24 h in 12-well tissue culture plates.

To determine how limiting TGF-beta synthesis alters tropoelastin levels, LF were incubated with TGF-beta oligodeoxynucleotides on and after the fifth day following the second subcultivation. The cell layers, in 12-well plates, were washed and the medium was changed to 0.6 ml of Opti-MEM (GIBCO-BRL, Grand Island, NY) containing 20 µg/ml of Lipofectamine cationic liposomes (GIBCO-BRL) in the presence or absence of 1 µM oligonucleotides, without serum or antibiotics. Initially, various concentrations of oligonucleotides were used to establish the concentration that maximally reduced TGF-beta and elastin proteins. These studies established that 1 µM antisense TGF-beta 1 produced the optimum reduction in the biologic activity of TGF-beta in the mink lung epithelial cell growth-inhibition assay, with the least toxicity (lactic dehydrogenase release into the culture medium). After 4 h at 37°C, the wells were supplemented with 0.6 ml of Opti-MEM containing 200 U of penicillin and 200 µg of streptomycin per milliliter, and 5% platelet-depleted, plasma-derived bovine serum (Biomedical Technologies Inc., Stoughton, MA). Since the serum is prepared after the platelets are removed, it contains less TGF-beta 1 than the usual bovine calf serum. The incubations were continued for an additional 24 h. The cell layers were then washed and the media were changed to MCDB-201 containing 2 mg of human serum albumin and 25 µg of beta -aminoproprionitrile per milliliter. The media were conditioned for another 12 h and then collected for quantitation of soluble elastin protein and TGF-beta biologic activity by analysis of the growth-inhibition of mink lung epithelial cells (26). The cell layers were used to isolate RNA (21).

Analysis of the Steady-state Level of Tropoelastin mRNA in Response to TGF-beta 1

Total RNA was isolated from LF that were either exposed to 100 pM TGF-beta 1 for 12 h or remained unexposed (control), using guanidinium thiocyanate (21). Eight micrograms of total RNA was subjected to Northern blot analysis (21). The nylon membranes were probed successively with complementary DNAs (cDNAs) for rat tropoelastin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) that were labeled by random priming (15). Because GAPDH expression is unaffected by TGF-beta , GAPDH mRNA was used to normalize for differences in the quantities of RNA that were loaded onto the gels (15). The autoradiograms were analyzed using a Shimadzu CS-9000U densitometer (Shimadzu, Columbia, MD) in the "zigzag" mode in order to accurately quantitate irregularly shaped bands. The ratios of the density of tropoelastin mRNA to GAPDH mRNA for samples from cells that had been exposed to TGF-beta 1 were expressed as the fold increase over the ratio for control samples.

Transfection of LF with a Human Elastin Promoter Construct

Transient transfections of LF were done with calcium phosphate-DNA coprecipitation (27). A heterologous construct (pEP62-5CAT), which contained 2,260 bp of the human elastin gene located 5' to the translational start site linked to the chloramphenicol transferase (CAT) coding region, was introduced into LF (27). Following a 12-h exposure to calcium phosphate, the cells were maintained for 2 h in 5% newborn bovine calf serum (Hyclone, Logan, UT). The cells were then washed and maintained for an additional 48 h in MCDB-201 containing 2 mg of human serum albumin with or without 100 pM TGF-beta 1. An expression plasmid containing the SV40 early promoter and the beta -galactosidase gene was cotransfected with the pEP62-5CAT reporter construct to normalize for transfection efficiency. CAT and beta -galactosidase assays were performed as previously described, except that the reactions proceeded for 2 h rather than 1 h (27).

Analysis of the Initiation Rate of Elastin Gene Transcription in Isolated Nuclei

For experiments on the initiation rate of elastin gene transcription in isolated nuclei, LF were cultured in 100-mm culture dishes for 10 days after the first subcultivation. During the last 12 h, groups of four plates were supplemented with 40 or 100 pM TGF-beta 1 or remained unsupplemented as controls. After this 12-h period, nuclei were isolated as previously described (25). The nuclear RNA was extended by in vitro transcription, following a modified procedure as described by Greenberg and Ziff, which has been provided in detail (25, 28).

Cationic nylon (Nytran; Schleicher and Schuell, Keene, NH) filters were prepared containing 5 µg of plasmid DNA incorporating a cDNA insert for rat GAPDH or rat elastin (RE2), or 5 µg of the parent plasmids PBR322 and pBluescript, respectively. Autoradiograms were exposed for 48 to 120 h and densitometry was performed. In order to obtain the specific density, the densitometric reading for slots containing only the plasmids was subtracted from the densitometric reading for slots that contained the plasmid plus the insert. For the control and RA-exposed cells, the specific densities of the slots containing elastin cDNA were divided by the specific densities of the slots containing the GAPDH insert for the respective treatment condition. This normalization compensated for differences in overall transcription related to minor inequalities in the number of nuclei used.

Analysis of Effect of TGF-beta 1 on Tropoelastin mRNA Stability

The effect of TGF-beta 1 on the half-life of tropoelastin mRNA was examined by pulsing LF with (3H)-uridine followed by chasing for various periods in the presence or absence of TGF-beta 1. Two 100-mm dishes of cells were used for each condition at each collection. The LF were cultured as previously described for 8 days following subcultivation. At this time, the medium was removed, the cell layers were washed with phosphate-buffered saline (PBS), and new medium containing 1.5% platelet-depleted, plasma-derived bovine serum, instead of bovine calf serum, was added. Certain plates received 40 pM TGF-beta 1, whereas others received an equivalent volume of the diluent as a control. Twelve hours later, the medium was changed to Dulbecco's modified Eagle's medium (DMEM) containing 5 mM glucosamine hydrochloride, 100 µg of streptomycin, 100 U of penicillin, 0.5 X minimal essential medium (MEM) nonessential amino acids (Sigma Chemical, St. Louis, MO), and prepulse medium. To deplete the intracellular pool of uridine, the cell layers were incubated for 1 h with glucosamine and washed, after which the medium was replaced with pulse medium that had the same composition as the prepulse medium except that it lacked glucosamine and instead contained 25 µCi/ml of [5,6-3H]-uridine/ml (35 to 50 Ci/mmol; DuPont-NEN, Wilmington, DE) and 1.5% platelet-depleted, plasma-derived bovine serum. The cultures that were previously exposed to TGF-beta 1 were maintained in medium containing 40 pM TGF-beta 1 and controls were maintained without TGF-beta 1. The pulse was continued for 8 h, the medium was removed, and after washing, DMEM (containing 5 mM cytidine, 5 mM unlabeled uridine, 100 µg of streptomycin, 100 U of penicillin, and 0.5 X MEM non-essential amino acids, with or without 40 pM TGF-beta 1 [chase medium]) was added. At various times after the chase was initiated, cytoplasmic RNA was isolated (29, 30). Each sample (obtained from two 100-mm plates) contained from 2 to 3 × 107 cpm.

Plasmids containing 3 µg of RE2 cDNA, 3 µg of pBluescript vector, 15 µg of human 28S ribosomal RNA, or 15 µg of pGEM4Z vector were denatured, neutralized, and applied to nitrocellulose, using a slot-blot apparatus. After baking, strips of nitrocellulose containing the cDNAs for elastin, 28S rRNA, and the Bluescript SK- and pGEM4Z vectors were rolled between two pieces of 125-µ nylon mesh and placed in 1.8-ml polypropylene vials (Costar Corp., Cambridge, MA) with rubber O rings.

Following prehybridization and hybridization, the filters were washed and treated with ribonuclease A (RNase A) (25). The slots containing the 3H-labeled RNA that had hybridized to a specific cDNA were excised and placed in 3a70 liquid scintillation fluid (Research Products International, Mt. Prospect, IL) and analyzed in a liquid scintillation spectrometer. In a typical experiment, the slots for elastin cDNA contained from 300 to 1,200 cpm, whereas the slots for 28S ribosomal RNA contained from 9,000 to 14,000 cpm. The slots for the plasmids alone contained from 90 to 150 cpm. To assess the quantity of 3H-uridine that was specifically bound to the elastin or 28S ribosomal cDNA, the 3H-uridine in the slots containing only the plasmids was subtracted from that in the slots containing the cDNA for each sample. The quantity of specifically bound 3H-uridine was divided by the quantity of 3H-uridine that was added to the hybridization, and the result was expressed as parts per million (ppm). To normalize for differences in the recovery of RNA, the 3H-uridine that was specifically bound to elastin was divided by the 3H-uridine that was specifically bound to 28S rRNA for each  sample.

Extraction of Lung Tissue for TGF-beta Bioassay

After perfusion with PBS, the lungs were dissected from neonatal rats on postnatal day 8 and from adult rats at 6 mo of age. The tissue was blotted on filter paper to remove excess PBS from the surface, and was weighed. The tissues were extracted with acid-ethanol following the procedure described by Khalil and associates (31). The protein content was assayed, and after neutralization followed by an appropriate dilution, the extracts were assayed for TGF-beta (26). Because the TGF-beta was activated during the extraction, latent TGF-beta was not quantified.

TGF-beta Bioassay as Mink Lung Cell Growth-inhibitory Activity

Mink lung epithelial cells (Mv1Lu, ATCC No. CCL64) were obtained from the American Type Culture Collection (Rockville, MD). The cells were maintained in Eagle's MEM containing 10% bovine calf serum, 1% nonessential amino acids (Sigma Chemical), 100 U of penicillin G, and 100 µg of streptomycin per milliliter. Subconfluent cells were harvested by trypsinization and aliquotted at 7 × 103 cells per well in 96-well tissue culture plates (Costar Corp.). The cells were allowed 6 h to adhere and the media were replaced with conditioned media from LF cultures. The conditioned media were prepared for the TGF-beta bioassay by transient (30 min at 25°C) acidification (pH 2 to 3) followed by neutralization. Aliquots of the media were then mixed with Eagle's MEM containing 0.6% bovine calf serum, 1% nonessential amino acids, 10 mM 4-(2-hydroxyethyl)-1-piperazine-N'-2-ethanesulfonic acid (Hepes), and antibiotics. Previous studies showed that approximately 98% of the TGF-beta s in the conditioned media from cell cultures were in the latent form. Pilot assays using at least three dilutions of the conditioned media for every experiment were performed to establish the volumes of conditioned media required to decrease growth in a range that fell within the linear portion of the standard curve. Once these volumes were established, each sample was assayed in quadruplicate at two concentrations. To generate a standard curve, known quantities of TGF-beta 1 were mixed with medium of the same composition as the conditioned media. The medium was removed from the Mv1Lu cells and replaced with the samples of conditioned media or TGF-beta 1. After incubating for 40 h, the cells were pulsed for 6 h with 5 µCi/ml of [3H-methyl]thymidine with a specific radioactivity of 6.7 Ci/mmol (Dupont-NEN). After the pulse, the media were removed and the cells were fixed in situ, washed, lysed with 0.25 M NaOH, neutralized, and subjected to liquid scintillation spectrometry (26). Addition of an anti-TGF-beta neutralizing antibody to the conditioned media reduced growth inhibition by 99.5 ± 0.3% (mean ± SEM, n = 3), indicating that TGF-beta was responsible for the inhibition.

Immunohistochemical Staining of TGF-beta s

For LF cultures, cells were subcultured on glass chamber-slides that had been pretreated with 8 µg/ml of human fibronectin for 1 h at room temperature. Subconfluent cells were rinsed four times with PBS and fixed for 20 min at room temperature with 4% paraformaldehyde in 0.1 M sodium phosphate buffer, pH 7.5. To obtain lung tissue, rats were euthanized with ketamine and xylazine on postnatal days 2, 4, 8, and 14, their thoracic cavities were opened, and the heart and lungs were perfused with PBS followed by 4% paraformaldehyde in 0.1 M sodium phosphate buffer, pH 7.5. The trachea was cannulated and instilled with fixative at a pressure of 20 cm H2O. After ligation of the trachea, the lungs, heart, and mediastinal structures were removed and fixed overnight at 4°C. The lobes of the fixed lungs were separated, embedded in paraffin, and 4 µm sections were cut. The sections were deparaffinized and incubated for 15 min in 0.3% Triton X-100 in 0.01 M Tris, pH 7.4, with 0.14 M NaCl (TBS). After briefly rinsing in TBS and absolute methanol, the endogenous peroxidase activity was quenched with 0.6% H2O2. The tissue sections, but not the cultured LF, were then treated for 30 min at 37°C with 1 mg/ml of hyaluronidase in 0.1 M sodium acetate, pH 5.5, with 0.14 M NaCl. After washing and incubating with 0.5% goat blocking serum, 2.5 µg/ml of isoform-specific TGF-beta antibodies (raised in rabbits and previously described), or an equivalent quantity of nonimmune rabbit IgG, were added in blocking serum (Vectastain Elite ABC Kit; Vector Laboratories, Burlingame, CA) (14). The specificity of each anti-TGF-beta antibody has been demonstrated in Western blot analyses using recombinant TGF-beta 1, TGF-beta 3, and native porcine TGF-beta 2 (14). The slides were incubated overnight at 4°C, rinsed, and then incubated with a biotin-conjugated goat anti-rabbit IgG, followed by avidin-biotin-complexed (ABC) horseradish peroxidase according to the instructions in the Vectastain kit. The peroxidase reaction was developed with 0.05% 3,3-diaminobenzidine HCl in 0.05 M Tris, pH 7.4, with 0.14 M NaCl, and 0.01% hydrogen peroxide for 2 to 2.5 min. The sections were counterstained with Harris or Gill's hematoxylin, dehydrated, and mounted. To allow a comparison of the TGF-beta s in lungs obtained from rats of different ages, sections from animals of several different ages were stained at the same time with the various antibodies, using the same procedure.

Statistical Analyses

The data from the study are expressed as means ± SEM. Comparisons of cultures in the absence of TGF-beta 1 with those in the presence of TGF-beta 1 were made by using Student's t test for paired variables (32). The half-life of elastin cytoplasmic mRNA was calculated through linear regression analysis. Multigroup analyses were done through a two-way analysis of variance (ANOVA) followed by a post hoc test using the multivariate general linear hypothesis module of Systat (Systat Inc., Evanston, IL). Differences were considered significant when P was less than 0.05.

    Results
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

TGF-beta 1 Increases Tropoelastin mRNA in Lung Fibroblasts

The steady-state level of tropoelastin mRNA was quantified in cultures of lipid-laden interstitial pulmonary fibroblasts that were exposed to TGF-beta 1 for 12 h. The results from a representative experiment are shown in Figure 1. Densitometry of the Northern blots demonstrated that 100 pM TGF-beta 1 increased the steady-state level of tropoelastin mRNA by 1.8-fold. When the data from six experiments were combined, TGF-beta 1 was found to have increased the steady-state level of tropoelastin mRNA by 1.8 ± 0.7-fold (mean ± SEM, P < 0.05, Students t test for paired variables). These findings, using the lipid-laden subpopulation of lung fibroblasts, confirm our previous studies of a more heterogeneous population of neonatal rat lung fibroblasts that were isolated by adherence to tissue culture plastic rather than by density sedimentation (15).


View larger version (26K):
[in this window]
[in a new window]
 
Figure 1.   Effect of TGF-beta 1 on the steady-state level of tropoelastin mRNA. Neonatal rat pulmonary lipid interstitial fibroblasts (LF) were exposed to 100 pM TGF-beta 1 for 12 h or remained unexposed as controls. Northern blot analysis revealed a 3.5-kb mRNA when probed with a cDNA for rat elastin. The membrane was reprobed with a cDNA for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1.4 kb) to normalize for differences in the quantities of total RNA that were loaded.

Effect of TGF-beta 1 on Human Elastin Promoter Activity in Rat Lung Fibroblasts

To determine whether TGF-beta 1 increases elastin gene transcription, we evaluated the effects of 100 pM TGF-beta 1 (the concentration that our previous studies had shown to produce a maximal increase in the steady-state level of tropoelastin mRNA) on the activity of the human elastin promoter in transiently transfected LF (15). The elastin promoter was constitutively active in rat LF, but its activity was not altered by TGF-beta 1 (Figure 2). The data shown in Figure 2 are representative of three experiments that were averaged following densitometry. When LF were exposed to 100 pM TGF-beta 1, the quantity of acetylated chloramphenicol was 88.2 ± 4.2% of that in control cells (not significant, n = 3). These findings suggest that the TGF-beta 1-mediated increase in tropoelastin mRNA in LF does not result from an increase in transcription. Alternatively, the data may indicate that a TGF-beta -responsive element is not contained within the first 2,260 bp upstream from the translational start site of the human elastin gene. To address the second possibility, we quantified endogenous elastin gene transcription in LF that had been exposed to TGF-beta 1.


View larger version (53K):
[in this window]
[in a new window]
 
Figure 2.   TGF-beta 1 does not alter human elastin promoter activity in rat lung fibroblasts. Neonatal rat pulmonary fibroblasts were transfected with a reporter construct containing the 2,260 bp located 5' to the translation start site of the human elastin gene, linked to the chloramphenicol acetyl transferase (CAT) gene. Following transfection, the cells were exposed to 100 pM TGF-beta 1 or remained unexposed (control) for 48 h. The cell layers were isolated and CAT and beta -galactosidase enzymatic assays were performed. The acetylated and unacetylated forms of chloramphenicol were separated by thin-layer chromatography.

TGF-beta 1 Does Not Increase the Initiation Rate of Elastin Gene Transcription

The results of a representative analysis of the in vitro transcription of nuclear RNA are shown in Figure 3. They demonstrate that elastin gene transcription is not increased when LF are exposed to 40 pM TGF-beta . The results from this analysis were combined with those from two similar experiments. Elastin gene transcription in the presence of TGF-beta was 87 ± 7% (mean ± SEM, n = 3, not significant) of that for control LF that were maintained in the absence of TGF-beta . Additional studies (not shown) demonstrated that elastin gene transcription is not significantly increased by 100 pM TGF-beta .


View larger version (22K):
[in this window]
[in a new window]
 
Figure 3.   TGF-beta 1 does not alter the rate of elastin gene transcription. In vitro transcription of nuclear RNA isolated from neonatal rat pulmonary fibroblasts exposed to 40 pM TGF-beta 1 or that remained unexposed as controls. The nuclear RNA was labeled with 32P-UTP and then hybridized with cDNA for rat elastin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), or the parent plasmids that contained the cDNA inserts (Bluescript and pBR322, respectively). The autoradiogram was exposed for 120 h.

TGF-beta 1 Increases Tropoelastin mRNA Stability

The results of a representative study of the effects of TGF-beta 1 on tropoelastin mRNA stability are shown in Figure 4. When the data from this experiment were combined with those from two similar experiments, the mean half-lives of tropoelastin cytoplasmic mRNA were 25 ± 3 h and 17 ± 1 for LF that were exposed to TGF-beta 1 and unexposed controls, respectively (mean ± SEM, n = 3, P < 0.02, t test for paired variables). These findings indicate that TGF-beta 1 stabilizes tropoelastin mRNA and thereby increases the steady-state level of tropoelastin mRNA. The half-life of tropoelastin mRNA is similar to that observed by others (approximately 20 h) in bovine auricular chondrocytes, but is longer than the reported half-life of tropoelastin mRNA in human dermal fibroblasts (5, 9).


View larger version (13K):
[in this window]
[in a new window]
 
Figure 4.   TGF-beta 1 increases tropoelastin mRNA stability. Pulmonary fibroblast cultures exposed to 40 pM TGF-beta 1 (dotted line) or that remained unexposed as controls (solid line) were pulsed with 3H-uridine and then chased for up to 50 h. Cytoplasmic RNA was isolated after increasing chase times, and was then hybridized with cDNAs for rat elastin or human 28S rRNA. The 3H-uridine present in tropoelastin mRNA was expressed as parts per million (ppm) of the initial counts per minute (cpm) of RNA that were added to the hybridization reaction (see MATERIALS AND METHODS). The quantity of 3H-uridine that hybridized to 28S rRNA was used to normalize for differences in the recovery of RNA.

Endogenous TGF-beta 1 and TGF-beta 2 Modulate Tropoelastin Gene Expression in LF

Immunostaining of cultured LF with TGF-beta isoform-specific antibodies demonstrated the presence of endogenous TGF-beta 1 and TGF-beta 2 (see Figure 5a through c), but not TGF-beta 3 (data not shown). To determine whether endogenously produced TGF-beta s stimulate elastin production by these cells, we disrupted the biologic effects of TGF-beta s by adding neutralizing antibodies or antisense oligodeoxynucleotides to the culture. Tropoelastin protein in the conditioned medium was assayed with an ELISA, whereas Northern blot analysis was used to quantify tropoelastin and GAPDH mRNAs. Addition of a pan-specific neutralizing antibody significantly diminished both tropoelastin protein (Figure 6A) and mRNA (Figure 6B). The isoform-specific antibodies against both TGF-beta 1 and TGF-beta 2 produced significant reductions in tropoelastin protein. However, only anti-TGF-beta 1 significantly reduced tropoelastin mRNA (Figure 6B). The reduction observed with anti-TGF-beta 2 was not statistically significant. The pan-specific antibody produced an additional reduction in tropoelastin protein as compared either with the specific anti-TGF-beta 1 or the TGF-beta 2 antibody. It is noteworthy that the pan-specific antibody did not completely abrogate tropoelastin mRNA and protein, suggesting that other endogenous factors contribute to elastin gene expression in LF.


View larger version (114K):
[in this window]
[in a new window]
 
Figure 5.   Identification of TGF-beta isoforms in cultured rat lung fibroblasts (LF) (a through c) and lung tissues (d through h) using immunohistochemistry. Lungs from rats at postnatal day 8 (d, f through h) and from adults (e) were fixed and processed and LF were cultured, as described in the MATERIALS AND METHODS section. After quenching of endogenous peroxidase and treatment of the tissue sections with hyaluronidase, the cultured LF and lung tissue were incubated overnight with 2.5 µg/ml rabbit anti-TGF-beta 1 (a, e, and f  ), 2.5 µg/ ml rabbit anti-TGF-beta 2 (b and g), 2.5 µg/ml rabbit anti-TGF-beta 3 (h) or 2.5 µg/ml of rabbit IgG (c and d). The slides were then washed and incubated with the reagents in the Vectastain ABC kit, and the peroxidase reaction was developed with diaminobenzidine to yield an insoluble brown product. The slides were counterstained with hematoxylin. SA = small airway, LA = large airway, P = pleural mesothelial surface. Bar is 50 µ long.


View larger version (47K):
[in this window]
[in a new window]
 


View larger version (63K):
[in this window]
[in a new window]
 
Figure 6.   Neutralizing anti-TGF-beta antibodies decrease soluble elastin in lung fibroblast (LF) cultures. (a) Postconfluent LF cultures in 24-well plates were incubated in serum-free medium for 36 h in the presence and absence of a neutralizing anti-TGF-beta 1 (from chicken), an equivalent amount of nonimmune chicken IgG (chick IgG), neutralizing anti-TGF-beta 2, neutralizing anti-pan TGF-beta (which neutralizes TGF-beta 1, TGF-beta 2, and TGF-beta 3), or an equivalent amount of nonimmune rabbit IgG. Controls were incubated in serum-free medium without antibodies and nonimmune IgG. During the last 24 h the culture medium was collected and subsequently assayed for soluble elastin with an ELISA. Bars are the means and vertical brackets are 1 SEM. **P < 0.01, n = 3 wells from one experiment that was representative of the three experiments that were performed. (b) Cultures of postconfluent LF were maintained as described in (a) in 12-well plates. The cell layers were collected and total RNA was isolated. Northern blot analysis was performed as outlined in the legend to Figure 1 and in MATERIALS AND METHODS. GAPDH = glyceraldehyde 3-phosphate dehydrogenase. *P < 0.05, n = 3 for all conditions.

Antisense oligonucleotides were used as an alternate strategy to disrupt endogenous TGF-beta production, and the effects of this disruption on elastin gene expression were analyzed. The oligodeoxynucleotides were designed to decrease the synthesis of TGF-beta 1, TGF-beta 2, or TGF-beta 3 proteins by the LF. The combined activities of all TGF-beta s in the conditioned media, including the latent and endogenously active forms of both TGF-beta 1 and TGF-beta 2, were assayed for their growth-inhibitory activity in Mv1Lu cell cultures. The results of a representative analysis are shown in Figure 7A. Either 1 or 2.5 µM antisense TGF-beta 1 significantly decreased TGF-beta biologic activity in the transiently acidified conditioned medium. However, neither antisense TGF-beta 2 nor antisense TGF-beta 3 (data not shown) produced a significant reduction in TGF-beta as compared with the missense control. Only antisense TGF-beta 1 produced a significant reduction in soluble elastin protein, as is shown in Figure 7B. Antisense TGF-beta 2 and TGF-beta 3 did not reduce soluble elastin (data not shown). The effects of antisense TGF-beta 1 on tropoelastin mRNA are shown in Figure 8A. Addition of 1 µM antisense TGF-beta 1 caused a mean reduction in tropoelastin mRNA of 33% from the missense control in three separate experiments. A representative Northern blot analysis from one of these experiments is shown in Figure 8B. The magnitude of the reduction in tropoelastin mRNA (33%) was similar to the reduction observed in tropoelastin protein in the presence of 1 µM antisense TGF-beta 1. Since antisense TGF-beta 2 and TGF-beta 3 oligonucleotides did not significantly reduce TGF-beta biologic activity, their effects on tropoelastin mRNA were not analyzed.


View larger version (28K):
[in this window]
[in a new window]
 


View larger version (29K):
[in this window]
[in a new window]
 
Figure 7.   TGF-beta 1 antisense oligodeoxynucleotides decrease TGF-beta and soluble elastin in lung fibroblast (LF) cultures. (a) Confluent cultures of LF in 48-well plates were transfected with oligodeoxynucleotides (antisense, containing the nucleotides in the antisense strand flanking the translation start site for TGF-beta 1 or TGF-beta 2; or missense, a scrambled sequence used as an irrelevant DNA control) or medium only, in the absence of any oligonucleotides or liposomes. During the final 12 h, serum-free media were conditioned. They were then transiently acidified (activated) and used to assay TGF-beta biologic activity by inhibiting mink lung epithelial cell (Mv1Lu) growth. Bars are the means and vertical brackets are 1 SEM. **P < 0.01, n = 3 wells from one experiment that was representative of four that were performed. (b) The soluble elastin in the conditioned media was quantified with an ELISA and normalized to the DNA content per well (see MATERIALS AND METHODS). *P < 0.05, n = 3 experiments in which each condition had three wells.


View larger version (28K):
[in this window]
[in a new window]
 


View larger version (32K):
[in this window]
[in a new window]
 
Figure 8.   TGF-beta 1 antisense oligodeoxynucleotides decrease tropoelastin mRNA in lung fibroblast (LF) cultures. (a) Confluent cultures of LF in 12-well plates were transfected as described in the legend to Figure 7. Cell layers were collected, total RNA isolated, and Northern blot analyses performed as described in MATERIALS AND METHODS and the legend to Figure 1. Bars are the means and vertical brackets are 1 SEM. *P < 0.05, n = 3 experiments. (b) A representative autoradiogram for a Northern blot analysis from one of the three experiments included in (a). Lane 1: control containing medium only; lane 2: 1 µM TGF-beta 1 antisense oligodeoxynucleotide; Lane 3, 1 µM missense oligodeoxynucleotide.

TGF-beta Isoforms in Neonatal and Adult Rat Lung Tissues

The temporal and spatial distributions of TGF-beta 1, TGF-beta 2, and TGF-beta 3 were compared on several days during early postnatal life and in adults. Representative results are shown in Figure 5 for lung tissue obtained at postnatal day 8 and from an adult. The spatial distribution and intensity of staining of each isotype were similar at postnatal days 2, 4, 8, and 12. Therefore, data are shown only for lungs obtained at day 8 and from an adult. TGF-beta 1 was present generally in the small airways and alveolar septa, and was abundant in the mesothelium and subpleural alveoli. TGF-beta 2 was also observed in these regions; however, immunoreactivity was most intense in the airways. TGF-beta 3 stained prominently in airways and alveoli, and was most abundant in the mesenchyme surrounding airways and blood vessels. In adult lungs, the three isoforms showed spatial distributions that were similar to those observed in the neonate, and only the data for TGF-beta 1 are shown. The combined biologic activities of the TGF-beta isoforms were quantified in neonatal and adult lungs using the mink lung epithelial cell growth-inhibition assay. Lungs that were isolated on the 8th postnatal day contained 4.1 ± 1.1 pg of TGF-beta /µg protein (n = 3), whereas adult lungs contained only 0.9 ± 0.1 pg/µg protein (n = 3) (P < 0.01). These data represent the antipan-TGF-beta antibody-inhibitable suppression of mink lung cell growth, which accounted for 54.5 ± 9.6% of the total growth suppression. Since all of the latent TGF-beta was activated during the extraction procedure, endogenously active TGF-beta s could not be quantified.

    Discussion
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

We have demonstrated that exogenous TGF-beta 1 increases elastin gene expression in neonatal rat LF by increasing the stability of tropoelastin mRNA, rather than by increasing the level of transcriptional initiation. The approximately 1.5-fold increase in tropoelastin mRNA stability observed in cultured LF is similar to the 1.8-fold increase in the steady-state level of tropoelastin mRNA that we observed in LF exposed to TGF-beta 1. Although the magnitude of the TGF-beta -related change in elastin expression is relatively small, it is comparable with the levels of induction (1.5- to 3-fold) of tropoelastin mRNA that others have observed using peptide growth factors, including TGF-beta 1 (15, 17). We have also shown that LF cultures contain TGF-beta 1 and TGF-beta 2, and that endogenous TGF-beta s produced by these cells regulate elastin gene expression in an autocrine manner.

We confirmed our previously published findings to establish that the TGF-beta 1-mediated increase in the steady-state level of tropoelastin mRNA in the lipid-laden subpopulation of neonatal rat lung fibroblasts is similar to that in the more heterogeneous population that we studied earlier (15). Confirmation of this was important, because others have reported that TGF-beta 1 does not increase tropoelastin mRNA in this subpopulation of lipid-laden fibroblasts (1). The divergence of our findings from those of Berk and associates (1) may reflect differences in culture conditions. We used cells that had been confluent for 4 or 5 days and were maintained under serum-free conditions immediately prior to and during exposure to TGF-beta 1. Berk and coworkers (1) studied the same subpopulation of fibroblasts approximately 24 h after they reached confluence, and the fetal bovine serum concentration was reduced to 0.4%.

The antisense TGF-beta oligodeoxynucleotides used in our study were less effective than the anti-TGF-beta antibodies in reducing elastin gene expression. The failure of the antisense TGF-beta 2 oligonucleotide to measurably reduce the total biologic activity of TGF-beta may be partly due to the observation that TGF-beta 1 is more abundant in LF cultures and accounts for more of the biologic activity of TGF-beta . However, TGF-beta 2 does apparently influence elastin production, since we observed that anti-TGF-beta 2 antibody significantly decreased soluble elastin protein. Additional studies in our laboratory have shown that exogenous TGF-beta 2 increases tropoelastin mRNA when added to LF cultures (unpublished data). The antisense TGF-beta 2 construct was complementary to the mouse TGF-beta 2 nucleotide sequence instead of to a rat sequence, whereas the nucleotide for TGF-beta 1 was complementary to the rat sequence. Thus, the mouse TGF-beta 2 oligonucleotide may hybridize less efficiently with the rat mRNA, and may therefore be less effective than the antisense TGF-beta 1 nucleotide in disrupting TGF-beta synthesis.

The TGF-beta 1 antisense oligonucleotide was also less effective than the anti-TGF-beta 1 neutralizing antibody in reducing elastin production. The lower efficacy of the TGF-beta 1 antisense construct may relate to the longer time required for the oligonucleotides to alter elastin expression. The antisense oligonucleotides must interrupt TGF-beta protein production to exert their effect on elastin. Thus, the level of previously synthesized TGF-beta would have to decay before the effect on elastin gene expression could be detected. The half-life of TGF-beta proteins in LF cultures is not known, but it is likely to be considerably longer than 24 h. TGF-beta 1 that is produced by erythroleukemia cells during a 1.5-h pulse is still very abundant in the culture medium after a 72 h chase (33). In contrast, the neutralizing antibodies could immediately interfere with TGF-beta function and thereby reduce elastin expression. In our experimental protocol, the cells were incubated for 40 h after exposure to the antisense oligonucleotides before RNA isolation. Since the half-life of tropoelastin mRNA is approximately 17 h, it is likely that no more than one half-life transpired after TGF-beta protein levels decreased. This would produce, at most, a 50% reduction in elastin. The observed level of reduction, after exposure to antisense TGF-beta 1 nucleotides, was approximately 33% for both tropoelastin mRNA and protein. This is comparable to the reductions in TGF-beta -mediated biologic effects that others have observed in vascular smooth-muscle cells with antisense TGF-beta 1 constructs, and in glucocorticoid-stimulated fetal rat lung fibroblasts with antisense TGF-beta 3 (34-36). Thus, although the antisense-mediated reductions in tropoelastin are relatively small, they are consistent with our results obtained with neutralizing antibodies. Taken together, these studies indicate that endogenous TGF-beta s can regulate tropoelastin production by neonatal LF in vitro.

Our immunohistochemical studies demonstrated that the TGF-beta 1 and TGF-beta 2 isoforms are the most abundant in cultured LF, whereas all three TGF-beta isoforms are present in the neonatal and adult rat lung. All three isoforms are found in the alveolar walls, and therefore are in close proximity to alveolar fibroblasts. Our observation that TGF-beta 1 is present in neonatal and adult rat pulmonary alveoli, as in cultured LF, indicates that TGF-beta 1 expression by cultured LF is not an artifact of the culture system (37). Our findings are in accord with those of others who have studied rodent lung fibroblasts and lungs (38, 39). However, our findings in rats differ from those in humans, in whom TGF-beta 1 is observed only in diseased lungs (40). The higher quantities of TGF-beta s in the subpleural region are an interesting finding in that this region corresponds to the region of maximal alveolar growth observed by Massaro and Massaro (41).

Further experimentation is required to determine whether TGF-beta s can also posttranscriptionally regulate elastin gene expression in the lung. However, on the basis of the current data, we hypothesize that age-related differences in the quantities of biologically active TGF-beta s in rat lungs could contribute to the age-related differences in tropoelastin mRNA stability that were observed by Swee and colleagues (7). This hypothesis is supported by our observation that the mean amount of total TGF-beta s (latent plus endogenously active) in the lungs of 8-day neonates is 4.5-fold greater than that in adult rat lungs. However, only a portion of these TGF-beta s would be endogenously active in vivo. Therefore, the relationship between endogenously active TGF-beta s and elastin gene expression must be elucidated. Our future studies will more directly address this hypothesis in order to further define the mechanisms of posttranscriptional regulation of elastin gene expression in the lung.

    Footnotes

Address correspondence to: Stephen E. McGowan, M.D., Department of Internal Medicine, C33B-GH, University of Iowa Hospitals and Clinics, Iowa City, IA 52242.

(Received in original form June 24, 1996 and in revised form November 4, 1996).

Acknowledgments: These studies were supported by awards from the Department of Veterans Affairs Research Service and Grant HL 45135 from the National Institutes of Health.

Abbreviations CAT, chloramphenicol acetyl transferase; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; LF, lung fibroblast; TGF-beta , transforming growth factor-beta ; RE2, cDNA for rat elastin.

    References
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Berk, J. L., C. Franzblau, and R. H. Goldstein. 1991. Recombinant interleukin-1-beta inhibits elastin formation by a neonatal rat lung fibroblast subtype. J. Biol. Chem. 266: 3192-3197 [Abstract/Free Full Text].

2. Kahari, V. M., Y. Q. Chen, M. M. Bashir, J. Rosenbloom, and J. Uitto. 1992. Tumor necrosis factor-alpha down-regulates human elastin gene expression. J. Biol. Chem. 267: 26134-26141 [Abstract/Free Full Text].

3. Wolfe, L. B., C. B. Rich, H. D. Goud, A. J. Terpstra, M. Bashir, J. Rosenbloom, G. E. Sonenshein, and J. A. Foster. 1993. Insulin-like growth factor-1 regulates transcription of the elastin gene. J. Biol. Chem. 268: 12418-12426 [Abstract/Free Full Text].

4. Jensen, D. E., C. B. Rich, A. J. Terpstra, S. R. Farmer, and J. A. Foster. 1995. Transcriptional regulation of the elastin gene by insulin-like growth factor-1 involves disruption of Sp1 binding. J. Biol. Chem. 270: 6555-6563 [Abstract/Free Full Text].

5. Parks, W. C., M. E. Kolodziej, and R. A. Pierce. 1992. Phorbol ester-mediated downregulation of tropoelastin expression is controlled by a posttranscriptional mechanism. Biochemistry 31: 6639-6645 [Medline].

6. Pierce, R. A., M. E. Kolodziej, and W. C. Parks. 1992. 1,25-dihydroxyvitamin D3 represses tropoelastin by a posttranscriptional mechanism. J. Biol. Chem. 267: 11593-11599 [Abstract/Free Full Text].

7. Swee, M. H., W. C. Parks, and R. A. Pierce. 1995. Developmental regulation of elastin production, expression of tropoelastin pre-mRNA persists after downregulation of steady-state mRNA levels. J. Biol. Chem. 270: 14899-14906 [Abstract/Free Full Text].

8. Marigo, V., D. Volpin, and G. M. Bressan. 1993. Regulation of the human elastin promoter in chick embryo cells, tissue specific effect of TGF-beta . Biochem. Biophys. Acta 1172: 31-36 [Medline].

9. Kahari, V. M., D. R. Olsen, R. W. Rhudy, P. Carrillo, Y. Q. Chen, and J. Uitto. 1992. Transforming growth factor-beta up-regulates elastin gene expression in human skin fibroblasts. Lab. Invest. 66: 580-588 [Medline].

10. Barnard, J. A., R. M. Lyons, and H. A. Moses. 1990. The cell biology of transforming growth factor-beta . Biochem. Biophys. Acta 1032: 79-87 [Medline].

11. Lafyatis, R., R. Lechleider, S. J. Kim, S. Jakowlew, A. B. Roberts, and M. B. Sporn. 1990. Structural and functional characterization of the transforming growth factor-beta 3 promoter. J. Biol. Chem. 265: 19128-19136 [Abstract/Free Full Text].

12. Miller, D. A., A. Lee, Y. Matsui, E. Y. Chen, H. L. Moses, and R. Derynck. 1989. Complementary DNA cloning of the murine transforming growth factor beta -3 (TGF-beta 3) precursor and the comparative expression of TGF-beta 3 and TGF-beta 1 messenger RNA in mouse embryos and adult tissues. Mol. Endocrinol. 3: 1926-1934 [Abstract/Free Full Text].

13. Millan, F. A., F. Denhez, P. Kondaiah, and R. J. Akhurst. 1991. Embryonic gene expression of TGF beta 1, beta 2, beta 3 suggest different developmental functions in vivo. Development 111: 131-144 [Abstract].

14. Pelton, R. W., B. Saxena, M. Jones, H. Moses, and L. I. Gold. 1991. Immunohistochemical localization of TGF-beta 1, TGF-beta 2, and TGF-beta 3 in the mouse embryo: expression patterns suggest multiple roles during embryonic development. J. Cell Biol. 115: 1091-1105 [Abstract/Free Full Text].

15. McGowan, S. E., and R. McNamer. 1990. Transforming growth factor-beta increases elastin production by neonatal rat lung fibroblasts. Am. J. Respir. Cell Mol. Biol. 3: 369-376 .

16. McGowan, S. E. 1992. Influences of endogenous and exogenous TGF-beta on elastin in rat lung fibroblasts and aortic smooth-muscle cells. Am. J. Physiol. 263 (Lung Cell. Mol. Physiol. 7):L257-L263.

17. Mauview, A., Y. Q. Chen, V. M. Kahari, I. Ledo, L. Rudnicka, and J. Uitto. 1993. Human recombinant interleukin-1beta up-regulates elastin gene expression in dermal fibroblasts. J. Biol. Chem. 268: 6520-6524 [Abstract/Free Full Text].

18. Mecham, R. P., S. L. Morris, B. D. Levy, and D. S. Wrenn. 1984. Glucocorticoids stimulate elastin production in differentiated bovine ligament fibroblasts but do not induce elastin synthesis in undifferentiated cells. J. Biol. Chem. 259: 12414-12418 [Abstract/Free Full Text].

19. Pierce, R. A., W. I. Mariencheck, S. Sandefur, E. C. Crouch, and W. C. Parks. 1995. Glucocorticoids upregulate tropoelastin expression during late stages of fetal lung development. Am. J. Physiol. 268 (Lung Cell. Mol. Physiol. 12):L491-L500.

20. Kahari, V. M.. 1994. Dexamethasone suppresses elastin gene expression in human skin fibroblasts in culture. Biochem. Biophys. Res. Commun. 201: 1189-1196 [Medline].

21. McGowan, S. E., C. S. Harvey, and S. K. Jackson. 1995. Retinoids, retinoic acid receptors, and cytoplasmic retinoid binding proteins in perinatal rat lung fibroblasts. Am. J. Physiol. 269 (Lung Cell. Mol. Physiol. 13):L463- L472.

22. Qian, S. W., P. Kondaiah, A. B. Roberts, and M. B. Sporn. 1990. cDNA cloning by PCR of rat transforming growth factor-beta 1.  Nucleic Acids Res. 18: 3059 [Free Full Text].

23. Hatzfield, J., M. L. Li, E. L. Brown, H. Sookdeo, J. P. Levesque, T. O'Toole, C. Gurney, S. C. Clark, and A. Hatzfeld. 1991. Release of human hematopoietic progenitors from quiescence by antisense transforming growth factor beta -1 or Rb oligonucleotides. J. Exp. Med. 174: 925-929 [Abstract/Free Full Text].

24. Stec, W. J., G. Zon, W. Egan, and B. Stec. 1984. Automated solid-phase synthesis, separation, and stereochemistry of phosphorothioate analogues of oligodeoxyribonucleotides. J. Am. Chem. Soc. 106: 6077-6079 .

25. Liu, R., C. S. Harvey, and S. E. McGowan. 1993. Retinoic acid increases elastin in neonatal rat lung fibroblast cultures. Am. J. Physiol. 265 (Lung Cell. Mol. Physiol. 9):L430-L437.

26. Danielpour, D., L. L. Dart, K. C. Flanders, A. B. Roberts, and M. B. Sporn. 1989. Immunodetection and quantitation of the two forms of transforming growth factor-beta (TGF-beta 1 and TGF-beta 2) secreted by cells in culture. J. Cell. Phyiol. 138: 79-86 [Medline].

27. Brettell, L. M., and S. E. McGowan. 1994. Basic fibroblast growth factor decreases elastin production by neonatal rat lung fibroblasts. Am. J. Respir. Cell Mol. Biol. 10: 306-315 [Abstract].

28. Greenberg, M. E., and E. B. Ziff. 1984. Stimulation of 3T3 cells induces transcription of the c-fos proto-oncogene. Nature 440: 433-438 .

29. Rodgers, J. R., M. L. Johnson, and J. M. Rosen. 1985. Measurement of mRNA concentration and mRNA half-life as a function of hormone treatment. In Methods in Enzymology, Vol. 109. S. P. Colowick and N. O. Kaplan, editors. Academic Press, San Diego. 572-592.

30. Levis, R., and S. Penman. 1977. The metabolism of poly(A)+ and poly(A)- hnRNA in cultured drosophila cells studied with a rapid uridine pulse-chase. Cell 11: 105-113 [Medline].

31. Khalil, N., O. Bereznay, M. Sporn, and A. Greenberg. 1989. Macrophage production of transforming growth factor-beta and fibroblast collagen synthesis in chronic pulmonary inflammation. J. Exp. Med. 170: 727-737 [Abstract/Free Full Text].

32. Rosner, B. 1990. Fundamentals of Biostatistics. PWS-Kent Publishing Co., Boston.

33. Miyazono, K., J. Thyberg, and C. H. Heldin. 1992. Retention of the transforming growth factor-beta 1 precursor in the Golgi complex in a latent endoglycosidase H-sensitive form. J. Biol. Chem. 267: 5668-5675 [Abstract/Free Full Text].

34. Itoh, H., M. Mukoyama, R. E. Pratt, G. H. Gibbons, and V. J. Dzau. 1993. Multiple autocrine growth factors modulate vascular smooth-muscle growth response to angiotensin II. J. Clin. Invest. 91: 2268-2274 .

35. Merrilees, M. J., and L. Scott. 1994. Antisense S-oligonucleotide against transforming growth factor-beta 1 inhibits proteoglycan synthesis in arterial wall. J. Vasc. Res. 31: 322-329 [Medline].

36. Yee, W., J. Wang, J. Liu, I. Tseu, M. Kuliszewski, and M. Post. 1996. Glucocorticoid-induced tropoelastin expression is mediated via transforming growth factor-beta 3. Am. J. Physiol. (Lung Cell. Mol.) 14: L992-L1001 .

37. Streuli, C., C. Schmidhauser, M. Kobrin, M. J. Bissell, and R. Derynck. 1993. Extracellular matrix regulates expression of the TGF-beta 1 gene. J. Cell. Biol. [120:253-260 Physiol.) 270:] L992-L1001.

38. Wang, J., M. Kuliszewski, W. Yee, L. Sedlakova, J. Xu, I. Tsue, and M. Post. 1995. Cloning and expression of glucocorticoid-induced genes in fetal rat lung fibroblasts. J. Biol. Chem. 270: 2722-2728 [Abstract/Free Full Text].

39. Pelton, R. W., M. D. Johnson, E. A. Perkett, L. I. Gold, and H. L. Moses. 1991. Expression of transforming growth factor-beta 1, beta 2, and beta 3 mRNA and protein in murine lung. Am. J. Respir. Cell Mol. Biol. 5: 522-530 .

40. Khalil, N., R. N. O'Conner, K. C. Flanders, and H. Unruh. 1996. TGF-beta 1, but not TGF-beta 2 or TGF-beta 3, is differentially present in epithelial cells of advanced pulmonary fibrosis: an immunohistochemical study. Am. J. Respir. Cell Mol. Biol. 14: 131-138 [Abstract].

41. Massaro, G. D., and D. Massaro. 1993. Postnatal lung growth: evidence that the gas-exchange region grows fastest at the periphery. Am. J. Physiol. 265 (Lung Cell. Mol. Physiol. 9):L319-L322.





This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Yang, M. A. Nugent, and M. P. Panchenko
EGF antagonizes TGF-{beta}-induced tropoelastin expression in lung fibroblasts via stabilization of Smad corepressor TGIF
Am J Physiol Lung Cell Mol Physiol, July 1, 2008; 295(1): L143 - L151.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
T. W. Guilbert, D. A. Stern, W. J. Morgan, F. D. Martinez, and A. L. Wright
Effect of Breastfeeding on Lung Function in Childhood and Modulation by Maternal Asthma and Atopy
Am. J. Respir. Crit. Care Med., November 1, 2007; 176(9): 843 - 848.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
P.-P. Kuang, X.-H. Zhang, C. B. Rich, J. A. Foster, M. Subramanian, and R. H. Goldstein
Activation of elastin transcription by transforming growth factor-beta in human lung fibroblasts
Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L944 - L952.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. J. DiCamillo, S. Yang, M. V. Panchenko, P. A. Toselli, E. F. Naggar, C. B. Rich, P. J. Stone, M. A. Nugent, and M. P. Panchenko
Neutrophil elastase-initiated EGFR/MEK/ERK signaling counteracts stabilizing effect of autocrine TGF-beta on tropoelastin mRNA in lung fibroblasts
Am J Physiol Lung Cell Mol Physiol, August 1, 2006; 291(2): L232 - L243.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
P.-P. Kuang, E. Lucey, D. C. Rishikof, D. E. Humphries, D. Bronsnick, and R. H. Goldstein
Engraftment of Neonatal Lung Fibroblasts into the Normal and Elastase-Injured Lung
Am. J. Respir. Cell Mol. Biol., October 1, 2005; 33(4): 371 - 377.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
H. Chen, J. Sun, S. Buckley, C. Chen, D. Warburton, X.-F. Wang, and W. Shi
Abnormal mouse lung alveolarization caused by Smad3 deficiency is a developmental antecedent of centrilobular emphysema
Am J Physiol Lung Cell Mol Physiol, April 1, 2005; 288(4): L683 - L691.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. A. Buczek-Thomas, E. C. Lucey, P. J. Stone, C. L. Chu, C. B. Rich, I. Carreras, R. H. Goldstein, J. A. Foster, and M. A. Nugent
Elastase Mediates the Release of Growth Factors from Lung In Vivo
Am. J. Respir. Cell Mol. Biol., September 1, 2004; 31(3): 344 - 350.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
Mechanisms and Limits of Induced Postnatal Lung Growth
Am. J. Respir. Crit. Care Med., August 1, 2004; 170(3): 319 - 343.
[Full Text] [PDF]


Home page
ThoraxHome page
L Wu, J Chau, R P Young, V Pokorny, G D Mills, R Hopkins, L McLean, and P N Black
Transforming growth factor-{beta}1 genotype and susceptibility to chronic obstructive pulmonary disease
Thorax, February 1, 2004; 59(2): 126 - 129.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
P.-P. Kuang, R. H. Goldstein, Y. Liu, D. C. Rishikof, J.-C. Jean, and M. Joyce-Brady
Coordinate expression of fibulin-5/DANCE and elastin during lung injury repair
Am J Physiol Lung Cell Mol Physiol, November 1, 2003; 285(5): L1147 - L1152.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. B. Rich, I. Carreras, E. C. Lucey, J. A. Jaworski, J. A. Buczek-Thomas, M. A. Nugent, P. Stone, and J. A. Foster
Transcriptional regulation of pulmonary elastin gene expression in elastase-induced injury
Am J Physiol Lung Cell Mol Physiol, August 1, 2003; 285(2): L354 - L362.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. J. DiCamillo, I. Carreras, M. V. Panchenko, P. J. Stone, M. A. Nugent, J. A. Foster, and M. P. Panchenko
Elastase-released Epidermal Growth Factor Recruits Epidermal Growth Factor Receptor and Extracellular Signal-regulated Kinases to Down-regulate Tropoelastin mRNA in Lung Fibroblasts
J. Biol. Chem., May 17, 2002; 277(21): 18938 - 18946.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. M. Davidson
Smad about Elastin Regulation
Am. J. Respir. Cell Mol. Biol., February 1, 2002; 26(2): 164 - 166.
[Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
W. H. Chung, B. M. Bennett, W. J. Racz, J. F. Brien, and T. E. Massey
Induction of c-jun and TGF-beta 1 in Fischer 344 rats during amiodarone-induced pulmonary fibrosis
Am J Physiol Lung Cell Mol Physiol, November 1, 2001; 281(5): L1180 - L1188.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
K. R. Stenmark
Cell-, age-, and phenotype-dependent differences in the control of gene expression
Am J Physiol Lung Cell Mol Physiol, October 1, 2001; 281(4): L762 - L765.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. B. Rich, M. R. Fontanilla, M. Nugent, and J. A. Foster
Basic Fibroblast Growth Factor Decreases Elastin Gene Transcription through an AP1/cAMP-response Element Hybrid Site in the Distal Promoter
J. Biol. Chem., November 19, 1999; 274(47): 33433 - 33439.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Zhang, R. A. Pierce, H. Wachi, R. P. Mecham, and W. C. Parks
An Open Reading Frame Element Mediates Posttranscriptional Regulation of Tropoelastin and Responsiveness to Transforming Growth Factor beta 1
Mol. Cell. Biol., November 1, 1999; 19(11): 7314 - 7326.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Takizawa, T. Ohtoshi, S. Kawasaki, T. Kohyama, M. Desaki, T. Kasama, K. Kobayashi, K. Nakahara, K. Yamamoto, K. Matsushima, et al.
Diesel Exhaust Particles Induce NF-{kappa}B Activation in Human Bronchial Epithelial Cells In Vitro: Importance in Cytokine Transcription
J. Immunol., April 15, 1999; 162(8): 4705 - 4711.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. A. Riddick, K. J. Serio, C. R. Hodulik, W. L. Ring, M. S. Regan, and T. D. Bigby
TGF-{beta} Increases Leukotriene C4 Synthase Expression in the Monocyte-Like Cell Line, THP-1
J. Immunol., January 15, 1999; 162(2): 1101 - 1107.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
H. Chen, S. Jackson, M. Doro, and S. McGowan
Perinatal expression of genes that may participate in lipid metabolism by lipid-laden lung fibroblasts
J. Lipid Res., December 1, 1998; 39(12): 2483 - 2492.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
M. E. Wilson, B. M. Young, B. L. Davidson, K. A. Mente, and S. E. McGowan
The Importance of TGF-{beta} in Murine Visceral Leishmaniasis
J. Immunol., December 1, 1998; 161(11): 6148 - 6155.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. C. Bruce and C. E. Honaker
Transcriptional regulation of tropoelastin expression in rat lung fibroblasts: changes with age and hyperoxia
Am J Physiol Lung Cell Mol Physiol, June 1, 1998; 274(6): L940 - L950.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McGowan, S. E.
Right arrow Articles by Gold, L. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McGowan, S. E.
Right arrow Articles by Gold, L. I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 1997 American Thoracic Society.