help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reid, C. J.
Right arrow Articles by Harris, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reid, C. J.
Right arrow Articles by Harris, A.
Am. J. Respir. Cell Mol. Biol., Volume 17, Number 5, November 1997 592-598

Developmental Expression of Mucin Genes in the Human Respiratory Tract

Colm J. Reid, Stephen Gould, and Ann Harris

Paediatric Molecular Genetics, Institute of Molecular Medicine, Oxford University; and Paediatric Pathology, John Radcliffe Hospital, Oxford, United Kingdom


    Abstract
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Mucin glycoproteins play a key role in the normal function of the airway epithelium. We examined the expression of mucin genes, MUC3, 4, 5AC, 5B, 6, 7, and 8 in human fetal tissues to establish the localization and age of onset of expression of each mucin gene during human development. We detected expression of MUC4, 5AC, 5B, and 7 in the mid-trimester airway epithelium but did not detect expression of MUC3, 6, or 8. MUC4 was expressed in the trachea and large airways in the majority of cells in the airway epithelium. Expression of MUC5AC was only seen in individual goblet cells in the trachea, while MUC5B was expressed in the surface epithelium of the trachea at 13 wk but was largely restricted to submucosal glands by 23 wk of gestation.


    Introduction
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Mucous glycoproteins, mucins, play a key role in the human airways by protecting the epithelial surface from injury and by facilitating removal of materials that enter the lung. Clearance of the mucous layer is achieved by beating cilia on ciliated epithelial cells in the airway which move the secretions up through the airways towards the nose and throat. The molecular composition of proteins in this mucous layer was poorly characterized until the isolation of a number of human mucin genes enabled the identification of those that are expressed in the airway epithelium (1).

Nine mucin genes have been identified, MUC1, 2, 3, 4, 5AC, 5B, 6, 7, and 8 (1), though only MUC1, 2, and 7 have been fully cloned. Partial sequence, generally from the tandem repeat, is available for the remainder of the genes. Studies of tissue localization have been carried out for a number of mucins using antibodies; however, these studies have the limitation that many of the antibodies bind to carbohydrate determinants that are present on different mucin core proteins. Some protein epitopes may also be masked by glycosylation. Hence, cell-specific localization of mucin gene expression is most reliably determined by using in situ mRNA hybridization with gene-specific oligonucleotides or riboprobes.

Mucins play a fundamental role in the pathogenesis of many lung diseases, particularly those involving chronic inflammation of the airways or susceptibility to infection such as asthma, chronic bronchitis, and cystic fibrosis. Mucin gene expression has been examined in the postnatal respiratory system of normal individuals and in a number of disease states (reviewed in 13). We examined the developmental expression of human mucin genes to establish which genes are important in the development and differentiation of the human lung epithelium. We previously reported expression of MUC1 and MUC2 in the fetal lung (14). Data in this report show expression of MUC4, MUC5AC, and MUC5B in the mid-trimester airway epithelium. Low levels of MUC7 were seen in tracheal submucosal glands at 23 wk. No expression of MUC3, 6, or 8 was observed. MUC4 was detected in the trachea and large airways where it was expressed in the majority of cells in the airway epithelium. MUC5AC was only expressed in individual goblet cells in the trachea both within the surface epithelium and in the necks of submucosal glands. MUC5B transcripts were detected in the surface epithelium of the trachea at 13 wk, but were mainly seen in submucosal gland epithelium by 23 wk of gestation.

    Materials and Methods
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Tissues from mid-trimester terminations were obtained with local ethical committee approval and age was determined on the basis of foot length. Data presented here are derived from two 13-wk fetuses, one male and one female; two 17/18-wk fetuses, one male and one female; and one female fetus of 23-wk gestation. Adult lung was normal tissue adjacent to tumors removed at surgery. Tissues for in situ hybridization were fixed directly in 4% paraformaldehyde (pH 9.5) overnight at 4°C, embedded and frozen in liquid nitrogen prior to cutting 10-µm sections. Frozen sections were mounted onto Vectabond-treated slides (Vector Laboratories Ltd., Burlingame, CA) and stored desiccated at -20°C until used. For each tissue, a minimum of 9 sections were hybridized with antisense probes for each mucin gene and 6 sections were hybridized with the respective sense probes.

In situ Hybridization

In situ hybridization was carried out as described previously (14). The following 74 bp double-stranded oligonucleotide probes were used. MUC3:GACCACATACCACAGTACTCCCAGCTTCACTTCTTTGATCACCATCACTGAG-ACCACCTCACACAGTACTCCCA (bases 140-213 EMBL Accession number M55405); MUC4:CACAAGTCACGCCACCTCTCTTCTTGTCACCGACGCTTCCTCAGTA-TCCACAGGTGACACCACCCCTCTTCCTG (bases 111-184 EMBL Accession number M64594); MUC5AC:CCCACGACCAGCACAACCTCTGCCCCTACAACAAG-AACAACTTCTGCTCCTAAAAGCAGCACAACCTCTGCCGC (bases 58-131 EMBL Accession number Z34278); MUC5B:GGACGACCTGGATCCTCACAGAGCTGACCACAACAGACCACTACGACTGCATCCACTGGATCCACGGCCACCCC (bases 221-294 EMBL Accession number X74955); MUC6:GGTCCACACACACAGCCCCACCAGTGACGCCGACCACCAGTGGGACGAGCCAAGCCGCGAGCTCATTCAGCACA (bases 308-381 EMBL Accession number S57578); MUC7:ACACCACAGCTGCCCCACCCACACCTTCTGCAACTACACCAGCTCCACCATCTTCCTCAGCTCCACCAGAGACC (bases 587-660 EMBL Accession number L13283); MUC8:CCGGGTTCATGAGCTGCCCACGCCCTTTCCAGGAAGGGACCCCGGGTTCACGAGCTGCCCACGTCCTCTCCAGG (bases 35-109 EMBL Accession number U14383). Each oligonucleotide carried additional bases to enable direct cloning into the BamH I and Hind III sites of pBluescript. Antisense and sense probes were generated from the T7 and T3 promoters, respectively. An additional probe for MUC8 mRNA (pAM3-3) that includes bases 1-312 of the pAM1 clone (12) that encompasses part of the MUC8 tandem repeat was kindly provided by Dr. G. Sachdev, Oklahoma. Purified probes were diluted to 5 × 106-2 × 107 cpm/ml in a hybridization solution containing formamide (final concentration 60-65%), 1× Denhardt's solution, 10% dextran sulphate, 0.5 mg/ml RNase-free transfer RNA (tRNA), and 10 mM DTT.

Tissue sections were digested with 10 µg/ml proteinase K for 2 min at 37°C, then treated with 25 mM acetic anhydride in 0.1 M triethanolamine (pH 8.0) for 10 min at room temperature (RT); briefly rinsed in 2× SSC before dehydrating through a graded ethanol series and air dried. As a control for nonspecific binding of the antisense probe, some sections were treated with 20 µg/ml RNase A for 15 min at room temperature before incubation with proteinase K.

Hybridization was done overnight at 55-60°C. Post- hybridization, slides were washed four times in 4× SSC at RT and digested with RNase A for 30 min at 37°C. Sections were washed at a final stringency of 0.1× SSC at 60°C or 70°C for 30 min and dehydrated. Slides were exposed to Kodak Nuclear Tracking (NTB-2) liquid emulsion for 10-14 days at 4°C. The slides were developed, fixed, and counterstained with hematoxylin and eosin.

    Results
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Mucin gene expression was analyzed at 13 wk, 17/18 wk, and 23 wk of gestation, and in adult lung. These time points encompass the crucial phases of epithelial cell development in the lung. Data presented here are from two fetuses at 13 wk, two at 17/18 wk, and one at 23 wk. Other fetuses of the same ages have been examined for mucin gene expression and there was no significant variation in the patterns between different fetuses of the same gestational age.

MUC3

No expression of MUC3 was detected in fetal trachea or lung at any stage of gestation that was examined (Table 1). This is consistent with the previous finding that MUC3 is an intestinal mucin (6, 8). The MUC3 probe was shown to be efficient at detecting MUC3 RNA in intestinal tissues (not shown) and the fetal tissue samples analyzed in this study were shown to contain intact mRNA for other mucin genes (see below). Hence, the failure to detect MUC3 transcripts in fetal lung tissue is a reliable negative finding. MUC 3 was not expressed in adult lung epithelium.

                              
View this table:
[in this window]
[in a new window]
 

TABLE 1
Developmental expression of mucins in human airway tissue

MUC4

The expression of MUC4 in fetal trachea and lung is shown in Figures 1 and 2 and Table 1. MUC4 mRNA was detected throughout the tracheal epithelium from 13 wk of gestation (Figures 1A-1C) through 23 wk of gestation (Figures 2A-2C) to term. Expression of MUC4 within the lung appears restricted to the epithelium of large airways, bronchi, and large bronchioles. It is detected within the epithelium of bronchi as low levels from 13 wk of gestation (Figures 1D, 1E) and expression levels remain low through the mid-trimester, though by 23 wk there is substantial MUC4 mRNA in the epithelium of large airways (Figures 2D- 2F). In adult lung, MUC4 transcripts were detected in the epithelium of main bronchi and bronchioles (not shown).


View larger version (94K):
[in this window]
[in a new window]
 
Figure 1.   Expression of MUC 4 in 13-wk trachea and bronchus. Expression of MUC4 mRNA in trachea (panels A-C) and bronchus (panels D-F). Panels A and D show brightfield views of sections hybridized with the MUC4 antisense probe and panels B and E show darkfield images of the same respective sections. Panels C and F show darkfield views of consecutive sections hybridized with the MUC4 sense negative control probe. For all panels, size bar = 200 µm.


View larger version (188K):
[in this window]
[in a new window]
 
Figure 2.   Expression of MUC 4 in 23-wk trachea and lung. Expression of MUC4 mRNA in trachea (panels A-C) and lung (panels D-F). Panels A and D show brightfield views of sections hybridized with the MUC4 antisense probe and panels B and E show darkfield images of the same respective sections. In panel E, MUC4 mRNA is seen in the epithelium lining bronchioles. Panels C and F show darkfield views of consecutive sections hybridized with the MUC4 sense negative control probe. For all panels, size bar = 200 µm.

MUC5AC

MUC5AC mRNA was not detected in the airway at 13 wk gestation in sections adjacent to one that contained abundant levels of MUC4 mRNA (Table 1), but was seen in the trachea, both in goblet cells of the surface epithelium and in cells within the neck of submucosal gland ducts, at 17 wk gestation (Figure 3) and at 23 wk. MUC5AC expression appeared more abundant at 17 wk than later in gestation (23 wk) though only one 23-wk fetus was examined. In adult lung, MUC5AC was expressed at high levels in the goblet cells of main bronchi and bronchioles (not shown).


View larger version (88K):
[in this window]
[in a new window]
 
Figure 3.   Expression of MUC 5AC in 17-wk trachea. Expression of MUC5AC mRNA in trachea (panels A-C). Panel A shows a brightfield view of a section hybridized with the MUC5AC antisense probe and panel B shows darkfield images of the same sections. Panel C shows a darkfield view of a consecutive section hybridized with the MUC5AC sense negative control probe. For all panels, size bar = 200 µm.

MUC5B

MUC5B was detected in clusters of cells within the tracheal epithelium at 13 wk (Figure 4C and Table 1), both in the surface epithelium and in subepithelial invaginations. By 23 wk, MUC5B transcripts were found primarily within the epithelium of submucosal glands both within the trachea (Figures 4A, 4B, 4D) and in bronchioles (Figures 4F- 4H). In addition, cells at the neck of tracheal submucosal gland ducts and individual cells elsewhere in the surface epithelium of trachea and bronchioles expressed MUC5B at 23 wk. Abundant expression of MUC5B was seen in adult bronchiolar epithelium (Figure 4E) and in submucosal gland epithelium (not shown).


View larger version (160K):
[in this window]
[in a new window]
 
Figure 4.   Expression of MUC5B in 13-wk trachea, 23-wk bronchus, and adult bronchiole. Expression of MUC5B mRNA in trachea (panels A-D) and bronchus (panels F -H). Panels A, B, and D, 23-wk trachea; panel C, 14-wk trachea; panel E, adult lung bronchiole; panels F -H 23-wk bronchus. Panels A and C-F show brightfield views of sections hybridized with the MUC5B antisense probe; panel B shows a darkfield image of the section shown in A; panel G shows a darkfield image of the section shown in F. Panel H shows a darkfield view of a section consecutive to that shown in panels F and G hybridized with the MUC5B sense negative control probe. For panels A- C and F-H, size bar = 200 µm; for panel D, size bar = 100 µm.

MUC6

MUC6 was not seen in lung epithelium at any gestational age or in adult tissue, though adjacent sections were shown to contain intact mRNA for other mucin genes. The MUC6 tandem repeat probe was shown to be effective at detecting MUC6 mRNA in several organs from the fetal digestive system, including stomach.

MUC7

MUC7 was detected at low levels in tracheal submucosal gland epithelium at 23 wk gestation (not shown), but was not detected elsewhere in the lung at any gestational age.

MUC8

No MUC8 mRNA was detectable in lung epithelium at any gestational age (using either the MUC8 74-bp tandem repeat probe or the pAM3-3 probe) (Table 1). However, as we did not detect expression of MUC8 in adult lung, we cannot be certain whether either probe was effective at detecting MUC8 mRNA in situ.

    Discussion
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The profile of mucin genes that are expressed in the developing lung epithelium is of relevance to lung diseases that manifest early in life such as perinatal infections and cystic fibrosis.

Development of the human lung can be divided into three overlapping stages: the embryonic period between 4 and 7 wk, when the lung buds off the foregut and the epithelial tube appears, divides, and starts invading the surrounding mesenchyme; the fetal period from 5 wk to birth; the postnatal period. The fetal period encompasses three developmental stages: during the pseudoglandular stage (5-17 wk), the conductive airway tissue and its associated vasculature develops; the canalicular stage (16-26 wk) is associated with the further branching of airways and vasculature, the differentiation of type I and type II pneumocytes, appearance of submucosal glands, and the start of surfactant synthesis; and the saccular stage from 25 wk to birth is associated with the formation of more airway generations, dilation of the future gas exchange spaces, and maturation of the surfactant system. Epithelial differentiation occurs outwards from the most central airways, with ciliated and goblet cells, smooth muscle cells, and cartilage arising initially in the large airways and later in smaller airways as they develop. Alveoli start to form between 36 wk and birth and maturation of the lung continues into the postnatal period. Hence an examination of mucin synthesis between 13 and 23 wk of gestation encompasses key phases of lung epithelial differentiation.

We previously examined the developmental expression of human MUC1 and MUC2 (14). MUC1 expression was detected by 12.5 wk of gestation within the epithelium of the respiratory system. The pattern of expression remained similar from this age until late in gestation with most MUC1 mRNA being found within the more proximal portion of the airways. MUC1 expression was seen within the epithelium lining the small bronchi, bronchioles, and more distal parts of the developing airway, but at lower levels moving towards the terminal sacs. Within the adult lung, MUC1 is expressed at high levels within the epithelium of the bronchi, bronchioles, and at slightly lower levels in alveoli.

Expression of MUC2 in the developing respiratory epithelium was restricted to larger bronchioles relatively late in development (after 19 wk) and levels of MUC2 mRNA were very low. In adult lung, MUC2 was clearly seen in goblet cells of the epithelia of the main bronchus and of bronchioles.

We now show that MUC4, MUC5AC and MUC5B are major components of the airway mucus in the developing human lung. MUC4, like MUC1, was expressed in the majority of the epithelial cells lining the airway in the regions where it was detected. However, unlike MUC1, MUC4 was only seen in the tracheal epithelium and in the epithelium lining the bronchi and larger bronchioles. No MUC4 expression was seen in the small airways.

The pattern of expression of MUC5AC resembled that of MUC2, being restricted to individual goblet cells in the airway epithelium. MUC5AC transcripts, like those of MUC2 in the airway were not detected at 13 wk gestation. By 17/18 wk gestation, MUC5AC mRNA was seen in tracheal goblet cells through expression levels appeared lower at 23 wk gestation. MUC5AC mRNA was not detected in the small bronchioles or in distal parts of the lung.

MUC5B shows a distinct pattern of expression from MUC5AC in the airways both prenatally and in adult lung. In adult lung, MUC5B transcripts are seen in submucosal gland epithelium, the epithelium lining the submucosal gland ducts and in the bronchiolar epithelium, primarily in goblet cells. The pattern of expression of MUC5B during fetal development is interesting as it appears to follow the differentiation pathway of submucosal glands. The glands develop as invaginations from precursor cells within the surface epithelium during the second trimester of gestation. By the late second trimester individual glands are morphologically well-differentiated. MUC5B mRNA is detected in populations of the tracheal epithelial cells at 13 wk gestation. By 23 wk it is primarily seen in the epithelium of submucosal glands, both in trachea and bronchi. MUC5B is also expressed at high levels in cells lining the neck of the submucosal gland ducts and at lower levels in individual cells in the surface epithelium of both trachea and bronchi.

This pattern of expression is consistent with MUC5B being transcribed in multiple submucosal gland progenitor cells in the surface airway epithelium at the start of the second trimester. By the end of the second trimester of gestation, the MUC5B transcripts are largely restricted to differentiated epithelial cells within the submucosal gland and gland duct, though a small number of MUC5B-expressing cells remain within the surface epithelium. These data would support models of submucosal gland development in which progenitor cells persist in the adult airway rather than being restricted to a transient phase during proximal airway development (15).

During the early pathology of cystic fibrosis (CF), the lung is not severely affected in comparison to the intestine and the pancreas. Lung pathology is often not evident until after the first postnatal lung infection, though mild distention of submucosal gland cells may be present at birth. In contrast, pancreatic pathology is already evident in the early mid-trimester, with obstruction of small pancreatic ducts with mucoid material. Intestinal obstruction during the late mid-trimester is not uncommon in CF and about 15% of CF babies are born with meconium ileus. In this context, it is of interest that the goblet cell mucins MUC2 and MUC5AC are not expressed until towards the end of the mid-trimester of gestation in the airway epithelium. Further, though MUC5B is expressed in the surface epithelium of trachea at 13 wk, its appearance in submucosal glands accompanies their morphologic differentiation in the late second trimester. Abundant expression of intestinal and pancreatic mucins genes (including MUC2) is seen from at least 13 wk gestation and hence this might provide an explanation for these tissues exhibiting CF-associated pathology from the early mid-trimester.

Another mucin cDNA, MUC8, has been isolated from adult human airway and has been shown to be expressed in this tissue by Northern blot analysis (12). We have been unable to detect expression of this gene during development of the human lung with 2 different probes, though as neither probe detected MUC8 mRNA in adult lung, it is possible that the expression levels of this mucin are too low to be detected by mRNA in situ hybridization.

In summary, mRNAs for MUC1, MUC2, MUC4, MUC5AC, MUC5B, and MUC7 mucins are expressed in the developing human fetal lung. MUC1, MUC4, and MUC5B mRNAs are seen at 13 wk gestation which is the earliest age that we have examined. MUC4 expression is seen in the majority of airway epithelial cells that line the trachea and larger airways though, in contrast to MUC1, is not seen in smaller airways. MUC5AC transcripts are not detected before 17 wk and, like MUC2 transcripts, are highly restricted in their pattern of expression. MUC5AC mRNA is seen in individual goblet cells in tracheal surface epithelium and in the necks of submucosal glands. MUC5B and MUC7 are primarily submucosal gland mucins and MUC5B mRNA expression follows the differentiation path of these glands.

    Footnotes

Address correspondence to: Dr. Ann Harris, Paediatric Molecular Genetics, Institute of Molecular Medicine, Oxford University, John Radcliffe Hospital, Oxford OX3 9DU, UK. E-mail: aharris{at}worf.molbiol.ox.ac.uk

(Received in original form October 7, 1996 and in revised form January 6, 1997).

   Abbreviation: transfer RNA, tRNA.

Acknowledgments: The writers are grateful to Simon Biddolph, Zahra Madgwick, and Dr. Michael Dunhill for their assistance; also to Dr. M. A. Hollingsworth for helpful discussions and Professor R. Moxon for his support. This work was supported by the Cystic Fibrosis Research Trust, UK.
    References
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Porchet, N., N. Van Cong, J. Dufosse, J. P. Audie, V. Guyonnet-Duperat, M. S. Gross, C. Denis, P. Degand, A. Bernheim, and J. P. Aubert. 1991. Molecular cloning and chromosomal localization of a novel human tracheobronchial mucin cDNA containing tandemly repeated sequences of 48 base pairs. Biochem. Biophys. Res. Comm. 175: 414-422 [Medline].

2. Guyonnet-Duperat, V., J.-P. Audie, V. Debailleul, A. Laine, M.-P. Buisine, S. Galiegue-Zoutina, P. Pigny, J.-P. Aubert, and N. Porchet. 1995. Characterization of the human mucin gene MUC5AC: a consensus cysteine-rich domain for 11p15 muscin genes? Biochem. J. 305: 211-219 .

3. Dufosse, J., N. Porchet, J. P. Audie, V. Guyonnet-Duperat, A. Laine, I. Van-Seuningen, S. Marrakchi, P. Degand, and J. P. Aubert. 1993. Degenerate 87-base-pair tandem repeats create hydrophilic/hydrophobic alternating domains in human mucin peptides mapped to 11p15. Biochem. J. 293: 329-337 .

4. Gendler, S. J., C. A. Lancaster, J. Taylor-Papadimitriou, T. Duhig, N. Peat, J. Burchell, L. Pemberton, E.-N. Lalani, and D. Wilson. 1990. Molecular cloning and expression of the human tumour-associated polymorphic epithelial mucin, PEM. J. Biol. Chem. 265: 15286-15293 [Abstract/Free Full Text].

5. Lan, M. S., S. K. Batra, W.-N. Qi, R. S. Metzgar, and M. A. Hollingsworth. 1990. Cloning and sequencing of a human pancreatic tumor cDNA. J. Biol. Chem. 264: 15294-15299 .

6. Gum, J. R., J. C. Byrd, J. W. Hicks, N. W. Toribara, D. T. A. Lamport, and Y. S. Kim. 1989. Molecular cloning of human intestinal mucin cDNAs. J. Biol. Chem. 264: 6480-6487 [Abstract/Free Full Text].

7. Gum, J. R., J. W. Hicks, N. W. Toibara, A.-M. Rothe, R. L. Lagace, and Y. S. Kim. 1992. The human MUC2 intestinal mucin has cysteine-rich subdomains located both upstream and downstream of its central repetitive region. J. Biol. Chem. 267: 21375-21383 [Abstract/Free Full Text].

8. Jany, B. H., M. W. Gallup, P.-S. Yan, J. R. Gum, Y. S. Kim, and C. B. Basbaum. 1991. Human bronchus and intestine express the same mucin gene. J. Clin. Invest. 87: 77-82 .

9. Gum, J. R., J. W. Hicks, D. M. Swallow, R. L. Lagace, J. C. Byrd, D. T. A. Lamport, B. Siddiki, and Y. S. Kim. 1990. Molecular cloning of cDNAs derived from a novel human intestinal mucin gene. Biochem. Biophys. Res. Comm. 171: 407-415 [Medline].

10. Toribara, N. W., A. M. Robertson, S. Ho, W. L. Kuo, E. Gum, J. Hicks, J. C. Byrd, B. Sidikki, and Y. S. Kim. 1993. Human gastric mucin. J. Biol. Chem. 268: 5879-5885 [Abstract/Free Full Text].

11. Bobek, L. A., H. Tsai, A. R. Biesbrock, and M. J. Levine. 1993. Molecular cloning, sequence, and specificity of expression of the gene encoding the low molecular weight human salivary mucin (MUC7). J. Biol. Chem. 268: 20563-20569 [Abstract/Free Full Text].

12. Shankar, V., M. S. Gilmore, R. C. Elkins, and G. P. Sachdev. 1994. A novel human airway mucin cDNA encodes a protein with unique tandem repeat organization. Biochem. J. 300: 295-298 .

13. Rose, M. C.. 1992. Mucins: structure, function and role in pulmonary diseases. Am. J. Physiol. 263: L413-L429 [Abstract/Free Full Text].

14. Chambers, J. A., M. A. Hollingsworth, A. E. O. Trezise, and A. Harris. 1994. Developmental expression of mucin genes MUC1 and MUC2. J. Cell Sci. 107: 413-424 [Abstract].

15. Englehardt, J. F., H. Schlossberg, J. R. Yankaskas, and L. Dudus. 1995. Progenitor cells of the adult human airway involved in submucosal gland development. Development 121: 2031-2046 [Abstract].





This article has been cited by other articles:


Home page
J. Immunol.Home page
T. Fujisawa, S. Velichko, P. Thai, L.-Y. Hung, F. Huang, and R. Wu
Regulation of Airway MUC5AC Expression by IL-1{beta} and IL-17A; the NF-{kappa}B Paradigm
J. Immunol., November 15, 2009; 183(10): 6236 - 6243.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
M. Kesimer, M. Scull, B. Brighton, G. DeMaria, K. Burns, W. O'Neal, R. J. Pickles, and J. K. Sheehan
Characterization of exosome-like vesicles released from human tracheobronchial ciliated epithelium: a possible role in innate defense
FASEB J, June 1, 2009; 23(6): 1858 - 1868.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
P. Chaturvedi, A. P. Singh, and S. K. Batra
Structure, evolution, and biology of the MUC4 mucin
FASEB J, April 1, 2008; 22(4): 966 - 981.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
Y. Zhu, C. Ehre, L. H. Abdullah, J. K. Sheehan, M. Roy, C. M. Evans, B. F. Dickey, and C. W. Davis
Munc13-2-/- baseline secretion defect reveals source of oligomeric mucins in mouse airways
J. Physiol., April 1, 2008; 586(7): 1977 - 1992.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
D. Y. C. Wu, R. Wu, Y. Chen, N. Tarasova, and M. M. J. Chang
PMA Stimulates MUC5B Gene Expression through an Sp1-Based Mechanism in Airway Epithelial Cells
Am. J. Respir. Cell Mol. Biol., November 1, 2007; 37(5): 589 - 597.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
H. W. J. Young, O. W. Williams, D. Chandra, L. K. Bellinghausen, G. Perez, A. Suarez, M. J. Tuvim, M. G. Roy, S. N. Alexander, S. J. Moghaddam, et al.
Central Role of Muc5ac Expression in Mucous Metaplasia and Its Regulation by Conserved 5' Elements
Am. J. Respir. Cell Mol. Biol., September 1, 2007; 37(3): 273 - 290.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Jonckheere, A. Vincent, M. Perrais, M.-P. Ducourouble, A. K.-v. Male, J.-P. Aubert, P. Pigny, K. L. Carraway, J.-N. Freund, I. B. Renes, et al.
The Human Mucin MUC4 Is Transcriptionally Regulated by Caudal-related Homeobox, Hepatocyte Nuclear Factors, Forkhead Box A, and GATA Endodermal Transcription Factors in Epithelial Cancer Cells
J. Biol. Chem., August 3, 2007; 282(31): 22638 - 22650.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
M. O. Henke, G. John, M. Germann, H. Lindemann, and B. K. Rubin
MUC5AC and MUC5B Mucins Increase in Cystic Fibrosis Airway Secretions during Pulmonary Exacerbation
Am. J. Respir. Crit. Care Med., April 15, 2007; 175(8): 816 - 821.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
D. Yuan-chen Wu, R. Wu, S. P. Reddy, Y. C. Lee, and M. M.-J. Chang
Distinctive Epidermal Growth Factor Receptor/Extracellular Regulated Kinase-Independent and -Dependent Signaling Pathways in the Induction of Airway Mucin 5B and Mucin 5AC Expression by Phorbol 12-Myristate 13-Acetate
Am. J. Pathol., January 1, 2007; 170(1): 20 - 32.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
O. W. Williams, A. Sharafkhaneh, V. Kim, B. F. Dickey, and C. M. Evans
Airway Mucus: From Production to Secretion
Am. J. Respir. Cell Mol. Biol., May 1, 2006; 34(5): 527 - 536.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
M. C. Rose and J. A. Voynow
Respiratory Tract Mucin Genes and Mucin Glycoproteins in Health and Disease
Physiol Rev, January 1, 2006; 86(1): 245 - 278.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. M. Holmen, N. G. Karlsson, L. H. Abdullah, S. H. Randell, J. K. Sheehan, G. C. Hansson, and C. W. Davis
Mucins and their O-Glycans from human bronchial epithelial cell cultures
Am J Physiol Lung Cell Mol Physiol, October 1, 2004; 287(4): L824 - L834.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
K. Hashimoto, B. S. Graham, S. B. Ho, K. B. Adler, R. D. Collins, S. J. Olson, W. Zhou, T. Suzutani, P. W. Jones, K. Goleniewska, et al.
Respiratory Syncytial Virus in Allergic Lung Inflammation Increases Muc5ac and Gob-5
Am. J. Respir. Crit. Care Med., August 1, 2004; 170(3): 306 - 312.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. Chokki, S. Yamamura, H. Eguchi, T. Masegi, H. Horiuchi, H. Tanabe, T. Kamimura, and S. Yasuoka
Human Airway Trypsin-Like Protease Increases Mucin Gene Expression in Airway Epithelial Cells
Am. J. Respir. Cell Mol. Biol., April 1, 2004; 30(4): 470 - 478.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
J. Tamaoki
The Effects of Macrolides on Inflammatory Cells
Chest, February 1, 2004; 125 (2009): 41S - 51S.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
B. M. Fischer, J. G. Cuellar, M. L. Diehl, A. M. deFreytas, J. Zhang, K. L. Carraway, and J. A. Voynow
Neutrophil elastase increases MUC4 expression in normal human bronchial epithelial cells
Am J Physiol Lung Cell Mol Physiol, April 1, 2003; 284(4): L671 - L679.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-P. Di, R. Harper, Y. Zhao, N. Pahlavan, W. Finkbeiner, and R. Wu
Molecular Cloning and Characterization of spurt, a Human Novel Gene That Is Retinoic Acid-inducible and Encodes a Secretory Protein Specific in Upper Respiratory Tracts
J. Biol. Chem., January 3, 2003; 278(2): 1165 - 1173.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
G. D. Leikauf, M. T. Borchers, D. R. Prows, and L. G. Simpson
Mucin Apoprotein Expression in COPD*
Chest, May 1, 2002; 121 (2009): 166S - 182S.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. C. Rose, T. J. Nickola, and J. A. Voynow
Airway Mucus Obstruction: Mucin Glycoproteins, MUC Gene Regulation and Goblet Cell Hyperplasia
Am. J. Respir. Cell Mol. Biol., November 1, 2001; 25(5): 533 - 537.
[Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
Y. Chen, Y. H. Zhao, Y.-P. Di, and R. Wu
Characterization of Human Mucin 5B Gene Expression in Airway Epithelium and the Genomic Clone of the Amino-Terminal and 5'-Flanking Region
Am. J. Respir. Cell Mol. Biol., November 1, 2001; 25(5): 542 - 553.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
Y. Li, L. D. Martin, M. Minnicozzi, S. Greenfeder, J. Fine, C. A. Pettersen, B. Chorley, and K. B. Adler
Enhanced Expression of Mucin Genes in a Guinea Pig Model of Allergic Asthma
Am. J. Respir. Cell Mol. Biol., November 1, 2001; 25(5): 644 - 651.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
Y. Chen, Y. H. Zhao, and R. Wu
Differential Regulation of Airway Mucin Gene Expression and Mucin Secretion by Extracellular Nucleotide Triphosphates
Am. J. Respir. Cell Mol. Biol., October 1, 2001; 25(4): 409 - 417.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
Y. CHEN, Y. H. ZHAO, and R. WU
In Silico Cloning of Mouse Muc5b Gene and Upregulation of Its Expression in Mouse Asthma Model
Am. J. Respir. Crit. Care Med., September 15, 2001; 164(6): 1059 - 1066.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
T. SHIMIZU, H. HIRANO, S. SHIMIZU, C. KISHIOKA, Y. SAKAKURA, and Y. MAJIMA
Differential Properties of Mucous Glycoproteins in Rat Nasal Epithelium . A Comparison between Allergic Inflammation and Lipopolysaccharide Stimulation
Am. J. Respir. Crit. Care Med., September 15, 2001; 164(6): 1077 - 1082.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
P. Roger, J-P. Gascard, J. Bara, E. Dulmet, and C. Brink
EGTA treatment of human airways in vitro unmasks M1/MUC5AC mucin in submucosal glands
Eur. Respir. J., July 1, 2001; 18(1): 176 - 183.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. Lin, V. Tsuprun, H. Kawano, M. M. Paparella, Z. Zhang, R. Anway, and S. B. Ho
Characterization of mucins in human middle ear and Eustachian tube
Am J Physiol Lung Cell Mol Physiol, June 1, 2001; 280(6): L1157 - L1167.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
K. Yanagihara, M. Seki, and P.-W. Cheng
Lipopolysaccharide Induces Mucus Cell Metaplasia in Mouse Lung
Am. J. Respir. Cell Mol. Biol., January 1, 2001; 24(1): 66 - 73.
[Abstract] [Full Text]


Home page
J. Histochem. Cytochem.Home page
M.-P. Buisine, L. Devisme, P. Degand, M.-C. Dieu, B. Gosselin, M.-C. Copin, J.-P. Aubert, and N. Porchet
Developmental Mucin Gene Expression in the Gastroduodenal Tract and Accessory Digestive Glands. II. Duodenum and Liver, Gallbladder, and Pancreas
J. Histochem. Cytochem., December 1, 2000; 48(12): 1667 - 1676.
[Abstract] [Full Text]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
L. E. Vinall, J. C. Fowler, A. L. Jones, H. J. Kirkbride, C. de Bolos, A. Laine, N. Porchet, J. R. Gum, Y. S. Kim, F. M. Moss, et al.
Polymorphism of Human Mucin Genes in Chest Disease . Possible Significance of MUC2
Am. J. Respir. Cell Mol. Biol., November 1, 2000; 23(5): 678 - 686.
[Abstract] [Full Text]


Home page
Mol Biol EvolHome page
J.-L. Desseyn, J.-P. Aubert, N. Porchet, and A. Laine
Evolution of the Large Secreted Gel-Forming Mucins
Mol. Biol. Evol., August 1, 2000; 17(8): 1175 - 1184.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. Zuhdi Alimam, F. M. Piazza, D. M. Selby, N. Letwin, L. Huang, and M. C. Rose
Muc-5/5ac Mucin Messenger RNA and Protein Expression Is a Marker of Goblet Cell Metaplasia in Murine Airways
Am. J. Respir. Cell Mol. Biol., March 1, 2000; 22(3): 253 - 260.
[Abstract] [Full Text]


Home page
J. Histochem. Cytochem.Home page
C. J. Reid and A. Harris
Expression of the MUC 6 Mucin Gene in Development of the Human Kidney and Male Genital Ducts
J. Histochem. Cytochem., June 1, 1999; 47(6): 817 - 822.
[Abstract] [Full Text]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
S. H. Bernacki, A. L. Nelson, L. Abdullah, J. K. Sheehan, A. Harris, C. William Davis, and S. H. Randell
Mucin Gene Expression during Differentiation of Human Airway Epithelia In Vitro . MUC4 and MUC5B Are Strongly Induced
Am. J. Respir. Cell Mol. Biol., April 1, 1999; 20(4): 595 - 604.
[Abstract] [Full Text]


Home page
Am. J. Respir. Crit. Care Med.Home page
A. WIEDE, W. JAGLA, T. WELTE, T. KOHNLEIN, H. BUSK, and W. HOFFMANN
Localization of TFF3, a New Mucus-associated Peptide of the Human Respiratory Tract
Am. J. Respir. Crit. Care Med., April 1, 1999; 159(4): 1330 - 1335.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. T. Borchers, M. P. Carty, and G. D. Leikauf
Regulation of human airway mucins by acrolein and inflammatory mediators
Am J Physiol Lung Cell Mol Physiol, April 1, 1999; 276(4): L549 - L555.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. S. Koo, J.-H. Yoon, T. Gray, D. Norford, A. M. Jetten, and P. Nettesheim
Restoration of the Mucous Phenotype by Retinoic Acid in Retinoid-Deficient Human Bronchial Cell Cultures: Changes in Mucin Gene Expression
Am. J. Respir. Cell Mol. Biol., January 1, 1999; 20(1): 43 - 52.
[Abstract] [Full Text]


Home page
GutHome page
C J Reid and A Harris
Developmental expression of mucin genes in the human gastrointestinal system
Gut, February 1, 1998; 42(2): 220 - 226.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reid, C. J.
Right arrow Articles by Harris, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reid, C. J.
Right arrow Articles by Harris, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 1997 American Thoracic Society.