|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
Abstract |
|---|
|
|
|---|
Mucin glycoproteins play a key role in the normal function of the airway epithelium. We examined the expression of mucin genes, MUC3, 4, 5AC, 5B, 6, 7, and 8 in human fetal tissues to establish the localization and age of onset of expression of each mucin gene during human development. We detected expression of MUC4, 5AC, 5B, and 7 in the mid-trimester airway epithelium but did not detect expression of MUC3, 6, or 8. MUC4 was expressed in the trachea and large airways in the majority of cells in the airway epithelium. Expression of MUC5AC was only seen in individual goblet cells in the trachea, while MUC5B was expressed in the surface epithelium of the trachea at 13 wk but was largely restricted to submucosal glands by 23 wk of gestation.
| |
Introduction |
|---|
|
|
|---|
Mucous glycoproteins, mucins, play a key role in the human airways by protecting the epithelial surface from injury and by facilitating removal of materials that enter the lung. Clearance of the mucous layer is achieved by beating cilia on ciliated epithelial cells in the airway which move the secretions up through the airways towards the nose and throat. The molecular composition of proteins in this mucous layer was poorly characterized until the isolation of a number of human mucin genes enabled the identification of those that are expressed in the airway epithelium (1).
Nine mucin genes have been identified, MUC1, 2, 3, 4, 5AC, 5B, 6, 7, and 8 (1), though only MUC1, 2, and 7 have been fully cloned. Partial sequence, generally from the tandem repeat, is available for the remainder of the genes. Studies of tissue localization have been carried out for a number of mucins using antibodies; however, these studies have the limitation that many of the antibodies bind to carbohydrate determinants that are present on different mucin core proteins. Some protein epitopes may also be masked by glycosylation. Hence, cell-specific localization of mucin gene expression is most reliably determined by using in situ mRNA hybridization with gene-specific oligonucleotides or riboprobes.
Mucins play a fundamental role in the pathogenesis of many lung diseases, particularly those involving chronic inflammation of the airways or susceptibility to infection such as asthma, chronic bronchitis, and cystic fibrosis. Mucin gene expression has been examined in the postnatal respiratory system of normal individuals and in a number of disease states (reviewed in 13). We examined the developmental expression of human mucin genes to establish which genes are important in the development and differentiation of the human lung epithelium. We previously reported expression of MUC1 and MUC2 in the fetal lung (14). Data in this report show expression of MUC4, MUC5AC, and MUC5B in the mid-trimester airway epithelium. Low levels of MUC7 were seen in tracheal submucosal glands at 23 wk. No expression of MUC3, 6, or 8 was observed. MUC4 was detected in the trachea and large airways where it was expressed in the majority of cells in the airway epithelium. MUC5AC was only expressed in individual goblet cells in the trachea both within the surface epithelium and in the necks of submucosal glands. MUC5B transcripts were detected in the surface epithelium of the trachea at 13 wk, but were mainly seen in submucosal gland epithelium by 23 wk of gestation.
| |
Materials and Methods |
|---|
|
|
|---|
Tissues from mid-trimester terminations were obtained
with local ethical committee approval and age was determined on the basis of foot length. Data presented here are
derived from two 13-wk fetuses, one male and one female;
two 17/18-wk fetuses, one male and one female; and one
female fetus of 23-wk gestation. Adult lung was normal tissue adjacent to tumors removed at surgery. Tissues for in
situ hybridization were fixed directly in 4% paraformaldehyde (pH 9.5) overnight at 4°C, embedded and frozen in
liquid nitrogen prior to cutting 10-µm sections. Frozen sections were mounted onto Vectabond-treated slides (Vector Laboratories Ltd., Burlingame, CA) and stored desiccated at
20°C until used. For each tissue, a minimum of 9 sections were hybridized with antisense probes for each
mucin gene and 6 sections were hybridized with the respective sense probes.
In situ Hybridization
In situ hybridization was carried out as described previously (14). The following 74 bp double-stranded oligonucleotide probes were used. MUC3:GACCACATACCACAGTACTCCCAGCTTCACTTCTTTGATCACCATCACTGAG-ACCACCTCACACAGTACTCCCA (bases 140-213 EMBL Accession number M55405); MUC4:CACAAGTCACGCCACCTCTCTTCTTGTCACCGACGCTTCCTCAGTA-TCCACAGGTGACACCACCCCTCTTCCTG (bases 111-184 EMBL Accession number M64594); MUC5AC:CCCACGACCAGCACAACCTCTGCCCCTACAACAAG-AACAACTTCTGCTCCTAAAAGCAGCACAACCTCTGCCGC (bases 58-131 EMBL Accession number Z34278); MUC5B:GGACGACCTGGATCCTCACAGAGCTGACCACAACAGACCACTACGACTGCATCCACTGGATCCACGGCCACCCC (bases 221-294 EMBL Accession number X74955); MUC6:GGTCCACACACACAGCCCCACCAGTGACGCCGACCACCAGTGGGACGAGCCAAGCCGCGAGCTCATTCAGCACA (bases 308-381 EMBL Accession number S57578); MUC7:ACACCACAGCTGCCCCACCCACACCTTCTGCAACTACACCAGCTCCACCATCTTCCTCAGCTCCACCAGAGACC (bases 587-660 EMBL Accession number L13283); MUC8:CCGGGTTCATGAGCTGCCCACGCCCTTTCCAGGAAGGGACCCCGGGTTCACGAGCTGCCCACGTCCTCTCCAGG (bases 35-109 EMBL Accession number U14383). Each oligonucleotide carried additional bases to enable direct cloning into the BamH I and Hind III sites of pBluescript. Antisense and sense probes were generated from the T7 and T3 promoters, respectively. An additional probe for MUC8 mRNA (pAM3-3) that includes bases 1-312 of the pAM1 clone (12) that encompasses part of the MUC8 tandem repeat was kindly provided by Dr. G. Sachdev, Oklahoma. Purified probes were diluted to 5 × 106-2 × 107 cpm/ml in a hybridization solution containing formamide (final concentration 60-65%), 1× Denhardt's solution, 10% dextran sulphate, 0.5 mg/ml RNase-free transfer RNA (tRNA), and 10 mM DTT.
Tissue sections were digested with 10 µg/ml proteinase K for 2 min at 37°C, then treated with 25 mM acetic anhydride in 0.1 M triethanolamine (pH 8.0) for 10 min at room temperature (RT); briefly rinsed in 2× SSC before dehydrating through a graded ethanol series and air dried. As a control for nonspecific binding of the antisense probe, some sections were treated with 20 µg/ml RNase A for 15 min at room temperature before incubation with proteinase K.
Hybridization was done overnight at 55-60°C. Post- hybridization, slides were washed four times in 4× SSC at RT and digested with RNase A for 30 min at 37°C. Sections were washed at a final stringency of 0.1× SSC at 60°C or 70°C for 30 min and dehydrated. Slides were exposed to Kodak Nuclear Tracking (NTB-2) liquid emulsion for 10-14 days at 4°C. The slides were developed, fixed, and counterstained with hematoxylin and eosin.
| |
Results |
|---|
|
|
|---|
Mucin gene expression was analyzed at 13 wk, 17/18 wk, and 23 wk of gestation, and in adult lung. These time points encompass the crucial phases of epithelial cell development in the lung. Data presented here are from two fetuses at 13 wk, two at 17/18 wk, and one at 23 wk. Other fetuses of the same ages have been examined for mucin gene expression and there was no significant variation in the patterns between different fetuses of the same gestational age.
MUC3
No expression of MUC3 was detected in fetal trachea or lung at any stage of gestation that was examined (Table 1). This is consistent with the previous finding that MUC3 is an intestinal mucin (6, 8). The MUC3 probe was shown to be efficient at detecting MUC3 RNA in intestinal tissues (not shown) and the fetal tissue samples analyzed in this study were shown to contain intact mRNA for other mucin genes (see below). Hence, the failure to detect MUC3 transcripts in fetal lung tissue is a reliable negative finding. MUC 3 was not expressed in adult lung epithelium.
|
MUC4
The expression of MUC4 in fetal trachea and lung is shown in Figures 1 and 2 and Table 1. MUC4 mRNA was detected throughout the tracheal epithelium from 13 wk of gestation (Figures 1A-1C) through 23 wk of gestation (Figures 2A-2C) to term. Expression of MUC4 within the lung appears restricted to the epithelium of large airways, bronchi, and large bronchioles. It is detected within the epithelium of bronchi as low levels from 13 wk of gestation (Figures 1D, 1E) and expression levels remain low through the mid-trimester, though by 23 wk there is substantial MUC4 mRNA in the epithelium of large airways (Figures 2D- 2F). In adult lung, MUC4 transcripts were detected in the epithelium of main bronchi and bronchioles (not shown).
|
|
MUC5AC
MUC5AC mRNA was not detected in the airway at 13 wk gestation in sections adjacent to one that contained abundant levels of MUC4 mRNA (Table 1), but was seen in the trachea, both in goblet cells of the surface epithelium and in cells within the neck of submucosal gland ducts, at 17 wk gestation (Figure 3) and at 23 wk. MUC5AC expression appeared more abundant at 17 wk than later in gestation (23 wk) though only one 23-wk fetus was examined. In adult lung, MUC5AC was expressed at high levels in the goblet cells of main bronchi and bronchioles (not shown).
|
MUC5B
MUC5B was detected in clusters of cells within the tracheal epithelium at 13 wk (Figure 4C and Table 1), both in the surface epithelium and in subepithelial invaginations. By 23 wk, MUC5B transcripts were found primarily within the epithelium of submucosal glands both within the trachea (Figures 4A, 4B, 4D) and in bronchioles (Figures 4F- 4H). In addition, cells at the neck of tracheal submucosal gland ducts and individual cells elsewhere in the surface epithelium of trachea and bronchioles expressed MUC5B at 23 wk. Abundant expression of MUC5B was seen in adult bronchiolar epithelium (Figure 4E) and in submucosal gland epithelium (not shown).
|
MUC6
MUC6 was not seen in lung epithelium at any gestational age or in adult tissue, though adjacent sections were shown to contain intact mRNA for other mucin genes. The MUC6 tandem repeat probe was shown to be effective at detecting MUC6 mRNA in several organs from the fetal digestive system, including stomach.
MUC7
MUC7 was detected at low levels in tracheal submucosal gland epithelium at 23 wk gestation (not shown), but was not detected elsewhere in the lung at any gestational age.
MUC8
No MUC8 mRNA was detectable in lung epithelium at any gestational age (using either the MUC8 74-bp tandem repeat probe or the pAM3-3 probe) (Table 1). However, as we did not detect expression of MUC8 in adult lung, we cannot be certain whether either probe was effective at detecting MUC8 mRNA in situ.
| |
Discussion |
|---|
|
|
|---|
The profile of mucin genes that are expressed in the developing lung epithelium is of relevance to lung diseases that manifest early in life such as perinatal infections and cystic fibrosis.
Development of the human lung can be divided into three overlapping stages: the embryonic period between 4 and 7 wk, when the lung buds off the foregut and the epithelial tube appears, divides, and starts invading the surrounding mesenchyme; the fetal period from 5 wk to birth; the postnatal period. The fetal period encompasses three developmental stages: during the pseudoglandular stage (5-17 wk), the conductive airway tissue and its associated vasculature develops; the canalicular stage (16-26 wk) is associated with the further branching of airways and vasculature, the differentiation of type I and type II pneumocytes, appearance of submucosal glands, and the start of surfactant synthesis; and the saccular stage from 25 wk to birth is associated with the formation of more airway generations, dilation of the future gas exchange spaces, and maturation of the surfactant system. Epithelial differentiation occurs outwards from the most central airways, with ciliated and goblet cells, smooth muscle cells, and cartilage arising initially in the large airways and later in smaller airways as they develop. Alveoli start to form between 36 wk and birth and maturation of the lung continues into the postnatal period. Hence an examination of mucin synthesis between 13 and 23 wk of gestation encompasses key phases of lung epithelial differentiation.
We previously examined the developmental expression of human MUC1 and MUC2 (14). MUC1 expression was detected by 12.5 wk of gestation within the epithelium of the respiratory system. The pattern of expression remained similar from this age until late in gestation with most MUC1 mRNA being found within the more proximal portion of the airways. MUC1 expression was seen within the epithelium lining the small bronchi, bronchioles, and more distal parts of the developing airway, but at lower levels moving towards the terminal sacs. Within the adult lung, MUC1 is expressed at high levels within the epithelium of the bronchi, bronchioles, and at slightly lower levels in alveoli.
Expression of MUC2 in the developing respiratory epithelium was restricted to larger bronchioles relatively late in development (after 19 wk) and levels of MUC2 mRNA were very low. In adult lung, MUC2 was clearly seen in goblet cells of the epithelia of the main bronchus and of bronchioles.
We now show that MUC4, MUC5AC and MUC5B are major components of the airway mucus in the developing human lung. MUC4, like MUC1, was expressed in the majority of the epithelial cells lining the airway in the regions where it was detected. However, unlike MUC1, MUC4 was only seen in the tracheal epithelium and in the epithelium lining the bronchi and larger bronchioles. No MUC4 expression was seen in the small airways.
The pattern of expression of MUC5AC resembled that of MUC2, being restricted to individual goblet cells in the airway epithelium. MUC5AC transcripts, like those of MUC2 in the airway were not detected at 13 wk gestation. By 17/18 wk gestation, MUC5AC mRNA was seen in tracheal goblet cells through expression levels appeared lower at 23 wk gestation. MUC5AC mRNA was not detected in the small bronchioles or in distal parts of the lung.
MUC5B shows a distinct pattern of expression from MUC5AC in the airways both prenatally and in adult lung. In adult lung, MUC5B transcripts are seen in submucosal gland epithelium, the epithelium lining the submucosal gland ducts and in the bronchiolar epithelium, primarily in goblet cells. The pattern of expression of MUC5B during fetal development is interesting as it appears to follow the differentiation pathway of submucosal glands. The glands develop as invaginations from precursor cells within the surface epithelium during the second trimester of gestation. By the late second trimester individual glands are morphologically well-differentiated. MUC5B mRNA is detected in populations of the tracheal epithelial cells at 13 wk gestation. By 23 wk it is primarily seen in the epithelium of submucosal glands, both in trachea and bronchi. MUC5B is also expressed at high levels in cells lining the neck of the submucosal gland ducts and at lower levels in individual cells in the surface epithelium of both trachea and bronchi.
This pattern of expression is consistent with MUC5B being transcribed in multiple submucosal gland progenitor cells in the surface airway epithelium at the start of the second trimester. By the end of the second trimester of gestation, the MUC5B transcripts are largely restricted to differentiated epithelial cells within the submucosal gland and gland duct, though a small number of MUC5B-expressing cells remain within the surface epithelium. These data would support models of submucosal gland development in which progenitor cells persist in the adult airway rather than being restricted to a transient phase during proximal airway development (15).
During the early pathology of cystic fibrosis (CF), the lung is not severely affected in comparison to the intestine and the pancreas. Lung pathology is often not evident until after the first postnatal lung infection, though mild distention of submucosal gland cells may be present at birth. In contrast, pancreatic pathology is already evident in the early mid-trimester, with obstruction of small pancreatic ducts with mucoid material. Intestinal obstruction during the late mid-trimester is not uncommon in CF and about 15% of CF babies are born with meconium ileus. In this context, it is of interest that the goblet cell mucins MUC2 and MUC5AC are not expressed until towards the end of the mid-trimester of gestation in the airway epithelium. Further, though MUC5B is expressed in the surface epithelium of trachea at 13 wk, its appearance in submucosal glands accompanies their morphologic differentiation in the late second trimester. Abundant expression of intestinal and pancreatic mucins genes (including MUC2) is seen from at least 13 wk gestation and hence this might provide an explanation for these tissues exhibiting CF-associated pathology from the early mid-trimester.
Another mucin cDNA, MUC8, has been isolated from adult human airway and has been shown to be expressed in this tissue by Northern blot analysis (12). We have been unable to detect expression of this gene during development of the human lung with 2 different probes, though as neither probe detected MUC8 mRNA in adult lung, it is possible that the expression levels of this mucin are too low to be detected by mRNA in situ hybridization.
In summary, mRNAs for MUC1, MUC2, MUC4, MUC5AC, MUC5B, and MUC7 mucins are expressed in the developing human fetal lung. MUC1, MUC4, and MUC5B mRNAs are seen at 13 wk gestation which is the earliest age that we have examined. MUC4 expression is seen in the majority of airway epithelial cells that line the trachea and larger airways though, in contrast to MUC1, is not seen in smaller airways. MUC5AC transcripts are not detected before 17 wk and, like MUC2 transcripts, are highly restricted in their pattern of expression. MUC5AC mRNA is seen in individual goblet cells in tracheal surface epithelium and in the necks of submucosal glands. MUC5B and MUC7 are primarily submucosal gland mucins and MUC5B mRNA expression follows the differentiation path of these glands.
| |
Footnotes |
|---|
Address correspondence to: Dr. Ann Harris, Paediatric Molecular Genetics, Institute of Molecular Medicine, Oxford University, John Radcliffe Hospital, Oxford OX3 9DU, UK. E-mail: aharris{at}worf.molbiol.ox.ac.uk
(Received in original form October 7, 1996 and in revised form January 6, 1997).
Abbreviation: transfer RNA, tRNA.Acknowledgments: The writers are grateful to Simon Biddolph, Zahra Madgwick, and Dr. Michael Dunhill for their assistance; also to Dr. M. A. Hollingsworth for helpful discussions and Professor R. Moxon for his support. This work was supported by the Cystic Fibrosis Research Trust, UK.
| |
References |
|---|
|
|
|---|
1. Porchet, N., N. Van Cong, J. Dufosse, J. P. Audie, V. Guyonnet-Duperat, M. S. Gross, C. Denis, P. Degand, A. Bernheim, and J. P. Aubert. 1991. Molecular cloning and chromosomal localization of a novel human tracheobronchial mucin cDNA containing tandemly repeated sequences of 48 base pairs. Biochem. Biophys. Res. Comm. 175: 414-422 [Medline].
2. Guyonnet-Duperat, V., J.-P. Audie, V. Debailleul, A. Laine, M.-P. Buisine, S. Galiegue-Zoutina, P. Pigny, J.-P. Aubert, and N. Porchet. 1995. Characterization of the human mucin gene MUC5AC: a consensus cysteine-rich domain for 11p15 muscin genes? Biochem. J. 305: 211-219 .
3. Dufosse, J., N. Porchet, J. P. Audie, V. Guyonnet-Duperat, A. Laine, I. Van-Seuningen, S. Marrakchi, P. Degand, and J. P. Aubert. 1993. Degenerate 87-base-pair tandem repeats create hydrophilic/hydrophobic alternating domains in human mucin peptides mapped to 11p15. Biochem. J. 293: 329-337 .
4.
Gendler, S. J.,
C. A. Lancaster,
J. Taylor-Papadimitriou,
T. Duhig,
N. Peat,
J. Burchell,
L. Pemberton,
E.-N. Lalani, and
D. Wilson.
1990.
Molecular cloning and expression of the human tumour-associated polymorphic epithelial mucin, PEM.
J. Biol. Chem.
265:
15286-15293
5. Lan, M. S., S. K. Batra, W.-N. Qi, R. S. Metzgar, and M. A. Hollingsworth. 1990. Cloning and sequencing of a human pancreatic tumor cDNA. J. Biol. Chem. 264: 15294-15299 .
6.
Gum, J. R.,
J. C. Byrd,
J. W. Hicks,
N. W. Toribara,
D. T. A. Lamport, and
Y. S. Kim.
1989.
Molecular cloning of human intestinal mucin cDNAs.
J. Biol. Chem.
264:
6480-6487
7.
Gum, J. R.,
J. W. Hicks,
N. W. Toibara,
A.-M. Rothe,
R. L. Lagace, and
Y. S. Kim.
1992.
The human MUC2 intestinal mucin has cysteine-rich subdomains located both upstream and downstream of its central repetitive
region.
J. Biol. Chem.
267:
21375-21383
8. Jany, B. H., M. W. Gallup, P.-S. Yan, J. R. Gum, Y. S. Kim, and C. B. Basbaum. 1991. Human bronchus and intestine express the same mucin gene. J. Clin. Invest. 87: 77-82 .
9. Gum, J. R., J. W. Hicks, D. M. Swallow, R. L. Lagace, J. C. Byrd, D. T. A. Lamport, B. Siddiki, and Y. S. Kim. 1990. Molecular cloning of cDNAs derived from a novel human intestinal mucin gene. Biochem. Biophys. Res. Comm. 171: 407-415 [Medline].
10.
Toribara, N. W.,
A. M. Robertson,
S. Ho,
W. L. Kuo,
E. Gum,
J. Hicks,
J. C. Byrd,
B. Sidikki, and
Y. S. Kim.
1993.
Human gastric mucin.
J. Biol. Chem.
268:
5879-5885
11.
Bobek, L. A.,
H. Tsai,
A. R. Biesbrock, and
M. J. Levine.
1993.
Molecular cloning, sequence, and specificity of expression of the gene encoding the
low molecular weight human salivary mucin (MUC7).
J. Biol. Chem.
268:
20563-20569
12. Shankar, V., M. S. Gilmore, R. C. Elkins, and G. P. Sachdev. 1994. A novel human airway mucin cDNA encodes a protein with unique tandem repeat organization. Biochem. J. 300: 295-298 .
13.
Rose, M. C..
1992.
Mucins: structure, function and role in pulmonary diseases.
Am. J. Physiol.
263:
L413-L429
14. Chambers, J. A., M. A. Hollingsworth, A. E. O. Trezise, and A. Harris. 1994. Developmental expression of mucin genes MUC1 and MUC2. J. Cell Sci. 107: 413-424 [Abstract].
15. Englehardt, J. F., H. Schlossberg, J. R. Yankaskas, and L. Dudus. 1995. Progenitor cells of the adult human airway involved in submucosal gland development. Development 121: 2031-2046 [Abstract].
This article has been cited by other articles:
![]() |
T. Fujisawa, S. Velichko, P. Thai, L.-Y. Hung, F. Huang, and R. Wu Regulation of Airway MUC5AC Expression by IL-1{beta} and IL-17A; the NF-{kappa}B Paradigm J. Immunol., November 15, 2009; 183(10): 6236 - 6243. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kesimer, M. Scull, B. Brighton, G. DeMaria, K. Burns, W. O'Neal, R. J. Pickles, and J. K. Sheehan Characterization of exosome-like vesicles released from human tracheobronchial ciliated epithelium: a possible role in innate defense FASEB J, June 1, 2009; 23(6): 1858 - 1868. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Chaturvedi, A. P. Singh, and S. K. Batra Structure, evolution, and biology of the MUC4 mucin FASEB J, April 1, 2008; 22(4): 966 - 981. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhu, C. Ehre, L. H. Abdullah, J. K. Sheehan, M. Roy, C. M. Evans, B. F. Dickey, and C. W. Davis Munc13-2-/- baseline secretion defect reveals source of oligomeric mucins in mouse airways J. Physiol., April 1, 2008; 586(7): 1977 - 1992. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Y. C. Wu, R. Wu, Y. Chen, N. Tarasova, and M. M. J. Chang PMA Stimulates MUC5B Gene Expression through an Sp1-Based Mechanism in Airway Epithelial Cells Am. J. Respir. Cell Mol. Biol., November 1, 2007; 37(5): 589 - 597. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. W. J. Young, O. W. Williams, D. Chandra, L. K. Bellinghausen, G. Perez, A. Suarez, M. J. Tuvim, M. G. Roy, S. N. Alexander, S. J. Moghaddam, et al. Central Role of Muc5ac Expression in Mucous Metaplasia and Its Regulation by Conserved 5' Elements Am. J. Respir. Cell Mol. Biol., September 1, 2007; 37(3): 273 - 290. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Jonckheere, A. Vincent, M. Perrais, M.-P. Ducourouble, A. K.-v. Male, J.-P. Aubert, P. Pigny, K. L. Carraway, J.-N. Freund, I. B. Renes, et al. The Human Mucin MUC4 Is Transcriptionally Regulated by Caudal-related Homeobox, Hepatocyte Nuclear Factors, Forkhead Box A, and GATA Endodermal Transcription Factors in Epithelial Cancer Cells J. Biol. Chem., August 3, 2007; 282(31): 22638 - 22650. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. O. Henke, G. John, M. Germann, H. Lindemann, and B. K. Rubin MUC5AC and MUC5B Mucins Increase in Cystic Fibrosis Airway Secretions during Pulmonary Exacerbation Am. J. Respir. Crit. Care Med., April 15, 2007; 175(8): 816 - 821. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Yuan-chen Wu, R. Wu, S. P. Reddy, Y. C. Lee, and M. M.-J. Chang Distinctive Epidermal Growth Factor Receptor/Extracellular Regulated Kinase-Independent and -Dependent Signaling Pathways in the Induction of Airway Mucin 5B and Mucin 5AC Expression by Phorbol 12-Myristate 13-Acetate Am. J. Pathol., January 1, 2007; 170(1): 20 - 32. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. W. Williams, A. Sharafkhaneh, V. Kim, B. F. Dickey, and C. M. Evans Airway Mucus: From Production to Secretion Am. J. Respir. Cell Mol. Biol., May 1, 2006; 34(5): 527 - 536. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Rose and J. A. Voynow Respiratory Tract Mucin Genes and Mucin Glycoproteins in Health and Disease Physiol Rev, January 1, 2006; 86(1): 245 - 278. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Holmen, N. G. Karlsson, L. H. Abdullah, S. H. Randell, J. K. Sheehan, G. C. Hansson, and C. W. Davis Mucins and their O-Glycans from human bronchial epithelial cell cultures Am J Physiol Lung Cell Mol Physiol, October 1, 2004; 287(4): L824 - L834. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hashimoto, B. S. Graham, S. B. Ho, K. B. Adler, R. D. Collins, S. J. Olson, W. Zhou, T. Suzutani, P. W. Jones, K. Goleniewska, et al. Respiratory Syncytial Virus in Allergic Lung Inflammation Increases Muc5ac and Gob-5 Am. J. Respir. Crit. Care Med., August 1, 2004; 170(3): 306 - 312. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Chokki, S. Yamamura, H. Eguchi, T. Masegi, H. Horiuchi, H. Tanabe, T. Kamimura, and S. Yasuoka Human Airway Trypsin-Like Protease Increases Mucin Gene Expression in Airway Epithelial Cells Am. J. Respir. Cell Mol. Biol., April 1, 2004; 30(4): 470 - 478. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Tamaoki The Effects of Macrolides on Inflammatory Cells Chest, February 1, 2004; 125 (2009): 41S - 51S. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Fischer, J. G. Cuellar, M. L. Diehl, A. M. deFreytas, J. Zhang, K. L. Carraway, and J. A. Voynow Neutrophil elastase increases MUC4 expression in normal human bronchial epithelial cells Am J Physiol Lung Cell Mol Physiol, April 1, 2003; 284(4): L671 - L679. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-P. Di, R. Harper, Y. Zhao, N. Pahlavan, W. Finkbeiner, and R. Wu Molecular Cloning and Characterization of spurt, a Human Novel Gene That Is Retinoic Acid-inducible and Encodes a Secretory Protein Specific in Upper Respiratory Tracts J. Biol. Chem., January 3, 2003; 278(2): 1165 - 1173. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. D. Leikauf, M. T. Borchers, D. R. Prows, and L. G. Simpson Mucin Apoprotein Expression in COPD* Chest, May 1, 2002; 121 (2009): 166S - 182S. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Rose, T. J. Nickola, and J. A. Voynow Airway Mucus Obstruction: Mucin Glycoproteins, MUC Gene Regulation and Goblet Cell Hyperplasia Am. J. Respir. Cell Mol. Biol., November 1, 2001; 25(5): 533 - 537. [Full Text] [PDF] |
||||
![]() |
Y. Chen, Y. H. Zhao, Y.-P. Di, and R. Wu Characterization of Human Mucin 5B Gene Expression in Airway Epithelium and the Genomic Clone of the Amino-Terminal and 5'-Flanking Region Am. J. Respir. Cell Mol. Biol., November 1, 2001; 25(5): 542 - 553. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, L. D. Martin, M. Minnicozzi, S. Greenfeder, J. Fine, C. A. Pettersen, B. Chorley, and K. B. Adler Enhanced Expression of Mucin Genes in a Guinea Pig Model of Allergic Asthma Am. J. Respir. Cell Mol. Biol., November 1, 2001; 25(5): 644 - 651. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chen, Y. H. Zhao, and R. Wu Differential Regulation of Airway Mucin Gene Expression and Mucin Secretion by Extracellular Nucleotide Triphosphates Am. J. Respir. Cell Mol. Biol., October 1, 2001; 25(4): 409 - 417. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. CHEN, Y. H. ZHAO, and R. WU In Silico Cloning of Mouse Muc5b Gene and Upregulation of Its Expression in Mouse Asthma Model Am. J. Respir. Crit. Care Med., September 15, 2001; 164(6): 1059 - 1066. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. SHIMIZU, H. HIRANO, S. SHIMIZU, C. KISHIOKA, Y. SAKAKURA, and Y. MAJIMA Differential Properties of Mucous Glycoproteins in Rat Nasal Epithelium . A Comparison between Allergic Inflammation and Lipopolysaccharide Stimulation Am. J. Respir. Crit. Care Med., September 15, 2001; 164(6): 1077 - 1082. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Roger, J-P. Gascard, J. Bara, E. Dulmet, and C. Brink EGTA treatment of human airways in vitro unmasks M1/MUC5AC mucin in submucosal glands Eur. Respir. J., July 1, 2001; 18(1): 176 - 183. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lin, V. Tsuprun, H. Kawano, M. M. Paparella, Z. Zhang, R. Anway, and S. B. Ho Characterization of mucins in human middle ear and Eustachian tube Am J Physiol Lung Cell Mol Physiol, June 1, 2001; 280(6): L1157 - L1167. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yanagihara, M. Seki, and P.-W. Cheng Lipopolysaccharide Induces Mucus Cell Metaplasia in Mouse Lung Am. J. Respir. Cell Mol. Biol., January 1, 2001; 24(1): 66 - 73. [Abstract] [Full Text] |
||||
![]() |
M.-P. Buisine, L. Devisme, P. Degand, M.-C. Dieu, B. Gosselin, M.-C. Copin, J.-P. Aubert, and N. Porchet Developmental Mucin Gene Expression in the Gastroduodenal Tract and Accessory Digestive Glands. II. Duodenum and Liver, Gallbladder, and Pancreas J. Histochem. Cytochem., December 1, 2000; 48(12): 1667 - 1676. [Abstract] [Full Text] |
||||
![]() |
L. E. Vinall, J. C. Fowler, A. L. Jones, H. J. Kirkbride, C. de Bolos, A. Laine, N. Porchet, J. R. Gum, Y. S. Kim, F. M. Moss, et al. Polymorphism of Human Mucin Genes in Chest Disease . Possible Significance of MUC2 Am. J. Respir. Cell Mol. Biol., November 1, 2000; 23(5): 678 - 686. [Abstract] [Full Text] |
||||
![]() |
J.-L. Desseyn, J.-P. Aubert, N. Porchet, and A. Laine Evolution of the Large Secreted Gel-Forming Mucins Mol. Biol. Evol., August 1, 2000; 17(8): 1175 - 1184. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zuhdi Alimam, F. M. Piazza, D. M. Selby, N. Letwin, L. Huang, and M. C. Rose Muc-5/5ac Mucin Messenger RNA and Protein Expression Is a Marker of Goblet Cell Metaplasia in Murine Airways Am. J. Respir. Cell Mol. Biol., March 1, 2000; 22(3): 253 - 260. [Abstract] [Full Text] |
||||
![]() |
C. J. Reid and A. Harris Expression of the MUC 6 Mucin Gene in Development of the Human Kidney and Male Genital Ducts J. Histochem. Cytochem., June 1, 1999; 47(6): 817 - 822. [Abstract] [Full Text] |
||||
![]() |
S. H. Bernacki, A. L. Nelson, L. Abdullah, J. K. Sheehan, A. Harris, C. William Davis, and S. H. Randell Mucin Gene Expression during Differentiation of Human Airway Epithelia In Vitro . MUC4 and MUC5B Are Strongly Induced Am. J. Respir. Cell Mol. Biol., April 1, 1999; 20(4): 595 - 604. [Abstract] [Full Text] |
||||
![]() |
A. WIEDE, W. JAGLA, T. WELTE, T. KOHNLEIN, H. BUSK, and W. HOFFMANN Localization of TFF3, a New Mucus-associated Peptide of the Human Respiratory Tract Am. J. Respir. Crit. Care Med., April 1, 1999; 159(4): 1330 - 1335. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Borchers, M. P. Carty, and G. D. Leikauf Regulation of human airway mucins by acrolein and inflammatory mediators Am J Physiol Lung Cell Mol Physiol, April 1, 1999; 276(4): L549 - L555. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Koo, J.-H. Yoon, T. Gray, D. Norford, A. M. Jetten, and P. Nettesheim Restoration of the Mucous Phenotype by Retinoic Acid in Retinoid-Deficient Human Bronchial Cell Cultures: Changes in Mucin Gene Expression Am. J. Respir. Cell Mol. Biol., January 1, 1999; 20(1): 43 - 52. [Abstract] [Full Text] |
||||
![]() |
C J Reid and A Harris Developmental expression of mucin genes in the human gastrointestinal system Gut, February 1, 1998; 42(2): 220 - 226. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Crit. Care Med. |