|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
Abstract |
|---|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Coordinated microscopic and molecular biological studies were used to document gap junction expression during postnatal development in ferret tracheal epithelium and lung and in fetal and adult human airway and lung. Expression of connexin 26 (Cx26) in the ferret airways was limited to the epithelial layer and was observed only during the newborn interval. In contrast, we found Cx26 expressed in the alveolar epithelium of the ferret lung by in situ hybridization, Northern blotting, RT-PCR amplification, and immunocytochemical labeling at all ages examined. This finding was further confirmed by documentation of gap junctional plaques upon ultrastructural examination of freeze-fracture replicas of adult ferret lung tissue. Parallel studies of developing human fetal lung and airway suggested connexin expression in the airways only in the first trimester but, as in the ferret, persistent expression was observed in both fetal and adult lung. These studies suggest that the transient expression of Cx26 is a reliable early indicator of airway epithelial development and differentiation in the airways. In contrast, Cx26 expression persists throughout life in the lung, suggesting that gap junctions serve more perennial intercellular communication functions in the peripheral lung.
| |
Introduction |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
The superficial tracheal epithelium of the newborn ferret is characterized by a rudimentary level of histologic development, the lumenal border being populated primarily by nonciliated secretory cells and less than 10% ciliated cells (1). This level of histologic organization corresponds to that of human fetal development during the first trimester (2). The ferret tracheal epithelium is further marked by prominent distributions of gap junctions during the neonatal period, which decline in prevalence with progressive cell differentiation and histologic organization over the first month of life (5). Gap junctions are well documented ultrastructural features of the cell membranes of a variety of tissues among mammals, including humans (5). However, they are not prominent in mature, normal mammalian airway epithelium (6, 7) although their proliferation during periods of development (5) and recovery from injury (12) is well documented. In contrast, several studies indicate the constitutive, persisting expression of gap junctions in the alveolar epithelium of the lung with attendant increases in their prevalence subsequent to injury (13). Immunocytochemical studies have shown that the gap junctions appearing in the infant ferret tracheal epithelium belong to two gene families encoding 26- and 32-kD connexin proteins (16). In the present study, we have used microscopic and molecular biologic procedures to characterize connexin expression in the developing and mature conducting airways and lungs of ferrets and correlated these findings with comparable studies of human fetal and adult airways and lung.
| |
Materials and Methods |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Animals
Pregnant sable ferrets were obtained from Marshall Research Animals (North Rose, NY) 1 wk prior to expected delivery date. Animals were housed in steel cages in an accredited institutional laboratory animal care facility and fed dry cat food ad libitum. Infant animals remained with the mothers until weaning at 50 d of age. The age groups and numbers of animals studied were as follows: newborns (< 24 h postpartum), n = 6; 21-50 d old, n = 3; adult, n = 4. Animals were studied without regard to sex except for the adult age group, which consisted of postpartum females.
Human Tissues
Human fetal trachea and lung were obtained at the time of therapeutic abortion through a tissue procurement agency (Anatomic Gift Foundation, Woodbine, GA). The gestational ages of the specimens ranged from approximately 6 to 23 wk. Normal adult human lung was obtained at the time of surgical lobectomy and tissue samples were dissected from tumor-free sites.
Tissues and Preliminary Processing
Animals were sacrificed by lethal intraperitoneal injections of sodium pentobarbital (60 mg/kg) and the tracheas and lungs resected for subsequent processing. Liver also was harvested from selected animals to provide a positive control for the connexin 26 (Cx26) probes. Tissues obtained for isolation of RNA for Northern blotting were frozen immediately upon resection in liquid nitrogen. Tissues for light microscopic in situ hybridization were fixed in 4% buffered paraformaldehyde, dehydrated, and embedded in paraffin. Sections were cut to 6 µm on gelatin-coated slides. Tissues for light microscopic immunocytochemistry were frozen in cryosectioning medium over dry ice immediately upon resection. Tissues for electron microscopic in situ hybridization and immunocytochemistry were fixed for 2 h at 4°C in 4% buffered paraformaldehyde/0.25% glutaraldehyde, pH 7.2, rinsed three times in phosphate buffer, dehydrated to 100% ethanol at room temperature, and embedded in either Unicryl resin (Goldmark Biological, Phillipsburg, NJ) or LR White resin (Ted Pella Inc., Redding, CA). Ultrathin sections were cut using a Sorvall MT6000 (RMC Inc., Tuscon, AZ) or LKB/Huxley (Leica Inc., Deerfield, IL) ultramicrotome to a thickness of 80 nm with a diamond knife.
Human fetal trachea and lung was fixed by immersion in 4% paraformaldehyde plus 0.25% glutaraldehyde in phosphate buffer immediately upon acquisition. The samples were processed to paraffin blocks for light microscopic investigations or appropriate resins for conventional ultrastructural studies as well as ultrastructural localizations of connexin antigen. Samples of adult human lung obtained for reverse transcriptase-polymerase chain reaction (RT-PCR) analysis were frozen immediately upon dissection from the resected tissue.
Northern Blotting and Oligonucleotide Probes to Cx26
Northern blots were prepared by standard techniques (17) using mRNA from adult ferret lung and infant ferret liver and probed with three oligonucleotide probes to Cx26. Three oligonucleotides varying in length from 35 to 39 bases were used as a cocktail for probing the Northern blots and for in situ hybridization histochemistry. They were derived from the coding region of the rat Cx26 gap junction cDNA sequence (8). They are as follows:
1. 5' GATCATGATGCGGAAGATGAAGAGGACAGTGAGCC 3' (complementary to bases 70-105)
2. 5' CTGGGTTTTGATCTCTTCGATGTCCTTAAACTCGTTGTT 3' (complementary to bases 334-373)*
3. 5' CCTAATGAACAGATAGCACAGCTCTGTGATGTTTAG 3' (complementary to bases 613-648)
RT-PCR Analysis
Isolation of total RNA. Total RNA was isolated from ferret and human lung by the method of Chirgwin and coworkers (18). Small pieces of peripheral lung were homogenized in lysis buffer (4 M guanidine thiocyanate, 25 mM sodium citrate, 10 mM dithiothreitol, pH 7) using a Polytron tissue disrupter. The homogenate was cleared of insoluble material by sedimentation at 16,000 × g for 10 min, then layered over a 5.7 M cesium chloride, 0.1 M EDTA cushion and sedimented at 100,000 × gav overnight. The supernatant was discarded and the RNA pellet was washed once with 80% ethanol and then dissolved in TE (10 mM Tris-HCl, 1 mM EDTA, pH 8). Reverse transcription. First-strand cDNAs were synthesized by reverse transcription of 1 µg of total RNA in 50 µl of a buffer containing 0.2 A260 units/ml of random hexamer oligonucleotide primers (Pharmacia, Piscataway, NJ), 10 U/µl Moloney murine leukemia virus reverse transcriptase (GIBCO-BRL Life Technologies, Gaithersburg, MD), 1 U/µl RNasin (Promega, Madison, WI), a 0.5 mM concentration of each of the four dexoyribonucleoside triphosphates (Pharmacia), 50 mM KCl, 3 mM MgCl2, and 10 mM Tris-HCl, pH 9.3. Following a 1-h incubation at 37 ° C, the reverse transcriptase was heat inactivated at 94°C for 4 min. DNA amplification. Connexin 26 and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) cDNAs were amplified using 2 µl of the first-strand cDNAs as template in 50 µl of amplification buffer containing 10 mM Tris-HCl (pH 9.3), 50 mM KCl, a 50-µM concentration of each of the four deoxyribonucleoside triphosphates, 3 mM MgCl2, 0.1 mg/ml bovine serum albumin (Sigma, St. Louis, MO), 1.25 U of Taq DNA polymerase (Boehringer Mannheim, Indianapolis, IN), and a 200-nM concentration each of a pair of oligonucleotide primers specific for Cx26 or G3PDH cDNAs. Sense and antisense degenerate oligonucleotide primers specific for two short sequences that are highly conserved in human, rat, mouse, and sheep Cx26 mRNAs were employed. These sequences were as follows: Sense: TCCCCATCTC(TCA)CACATCCGGC Antisense: AAGATGAC(AC)CGGAAGAAGATGCTG Primers for human G3PDH (19) were used to amplify both human and ferret cDNAs. Amplifications were performed in 96-well plates using a PTC-100 programmable thermal controller (MJ Research, Watertown, MA). Amplifications were cycled for 30 s at 92°C, 30 s at 56°C, and 1 min at 72°C for 30-39 cycles. Amplification products were analyzed by alkaline, agarose gel electrophoresis, and ethidium bromide staining. Cx26 amplification products were sequenced by the University of North Carolina Automated DNA Sequence Facility in order to confirm their identity as Cx26 mRNAs.Light and Electron Microscopic In Situ Hybridization
For light microscopic in situ hybridization, sections were deparaffinized, rinsed in PBS, treated with TEA, dehydrated through ethanol, and air dried. Five picomoles (pmol) of each oligonucleotide was labeled and tailed with 50 pmol of 35S-labeled dATP (Du Pont-NEN, Boston, MA) and purified on a G-50 nick column (Pharmacia). Each slide was hybridized with a cocktail of the three oligonucleotides, each labeled with 200,000 cpm in 100 µl of hybridization buffer overnight at 37°C. Slides were subsequently washed four times (10 min each) in 1× SSC at 55°C, once for 80 min in 1× SSC at room temperature, dipped in distilled water, 95% ethanol, and air dried. Slides were coated with Kodak NTB-2 (Eastman Kodak Co., Rochester, NY) and stored at 4°C for 48-72 h. Specimens were developed in D19, fixed, counterstained in 0.25% toluidine blue, and coverslipped with DPX mounting medium.
For electron microscopic in situ hybridization, the three oligonucleotide antisense and sense probes were end labeled with digoxigenin-11-dUTP (Boehringer Mannheim Corp.). Ultrathin sections of newborn ferret tracheal epithelium, as well as newborn ferret liver (positive control), and newborn ferret heart and adult ferret tracheal epithelium (negative controls) mounted on gold grids were incubated in a hybridization buffer consisting of 5× SSC with 0.1 mg/ml tRNA (GIBCO-BRL) for 22 h at 37°C with the three oligonucleotides simultaneously, each at a concentration of approximately 10 ng/µl. Grids were subsequently washed three times at 65°C (5 min each) with 2× SSC and twice for 5 min with PBS containing 0.1% Tween 20 (PBST). The probe detection steps following hybridization were performed at room temperature in the dark. Grids were first blocked for 1 h in a solution of PBST, 1% bovine serum albumin (BSA), and 0.1% gelatin from cold water fish skin (Sigma). Grids were subsequently incubated with gold-labeled anti-digoxigenin antibody (Boehringer Mannheim) diluted 1:30 in the blocking buffer for 1.5 h. Grids were rinsed three times with blocking buffer and five times with sterile deionized water. The gold label was amplified using Silver Enhance (Boehringer Mannheim) for 8 min at room temperature followed by four washes in sterile, deionized water. Sections were poststained with 9% uranyl acetate for 20 min, and viewed and photographed on a Zeiss EM900 transmission electron microscope at an accelerating voltage of 50 kV.
Antibodies to Peptide Fragments of Different Connexins
An affinity-purified antibody prepared against a synthetic peptide corresponding to a postulated cytoplasmic domain of Cx26 (9) as well as preimmune control immunoglobulin were used for immunocytochemical studies at the light and electron microscopic levels.
Light and Electron Microscopic Immunocytochemistry
Frozen sections affixed to microscope slides were incubated with a 1:250 dilution of the primary antibody or preimmune control antisera in phosphate-buffered saline (PBS) containing 0.1% bovine serum albumin. The sections were incubated at 37°C for 1 h followed by a rinse in PBS. Subsequently, the sections were incubated with a fluorescein isothiocyanate (FITC)-labeled goat anti-rabbit IgG. The sections were coverslipped in glycerol-PBS (9:1) with 0.1% phenylenediamine to retard fading.
Ultrathin sections were incubated with the same primary antibodies or preimmune control antisera followed by washing and labeling with 10-nm colloidal gold-labeled second antibody. The sections were poststained with lead citrate, and viewed and photographed on a Zeiss EM900 transmission electron microscope at an accelerating voltage of 50 kV.
| |
Results |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Comparative Histologic Organization of Postnatal and Human Fetal Airway Epithelium
Previous studies from this laboratory have documented the patterns of postnatal airway epithelial development in the ferret (1). Briefly, the newborn ferret tracheal epithelium is characterized by a large population of nonciliated secretory cells and a marked paucity of ciliated cells. However, the first month of life is marked by rapid cell differentiation and organization of a pseudostratified columnar epithelium in which ciliated cells are predominant.
Our morphologic observations of human fetal airways, consistent with those of other reports in the literature, reveal that cilia are present in the tracheal epithelium by approximately the thirteenth gestational week (2). Examination of first-trimester human fetal trachea and lower airways revealed an epithelial layer approaching pseudostratification but exhibiting limited morphologic evidence of differentiation. This level of organization, particularly the paucity of ciliated cells, was consistent with that previously documented in the newborn ferret. Second-trimester human fetal airways exhibited a well-organized epithelial layer in which ciliated cells were prominent, a pattern consistent with that seen in the ferret trachea postnatally at approximately 1 mo of age.
Northern Blotting and RT-PCR Analyses
To determine if Cx26 mRNA is expressed in adult ferret
lung, Northern blot analysis of lung and liver total RNA
was performed. A cocktail of 32P-labeled, antisense oligonucleotide probes complementary to rat Cx26 mRNA hybridized to an abundant 2.4-kb transcript in ferret liver
(Figure 1, right lane). The size of this transcript and the
high level of expression in the liver are consistent with Cx26 mRNA expression in rat (8), thus it is likely that this transcript is ferret Cx26 mRNA. Although it was less abundant, the same 2.4-kb transcript was detected in lung total
RNA (Figure 1, left lane), suggesting that Cx26 mRNA is
expressed in adult ferret lung. This was confirmed by RT-PCR analysis, a more sensitive expression assay. Cx26
cDNA was amplified from lung cDNA using a sense and
antisense degenerate oligonucleotide primer pair specific for Cx26 mRNA (see MATERIALS AND METHODS). A single amplification product of the predicted size was obtained when reverse-transcribed total RNA was used as
template (+, Figure 2). The amplification product was sequenced to confirm that it was derived from a Cx26 gene.
Because the sequence of ferret Cx26 mRNA has not been
determined, the sequence of the amplification product
was compared to a nonredundant set of all nucleotide sequences published in the GenBank DNA sequence database. The four most similar nucleotide sequences were those of human, mouse, rat, and sheep Cx26 mRNA, respectively. The probability that the observed sequence similarities could occur by chance was < 10
45, suggesting that
the ferret amplification product was derived from a ferret
Cx26 gene. There were no detectable amplification products when an equivalent amount of RNA that had not
been reverse transcribed was used as template (
, Figure
2). Because reverse transcription was essential for successful amplification, it is highly unlikely that the amplification product was derived from chromosomal contamination of the RNA and most likely that it was derived from
ferret Cx26 mRNA. Taken together, the results of Northern blotting and RT-PCR analyses strongly suggested that Cx26 mRNA is expressed in adult ferret lung.
|
|
In Situ Hybridization
Light microscopic in situ hybridization using a cocktail of three 35S-labeled antisense oligonucleotides encoding elements of Cx26 produced no labeling in the infant ferret trachea (Figure 3). However, ultrastructural level in situ hybridization using the same antisense and sense oligonucleotide probes suggested a limited level of hybridization (Figure 4). Hybridization at the ultrastructural level was uniformly present in newborn ferret liver (positive control) and not detectable above background in newborn ferret heart and adult ferret tracheal epithelium (negative controls). In contrast, in situ hybridization revealed prominent labeling at both the light and ultrastructural level in the lung parenchyma at all ages from newborn to adult (Figures 5 and 6). Ultrastructural findings in the lung were consistent with those at the light microscopic level and although the nature of the embedding medium imposes resolution limitations, the connexin mRNA localization appeared to be associated with cytoplasmic Golgi and endoplasmic reticulum sites.
|
|
|
|
In human fetal tissue, in situ hybridization revealed a pattern of expression similar to that seen during postnatal development in the ferret. Light microscopy could document no localization of connexin mRNA in the tracheal epithelium in either the first or second trimester (Figure 7), although consistent expression was noted in the lung alveolar epithelium (Figure 8).
|
|
Immunocytochemical Studies of Cx26 Antigen
Light microscopic immunocytochemistry using a polyclonal antibody to a peptide fragment of the deduced amino acid sequence of Cx26 documented localization of this antigen in the lungs of newborn ferrets (Figure 9) and confirmed the earlier documentation of localization in the conducting airway epithelium (16). Epifluorescence microscopy using indirect FITC labeling revealed fluorescence at sites consistent with the intercellular position of gap junctions in both the lung and airway epithelium among newborn ferrets. In contrast, Cx26 localization was not observed in the tracheal epithelium of adult animals but was consistently documented in the lung (Figure 10). Electron microscopic immunocytochemistry performed on first- and second-trimester human fetal trachea and lung localized Cx26 antigen in airways and lung of first- but not second-trimester fetal tissue (Figures 11 and 12).
|
|
|
|
Examination of Freeze-Fracture Replicas
The consistent and prominent documentation of Cx26 transcription and/or translation products in the lung of ferrets at all ages and particularly the persistence of these products in mature adult lung led to attempts to document morphologically the presence of gap junctions in the parenchyma of the peripheral lung. Using freeze-fracture technique, gap junctions were identified clearly in adult ferret lung in contrast to the normal adult airway epithelium, in which gap junctions are rarely observed (Figure 13).
|
| |
Discussion |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
In addition to confirming localization of gap junctional translation products in the developing ferret trachea and lung, these investigations have applied in situ hybridization techniques to identify gap junction transcription sites in the infant ferret tracheal and lung epithelium. In these studies, the in situ hybridization reaction was performed using a combination of three 35S-labeled oligonucleotides encoding different regions of Cx26. Our findings document that although Cx26 antigen can be localized in the developing trachea, transcription product localized by in situ hybridization is not present at the light microscopic level although ultrastructural level in situ hybridization suggests a low level of expression. In contrast, in situ hybridization revealed Cx26 expression at all ages in ferret lungs and examination of freeze-fracture preparations morphologically documented the presence of gap junctions in the ferret lung. These findings pose an interesting contrast between the conducting airways and lungs of ferrets relative to Cx26 expression. Whereas neither transcription nor translation connexin products persist in the ferret tracheal epithelium past the postnatal epithelial developmental interval, it appears that connexin expression persists in the lung, a finding further supported by ultrastructural documentation of gap junctions in freeze-fractured lung. These observations further suggest that electron microscopic in situ hybridization may be useful in documenting low-level gene expression.
Studies of connexin expression in human fetal and adult lung and airways suggested a pattern similar to that which occurs postnatally in the ferret. Light microscopic in situ hybridization detected no connexin expression in human fetal tracheal epithelium in the first or second trimesters. However, connexin expression was observed in the human fetal lung throughout this range. Our morphologic observations are consistent with other reports in the literature that cilia are present in the trachea by approximately week 13 and that ciliogenesis progresses into the second trimester. Examination of 6- and 8-week-old human fetal tracheas, however, has revealed a low columnar epithelium with a paucity of ciliated cells, an organization comparable to that seen in the newborn ferret tracheal epithelium.
We found ultrastructural level in situ hybridization to be a sensitive approach to the documentation of gap junction transcripts in the airways and lung. Transcript localization was documented at the electron microscopic level at focal sites along intercellular borders, suggesting synthesis of gap junction proteins proximal to sites of incorporation into the membrane. Inasmuch as the progressive decline in gap junction prevalence with age also suggests attenuated connexin expression in these tissues accompanying epithelial maturation, detection of a hybridization signal at the ultrastructural level suggests that electron microscopic in situ hybridization techniques may be effective in detecting limited or residual gene expression. Correlative electron microscopic immunocytochemistry confirmed the localization of Cx26 translation product at similar ultrastructural sites. These findings suggest that connexin proteins are assembled in the endoplasmic reticulum (ER)-Golgi network of developing epithelial cells and are directed toward intercellular borders where they are incorporated into the membrane. Further, these studies suggest that connexin expression is a useful marker of impending differentiation in the airway epithelium, in contrast to the lung, where expression appears to be more constitutive.
Our studies of gap junction expression and epithelial cell differentiation in the human fetal lung and airways and the postnatal lung and airways in the ferret suggest a similar pattern of development and ciliated cell differentiation at the cellular and molecular levels, albeit with some temporal variation. In the infant ferret trachea, a simple columnar epithelium is coupled by abundant connexin translation product (i.e., gap junctions) during early postnatal life. The limited evidence of Cx26 mRNA in the tracheal epithelium postnatally suggests that transcription most likely occurs in fetal life with translation and organization of gap junctions in late fetal or early postnatal life. In contrast, these events appear to occur in human fetal airways during the first trimester, at which time the epithelial layer is also of rudimentary organization. However, Cx26 expression is demonstrable with a variety of techniques at all ages in the ferret lung and in first- and second-trimester human fetal and adult lung. This observation suggests a fundamental difference in the role of gap junctions in the airways and lung that remains to be elucidated. Although connexin expression has been clearly associated with organization and differentiation as well as regeneration following injury in the airways, gap junctions appear as more constitutive elements in the lung proper. Our in situ experiments indicated that hybridization signal is distributed uniformly throughout the lung although not in every alveolus.
In summary, our studies indicate that postnatal development of the airway epithelium in the ferret parallels that of human fetal development during the first and second trimesters with respect to ciliation and to gap junction expression. Of particular interest is the observation that gap junction expression is transient in the airways, being limited to the developmental interval, but appears to persist throughout life in the lungs. This is particularly evident in comparative observations of the progression of airway and submucosal gland epithelium, wherein gap junctions decline in prominence with maturation of the superficial airway epithelium within 1 mo but persist in the submucosal glands as these glands continue to organize out to approximately 2 mo of age. These observations also suggest that intercellular communication via gap junctions serves different, but possibly related, purposes (e.g., modulation of secretory events) in the airways and lung.
| |
Footnotes |
|---|
Address correspondence to: Johnny L. Carson, Ph.D., Center for Environmental Medicine and Lung Biology, The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599-7310. E-mail: jcarson{at}med.unc.edu
(Received in original form September 23, 1996 and in revised form April 28, 1997).
* There was an inadvertent mismatch substitution of a G for a C in the 37th base during the preparation of this oligonucleotide. However, a one base mismatch was considered tolerable because of the stringency of the hybridization and washing conditions.Acknowledgments: The authors thank Drs. Norton Gilula and Nalin Kumar for the kind gift of antibody to Cx26 and Dr. James Yankaskas for providing specimens of normal human lung used in performing the RT-PCR analysis. This research was supported in part by Grants HL19171 and HL34322 from the National Heart, Lung, and Blood Institute and by Cooperative Agreement #CR824915 from the U.S. Environmental Protection Agency. The U.S. Environmental Protection Agency, through its Office of Research and Development, partially funded and collaborated in the research described here under Cooperative Agreement #CR824915 to Philip A. Bromberg. It has not been subjected to agency review and therefore does not necessarily reflect the views of the agency, and no official endorsement should be inferred.
Abbreviations ATP, adenosine triphosphate; BSA, bovine serum albumin; cDNA, complementary DNA; cpm, counts per minute; Cx26, connexin 26; FITC, fluorescein isothiocyanate; G3PDH, glyceraldehyde-3-phosphate dehydrogenase; IgG, immunoglobulin G; kb, kilobase; PBS, phosphate-buffered saline; PBST, phosphate-buffered saline-Tween 20; SDS, sodium dodecyl sulfate; SSC, sodium chloride-sodium citrate; TEA, triethanolamine; UTP, uridine triphosphate.
| |
References |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
1. Leigh, M. W., T. M. Gambling, J. L. Carson, A. M. Collier, R. E. Wood, and T. F. Boat. 1986. Postnatal development of tracheal surface epithelium and submucosal glands in the ferret. Exp. Lung Res. 10: 153-169 [Medline].
2. Moscoso, G., K. Nandra, and M. Driver. 1989. Ciliogenesis and ciliation of the respiratory epithelium in the human fetal cartilaginous trachea. Pathol. Res. Prac. 184: 161-167 .
3. Gaillard, D. A., A. V. Lallement, A. F. Petit, and E. S. Puchelle. 1989. In vivo ciliogenesis in human fetal tracheal epithelium. Am. J. Anat. 185: 415-428 [Medline].
4. Montgomery, P. Q., N. D. Stafford, and C. Stolinski. 1990. Ultrastructure of human fetal trachea: a morphological study of the luminal and glandular epithelia at mid-trimester. J. Anat. 173: 43-59 [Medline].
5. Carson, J. L., N. J. Willumsen, T. M. Gambling, S. S. Hu, and A. M. Collier. 1989. Dynamics of intercellular communication and differentiation in a rapidly developing mammalian airway epithelium. Am. J. Respir. Cell Mol. Biol. 1: 385-390 .
6. Inoue, S., and J. C. Hogg. 1977. Freeze-etch study of the tracheal epithelium of normal guinea pigs with particular reference to intercellular junctions. J. Ultrastruct. Res. 61: 89-99 [Medline].
7. Inoue, S., and J. C. Hogg. 1974. Intercellular junctions of the tracheal epithelium in guinea pigs. Lab. Invest. 31: 68-74 [Medline].
8.
Kumar, N. M., and
N. B. Gilula.
1986.
Cloning and characterization of human and rat liver cDNAs coding for a gap junction protein.
J. Cell Biol.
103:
767-776
9.
Risek, B.,
S. Guthrie,
N. Kumar, and
N. B. Gilula.
1990.
Modulation of gap
junction transcript and protein expression during pregnancy in the rat.
J.
Cell Biol.
110:
269-282
10.
Yee, A. G., and
J.-P. Revel.
1978.
Loss and reappearance of gap junctions in
regenerating liver.
J. Cell Biol.
78:
554-564
11.
Zhang, J. T., and
B. J. Nicholson.
1989.
Sequence and tissue distribution of a
second protein of hepatic gap junctions, Cx26, as deduced from its cDNA.
J. Cell Biol.
109:
3391-3401
12. Gordon, R. E., B. P. Lane, and M. Marin. 1982. Regeneration of rat tracheal epithelium: changes in gap junctions during specific phases of the cell cycle. Exp. Lung Res. 3: 47-56 [Medline].
13. Bartels, H.. 1979. The air-blood barrier in the human lung: a freeze-fracture study. Cell Tissue Res. 198: 269-285 [Medline].
14. Bartels, H., H. J. Oestern, and G. Voss-Wermbter. 1980. Communicating- occluding junction complexes in the alveolar epithelium: a freeze-fracture study. Am. Rev. Respir. Dis. 121: 1017-1024 [Medline].
15. Gordon, R. E., R. F. Heller, J. R. Del Valle, and R. F. Heller. 1989. Membrane perturbations and mediation of gap junction formation in response to taurine treatment in normal and injured alveolar epithelia. Exp. Lung Res. 15: 895-908 [Medline].
16. Carson, J. L., A. M. Collier, S. S. Hu, and J. B. McLachlan. 1995. Variability in distribution and populations of gap junctions in ferret trachea during postnatal development. Am. J. Physiol. 268(Lung Cell. Mol. Physiol. 12): L576-L583.
17.
Thomas, P. S..
1980.
Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose.
Proc. Natl. Acad. Sci. USA
77:
5201-5205
18. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, and W. J. Rutter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18: 5294-5299 [Medline].
19.
Gendelman, H. E.,
R. M. Friedman,
S. Joe,
L. M. Baca,
J. A. Turpin,
G. Dveksler,
M. S. Meltzer, and
C. Dieffenbach.
1990.
A selective defect of
interferon alpha production in human immunodeficiency virus-infected
monocytes.
J. Exp. Med.
172:
1433-1442
This article has been cited by other articles:
 |
|
 |
|
  S. Boitano, Z. Safdar, D. G. Welsh, J. Bhattacharya, and M. Koval Cell-cell interactions in regulating lung function Am J Physiol Lung Cell Mol Physiol, September 1, 2004; 287(3): L455 - L459. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. E. Isakson, G. J. Seedorf, R. L. Lubman, W. H. Evans, and S. Boitano Cell-Cell Communication in Heterocellular Cultures of Alveolar Epithelial Cells Am. J. Respir. Cell Mol. Biol., November 1, 2003; 29(5): 552 - 561. [Abstract] [Full Text]
|
|
|
|
|
|
M. Koval Sharing signals: connecting lung epithelial cells with gap junction channels Am J Physiol Lung Cell Mol Physiol, November 1, 2002; 283(5): L875 - L893. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. E. Isakson, R. L. Lubman, G. J. Seedorf, and S. Boitano Modulation of pulmonary alveolar type II cell phenotype and communication by extracellular matrix and KGF Am J Physiol Cell Physiol, October 1, 2001; 281(4): C1291 - C1299. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. E. Rannels Gap junction communication in alveolar epithelial cells Am J Physiol Lung Cell Mol Physiol, June 1, 2001; 280(6): L1083 - L1084. [Full Text] [PDF]
|
|
|
|
 |
|
 E. D. CRANDALL and M. A. MATTHAY Alveolar Epithelial Transport . Basic Science to Clinical Medicine Am. J. Respir. Crit. Care Med., March 15, 2001; 163(4): 1021 - 1029. [Full Text]
|
|
|
|
|
|
Y. Guo, C. Martinez-Williams, C. E. Yellowley, H. J. Donahue, and D. E. Rannels Connexin expression by alveolar epithelial cells is regulated by extracellular matrix Am J Physiol Lung Cell Mol Physiol, February 1, 2001; 280(2): L191 - L202. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Crit. Care Med. |