help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by John, M.
Right arrow Articles by Fan Chung, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by John, M.
Right arrow Articles by Fan Chung, K.
Am. J. Respir. Cell Mol. Biol., Volume 18, Number 1, January 1998 84-90

Expression and Release of Interleukin-8 by Human Airway Smooth Muscle Cells: Inhibition by Th-2 Cytokines and Corticosteroids

Mattheus John, Bo-Ting Au, Peter J. Jose, Sam Lim, Michael Saunders, Peter J. Barnes, Jane A. Mitchell, Maria G. Belvisi, and K. Fan Chung

Thoracic Medicine and Applied Pharmacology, National Heart and Lung Institute, Imperial College School of Medicine, London, United Kingdom


    Abstract
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Interleukin (IL)-8 is a C-X-C chemokine that potently chemoattracts and activates neutrophils. We determined whether IL-8 could be produced by human airway smooth muscle cells in culture and examined its regulation. TNF-alpha stimulated IL-8 mRNA expression and protein release in a time- and dose-dependent manner, whereas IFN-gamma alone had no effect. Both cytokines together did not induce greater IL-8 release compared to TNF-alpha alone. IL-1beta was more potent in inducing IL-8 release and, together with TNF-alpha , there was a synergistic augmentation of IL-8 release. IL-8 release induced by TNF-alpha and IFN-gamma was partly inhibited by the Th-2-derived cytokines IL-4, IL-10, and IL-13, as well as by dexamethasone. In addition to its contractile responses, airway smooth muscle cells have synthetic and secretory potential with the release of IL-8 and subsequent recruitment and activation of neutrophils in the airways. Release of IL-8 can be modulated by Th-2-derived cytokines and corticosteroids.


    Introduction
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Airway smooth muscle has been regarded as having mainly contractile properties because of its ability to shorten in response to many contractile inflammatory mediators, leading to a reduction in airway caliber. Airway smooth muscle can also respond to cytokines and growth factors released from resident and/or infiltrating proinflammatory cells by undergoing mitogenesis (1). However, it is not known whether airway smooth muscle cells can act as effector cells in initiating or perpetuating airway inflammation by expressing and releasing inflammatory products such as chemotactic cytokines or chemokines.

Interleukin (IL)-8 is a member of the C-X-C chemokine subfamily of cytokines. It was identified following the original description of a neutrophil chemotactic agent in the supernatants of lipopolysaccharide (LPS)- or phytohemagglutinin-stimulated human monocytes (2, 3). IL-8 induces the full pattern of responses of activated neutrophils. It induces shape change and migration, exocytosis of stored proteins, and respiratory burst resulting in the release of superoxide anions or hydrogen peroxide of neutrophils (4). IL-8 is produced by inflammatory cells such as monocytes/macrophages (3), eosinophils (5), and by a variety of resident cells such as airway epithelial cells (6) and endothelial cells (7).

We have shown that human airway smooth muscle cells (HASMCs) in culture can express and release the C-C chemokine RANTES (8). This indicates that airway smooth muscle not only has contractile function but can also secrete inflammatory products that participate in the airway inflammatory response. We postulated that HASMCs could also express and release C-X-C chemokines such as IL-8. In the present study, we demonstrate that HASMCs in culture can be stimulated by tumor necrosis factor alpha  (TNF-alpha ) and IL-1beta to express and release IL-8, and that this effect can be inhibited by cytokines such as these derived from Type 2 helper T cell (Th-2 cells): IL-4, IL-10, and IL-13. Dexamethasone had a similar inhibitory effect. Our results reinforce the view that HASMCs can participate in the chemoattraction and activation of neutrophils and of other inflammatory cells.

    Materials and Methods
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

HASMC Culture

Human bronchial smooth muscle was obtained from the lobar or main bronchus at lung resection from patients of either sex, undergoing surgery for carcinoma of the bronchus, as described previously (9, 10). Once in culture, human airway smooth muscle cells were maintained in Dulbecco's modified Eagle's medium (DMEM) containing fetal calf serum (FCS) (10%, vol/vol) supplemented with sodium pyruvate (1 mM), L-glutamine (2 mM), nonessential amino acid mixture (1:100), gentamicin (50 µg/ml), and amphotericin B (1.5 µg/ml). All cultures were maintained in a humidified atmosphere at 37°C in air/CO2 (95:5%, vol/vol). Fresh medium was replaced every 72 h. As revealed by immunofluorescence techniques for both smooth muscle actin and myosin, more than 95% of the cells displayed the characteristics of smooth muscle cells in culture (10).

Cell Stimulation

Confluent human airway smooth muscle cells (passage 3- 8) were growth arrested by FCS deprivation for 72 h in DMEM supplemented with sodium pyruvate (1 mM), nonessential amino acids (1:100), L-glutamine (2 mM), gentamicin (50 µg/ml), amphotericin B (1.5 µg/ml) (GIBCO, Paisley, UK), insulin (1 µM), transferrin (5 µg/ml), ascorbic acid (100 µM), and bovine serum albumin (BSA, 0.1%) (Sigma, Poole, UK). After 72 h, cells were stimulated in fresh FCS-free medium containing cytokines IL-1beta , TNF-alpha , interferon gamma  (IFN-gamma ) alone or in combination in a concentration- and time-dependent manner, and in the presence of different concentrations of IL-4, IL-10, IL-13 (R&D Laboratories, Oxford, UK), and dexamethasone (Sigma). In these experiments, dexamethasone and IL-4, IL-10, and IL-13 were preincubated for 2 h prior to addition of TNF-alpha , IFN-gamma , and the mixture of three cytokines (cytomix).

Airway Smooth Muscle Proliferation

To determine any potential effect of IL-1beta on airway smooth muscle (ASM) proliferation, ASM at confluence and growth arrested by FCS deprivation was incubated with [3H]thymidine at a final concentration of 1 µCi ml-1 to allow this incorporation into DNA. Cultures were washed twice in phosphate-buffered saline to rinse loosely associated radioactive tracer from the wells. Acid-soluble radioactivity was removed by a 20-min treatment with 5% trichloroacetic acid at 4°C, followed by washing the cultures twice in 95% ethanol. The remaining material, which represented the acid-insoluble pools, was solubilized by a 30-min incubation with 2% Na2CO3 in 0.1 M NaOH. The radioactivity was determined by liquid scintillation counting.

Northern Blot Analysis

Total cellular RNA was extracted from adherent cells using a modification of the method of Chomczynski and Sacchi (11). Following two phenol-chloroform extractions and an isopropanol precipitation, RNA samples were stored overnight and washed twice with ethanol (75%, vol/ vol; BDH, Poole, UK) and dissolved in RNase-free water. A total of 20 µg of cytoplasmic RNA was separated by electrophoresis on a 1% agarose gel containing 7.5% formaldehyde and transferred to a nylon Hybond-N membrane (Amersham, Bucks, UK) and fixed by ultraviolet irradiation. Filters were then hybridized with a 32P-labeled human IL-8 cDNA probe using a multiprime DNA labeling kit (Amersham). The IL-8 probe was a 750-bp PstI- BamHI cDNA fragment. Filters were then washed at a final stringency of 0.1× SSC and 0.1% sodium dodecyl sulfate (SDS) at 55°C and exposed at -70°C on Kodak (Rochester, NY) XS 1 100 film for 3-5 d. Probes were stripped by incubating the blot in a 50% formamide solution at 70°C for 2 h before hybridization with a 32P-labeled

1272-bp rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA probe. Densitometric quantification of the Northern blots was performed by laser densitometry (Protein & DNA Imageware System, Discovery Series, New York, NY). Specific RNA levels are expressed as the ratio of IL-8 to GAPDH mRNA.

Reverse Transcriptase-Polymerase Chain Reaction

Total cellular RNA was prepared as for Northern analysis. Reverse transcription of 1 µg of total RNA was performed using avian myeloblastosis virus (AMV) reverse transcriptase (15 U), a 1 mM of dATP, dCTP, dGTP, and dTTP, 0.4 µg oligo(dT)15 primer, 30 U RNase inhibitor, 5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 9.0), and 0.1% Triton X-100 in a total volume of 40 µl (all from Promega, Southampton, UK). Oligo(dT) and dissolved RNA were incubated at 65°C for 10 min and placed on ice for 5 min. The remaining ingredients were then added and samples were incubated at 42°C for 60 min followed by 10 min at 85°C. The cDNA was subsequently diluted to a final volume of 400 µl in nuclease-free water.

Ten microliters of the cDNA solutions were used. The polymerase chain reaction (PCR) was performed using a 7.5 pM concentration of forward and reverse primers; dATP, dGTP, dTTP, and dCTP at a final concentration of 0.2 mM each; Taq polymerase, 1.5 U; MgCl2, 1.5 mM; KCl, 50 mM; Tris-HCl (pH 9.0), 10 mM; and 0.1% Triton X-100 in a final volume of 30 µl. Primers for IL-8 were GTGCCGGTCGAACCTTCAGTA and CTCTTCAAAAACTTCTCCCGACTCTTAAGTATT, giving a product of 298 bp. Primers for GAPDH were TCTAGACGGCAGGTCAGGTCCACC and CCACCCATGGCAAATTCCATGGCA, giving a product of 598 bp. The PCR was carried out in a Techne multiwell thermocycler (Techne, Cambridge, UK) at 95°C for an initial 5 min followed by 24 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 60 s. Final extension was for 10 min at 72°C. The number of cycles was chosen after determination of the linear phase of the product amplification curve from serial sampling with increasing cycles of amplification. Products were distinguished by electrophoresis on a 2% agarose ethidium bromide-stained gel and then visualized and photographed using ultraviolet luminescence. The relative abundance of the product was assessed using laser densitometry measured from the photographic negative and expressed as a ratio of the IL-8 band to the GAPDH band.

IL-8 Radioimmunoassay

IL-8 was measured as described previously (12). All samples were assayed in duplicate, and nonspecific binding was determined by incubation of the radiolabeled ligand under identical conditions but in the absence of the anti-human IL-8 antiserum.

Data Analysis

Data are reported as a mean ± SEM. Comparison between groups was performed using the paired t test. A P value of < 0.05 was considered to be significant.

    Results
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Induction of IL-8 Protein and mRNA Expression by TNF-alpha and IFN-gamma

HASMCs were stimulated for 24 h with TNF-alpha (10 ng/ml) and IFN-gamma (10 ng/ml) or with both TNF-alpha and IFN-gamma . TNF-alpha alone induced IL-8 protein and mRNA, as measured on Northern analysis, whereas IFN-gamma had no significant effect. There was no further induction of IL-8 protein and mRNA with the combination of both cytokines (Figure 1).


View larger version (44K):
[in this window]
[in a new window]
 


View larger version (19K):
[in this window]
[in a new window]
 
Figure 1.   Effect of IFN-gamma (10 ng/ml), TNF-alpha (10 ng/ml), TNF-alpha plus IFN-gamma (10 ng/ml each), and TNF-alpha plus IFN-gamma in the presence of dexamethasone (10-6 M) on IL-8 mRNA and protein expression after 24 h of stimulation. (A) Representative Northern blot of IL-8 and GAPDH mRNA expression in human airway smooth muscle cells after stimulation and the effect of dexamethasone. (B) Mean ratio of IL-8 and GAPDH mRNA as measured by densitometric analysis. (C) IL-8 immunoreactivity in supernatants from human airway smooth muscle cells treated as described above. Data are the mean ± SEM of three experiments. *P < 0.05, **P < 0.01 compared with dexamethasone treatment.

Dose effect. HASMCs were plated on 24-well plates and stimulated either with TNF-alpha or IFN-gamma alone at concentrations of 0, 1, 3, 10, 30, and 100 ng/ml for 24 h. In addition, TNF-alpha (10 ng/ml) or IFN-gamma (10 ng/ml) was added to each concentration of the alternate cytokine in order to test any potential dose-dependent synergistic effect of one cytokine on the other. IFN-gamma alone had no significant effect up to a concentration of 100 ng/ml, whereas TNF-alpha induced the release of IL-8, with the highest effect being seen at 100 ng/ml. In the presence of TNF-alpha (10 ng/ml), IFN-gamma did not induce a dose-dependent increase in IL-8 production. Similarly, there was no potentiating effect of IFN-gamma (10 ng/ml) on the response to increasing concentrations of TNF-alpha (Figure 2).


View larger version (17K):
[in this window]
[in a new window]
 
Figure 2.   Dose-response curves of TNF-alpha and IFN-gamma alone and of the combination of TNF-alpha and IFN-gamma relative to IL-8 production after a 24 h incubation with human airway smooth muscle cells. (A) TNF-alpha alone (solid squares) and in the presence of IFN-gamma at 10 ng/ml (solid circles). (B) IFN-gamma alone (solid squares) and in the presence of TNF-alpha at 10 ng/ml (solid circles). Data are the mean ± SEM of three experiments. *P < 0.05 compared with the response to IFN-gamma alone (B).

Time course. HASMCs were cultured in the presence of TNF-alpha or IFN-gamma or TNF-alpha plus IFN-gamma at 10 ng/ml each. There was a time-dependent increase in IL-8 release after stimulation with TNF-alpha and with the combination of TNF-alpha and IFN-gamma (Figure 3). There was no synergistic effect of TNF-alpha and IFN-gamma on IL-8 release. The time course of IL-8 release after stimulation with TNF-alpha plus IFN-gamma was similar to that of TNF-alpha alone. IFN-gamma alone had no effect on IL-8 release. There was a persistent increase in IL-8 mRNA as measured by reverse transcriptase (RT)-PCR between 12 and 96 h, with a peak expression at 24 h (Figure 3).


View larger version (55K):
[in this window]
[in a new window]
 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 3.   Time course of IL-8 mRNA abundance and protein release in human airway smooth muscle stimulated with TNF-alpha and IFN-gamma (10 ng/ml each). (A) Time course of expression of IL-8 and GAPDH mRNA using RT-PCR. (B) Ratios of IL-8 mRNA to GAPDH mRNA measured by densitometry. (C) IL-8 protein release after stimulation of human airway smooth muscle cells with TNF-alpha (solid diamonds), IFN-gamma (solid squares), TNF-alpha plus IFN-gamma (solid circles) at a concentration of 10 ng/ml each, and from control unstimulated cells (open triangles). Data are the mean ± SEM of three experiments. *P < 0.05, **P < 0.01, ***P < 0.001 compared with control (unstimulated cells).

Effect of Different Combinations of IL-1beta , TNF-alpha , and IFN-gamma on IL-8 Release

HASMCs were stimulated for 24 h with TNF-alpha (10 ng/ml) or IFN-gamma (10 ng/ml) in the presence of IL-1beta (10 ng/ml) or with a combination of the three cytokines (cytomix). The stimulatory effect of IL-1beta and IFN-gamma was similar to that of IL-1beta alone. Cytomix was significantly less effective than IL-1beta and TNF-alpha , indicating that IFN-gamma had inhibitory effects when combined with IL-1beta and TNF-alpha on IL-8 release (Figure 4).


View larger version (15K):
[in this window]
[in a new window]
 
Figure 4.   IL-8 protein release from human airway smooth muscle cells 24 h after incubation with IL-1beta (10 ng/ml), IL-1beta plus TNF-alpha (10 ng/ml), IL-1beta plus IFN-gamma (10 ng/ml), and a mixture of IL-1beta , TNF-alpha , and IFN-gamma (CM). The effect of dexamethasone (Dex; 10-6 M) on IL-8 release is also shown. There was no significant increase in IL-8 detected under control conditions (CTRL). IL-1beta synergized with TNF-alpha to increase IL-8 production, whereas IFN-gamma had no effect on IL-1beta increase. The mixture of three cytokines induced IL-8 release, whereas dexamethasone inhibited IL-8 release induced by this mixture. ***P < 0.001 compared to control (CTRL).

HASMCs were stimulated with IL-1beta (0, 4, 20, and 100 ng/ml) for 24 h. All concentrations of IL-1beta stimulated IL-8 release, with the 4-ng/ml concentration already having a submaximal effect (Figure 5). Cytomix induced IL-8 release in a time-dependent fashion up to 48 h (Figure 5).


View larger version (13K):
[in this window]
[in a new window]
 
Figure 5.   (A) Effect of increasing concentration of IL-1beta on IL-8 production after 24-h incubation with human airway smooth muscle cells. Data are the mean ± SEM of three experiments. **P < 0.01, ***P < 0.001 compared with control. (B) Time course of IL-8 protein release in response to a combination of IL-1beta , TNF-alpha , and IFN-gamma (10 ng/ml each) (Cytomix, CM; solid squares) and from control unstimulated cells (CTRL; solid triangles). Data shown are the mean of two experiments.

Effect of IL-1beta on ASM Proliferation

IL-1beta (10 ng/ml) decreased [3H]thymidine incorporation by 36.3 ± 14.8% (n = 3); cytomix (IL-1beta , IFN-gamma , and TNF-alpha , at 10 ng/ml each; n = 3) also decreased it by 18.6 ± 9.3%.

Effects of IL-4, IL-10, IL-13, and Dexamethasone on IL-8 Release

HASMCs were stimulated with TNF-alpha plus IFN-gamma (10 ng/ ml each) in the presence of IL-4, IL-10, IL-13, or dexamethasone. IL-4, IL-10, and IL-13 significantly reduced IL-8 production with a maximal effect observed at 10 ng/ ml for IL-4 and IL-10, and 1 ng/ml for IL-13 (Figure 6). Dexamethasone inhibited IL-8 release by 26.5 ± 12.9% at 10-6 M (P < 0.001) together with a reduction in IL-8 mRNA as assessed by Northern analysis (Figure 1). After stimulation with cytomix dexamethasone (10-6 M) inhibited IL-8 release by 41.2 ± 6% (Figure 6).


View larger version (17K):
[in this window]
[in a new window]
 
Figure 6.   Inhibition of IL-8 release from human airway smooth muscle cells, stimulated with a combination of TNF-alpha and IFN-gamma (10 ng/ml each), by IL-4, IL-10, or IL-13, and dexamethasone. (A) Significant inhibition of IL-8 release by IL-4 (solid circles), IL-10 (solid diamonds), or IL-13 (solid squares). (B) Significant effect of dexamethasone on IL-8 release by human airway smooth muscle cells. Data shown are the mean ± SEM of three experiments. *P < 0.05, **P < 0.01, ***P < 0.001 compared with responses in the absence of IL-4, IL-10, and IL-13 or dexamethasone (open circle).

    Discussion
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

We have shown that human airway smooth muscle cells in culture are able to express IL-8 mRNA and release IL-8 protein in response to TNF-alpha and IL-1beta but not to IFN-gamma . This effect is concentration- and time-dependent. IL-1beta was more potent than TNF-alpha and it synergized with TNF-alpha in terms of IL-8 release. The Th-2-derived cytokines IL-4, IL-10, and IL-13 inhibited the release of IL-8 protein. Similarly, IL-8 release was inhibited by dexamethasone. Our results suggest that airway smooth muscle may contribute to airway inflammation by releasing the neutrophil chemoattractant and activating cytokine, IL-8.

IL-8 gene induction and protein release have been described in many cell types such as airway epithelial cells (6, 13), mononuclear cells (14), and endothelial cells (7, 15), and our current work demonstrates the expression and production of IL-8 by airway smooth muscle cells. IL-1beta was more potent than TNF-alpha in inducing IL-8 protein release, and synergized with TNF-alpha in increasing IL-8 release. IL-1beta and TNF-alpha have also been shown to increase the expression of IL-8 in other cell types such as airway epithelial cells and fibroblasts (13, 16). We did not observe any effect of IFN-gamma . However, a synergistic interaction between TNF-alpha and IFN-gamma has been described in airway smooth muscle cells (8) and also in fibroblasts, endothelial cells, and airway epithelial cells for gene expression and protein release of another chemokine, RANTES (19). Thus, the ultimate effect of these proinflammatory cytokines on airway smooth muscle cells depends on the particular chemokine generated.

There was a continuing time-dependent increase in IL-8 protein release on exposure to TNF-alpha or to cytokine mixture up to 48 to 96 h. The parallel increase in IL-8 mRNA as observed on Northern analysis or reverse transcription polymerase chain reaction indicates that the increase in protein release is secondary to IL-8 gene transcription. This is further supported by the observation that glucocorticosteroids inhibited both IL-8 gene expression together with IL-8 protein release to a similar extent. A negative GRE site has been described on the 5'-flanking region of the IL-8 gene (22) and binding of activated glucocorticoid receptor to that site may lead to inhibition of IL-8 gene expression, as has been reported in a human fibrosarcoma cell line (18).

It is possible that the time-dependent increase in IL-8 mRNA and protein expression indicates that this response could be related to increased mitogenesis and changes in airway smooth muscle cell phenotype. Previous studies using similar concentrations of TNF-alpha have shown that it induces modest proliferation in cultures of human airway smooth muscle (23) and IL-1beta has been reported to increase guinea pig airway smooth muscle cell mitogenesis (24). However, in the present study, there was a reduction in proliferation of human airway smooth muscle cells as measured by thymidine incorporation induced by IL-1beta and also by the mixture of cytokines. It is therefore unlikely that the increase in IL-8 expression and release observed following cytokine stimulation is due to any induced increase in smooth muscle cell proliferation.

The cytokines IL-4, IL-10, and IL-13 are derived from Th-2 cells, and IL-10 and IL-13 can also be released from monocytes/macrophages. The degree of inhibition observed by these cytokines did not exceed 60%, with IL-10 being the most effective. We have also observed that these three cytokines can inhibit to a similar extent the release of RANTES from airway smooth muscle cells (8) and of macrophage inflammatory protein 1alpha (MIP-1alpha ) from alveolar macrophages (14, 25, 26). The inhibition observed by these cytokines on the release of IL-8 from airway smooth muscle cells indicates that Th-2 cells or macrophages may interact with airway smooth muscle. Activated T cells have been shown to adhere to airway smooth muscle cells via specific integrins (27).

Our results indicate that the airway smooth muscle cell should not be regarded solely as a specialized cell capable only of contractile responses. Proinflammatory cytokines and several growth factors can modulate airway smooth muscle phenotype and mitogenesis (1) and the resulting increase in airway smooth muscle mass may contribute to airway obstruction and bronchial hyperresponsiveness in asthma (28). It is not known whether IL-8 could have an autocrine role in the airway smooth muscle in controlling mitogenesis. In preliminary studies of immunostaining with an anti-IL-8 antibody, we have observed positive staining in airway smooth cells of the airways in lungs obtained from patients undergoing lung resection for cancer (T. Gilbey and K. F. Chung, unpublished observations). This indicates that IL-8 may be expressed under basal conditions in vivo, and the role of IL-8 in this situation is not known.

The additional secretory potential of airway smooth muscle, particularly in terms of IL-8 and RANTES release, adds another dimension to the putative role of airway smooth muscle in airway inflammation. Airway smooth muscle could contribute directly to the recruitment of inflammatory cells such as neutrophils to the airways by increased expression of IL-8. This could occur through the release of the proinflammatory cytokines TNF-alpha and IL-1beta from monocytes/alveolar macrophages or T cells within the vicinity of airway smooth muscle cells. On the other hand, Th-2 cells may provide cytokines such as IL-4, IL-10, and IL-13 to inhibit IL-8 expression. Our observations support the notion that airway smooth muscle could be a major contributor to the inflammatory features of the airways in diseases characterized by a neutrophilic airway inflammation such as chronic bronchitis and asthma.

    Footnotes

Address correspondence to: Dr. K. F. Chung, National Heart and Lung Institute, Dovehouse St., London SW3 6LY, UK. E-mail: f.chung{at}ic.ac.uk

(Received in original form October 21, 1996 and in revised form April 7, 1997).

Acknowledgments: This work was supported by a Program Grant from the British Medical Research Council (K.F.C. and P.J.B.), and a grant from the Overseas German Academic Exchange Service (M.J.).

Abbreviations ASM, airway smooth muscle; DMEM, Dulbecco's modified Eagle's medium; FCS, fetal calf serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HASMC, human airway smooth muscle cells; IFN-gamma , interferon gamma ; IL, interleukin; LPS, lipopolysaccharide; RT-PCR, reverse transcriptase-polymerase chain reaction; Th-2, helper T cell type 2; TNF-alpha , tumor necrosis factor alpha .

    References
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Hirst, S. J.. 1996. Airway smooth muscle cell culture: application to studies of airway wall remodelling and phenotype plasticity in asthma. Eur. Respir. J. 9: 808-820 [Abstract].

2. Schroder, J. M., U. Mrowietz, E. Morita, and E. Christophers. 1987. Purification and partial biochemical characterisation of a human monocyte- derived, neutrophil-activating peptide that lacks interleukin 1 activity. J. Immunol. 139: 3474-3483 [Abstract].

3. Yoshimura, T., K. Matsushima, J. J. Oppenheim, and E. J. Leonard. 1987. Neutrophil chemotactic factor produced by lipopolysaccharide (LPS)-stimulated human blood mononuclear leukocytes: partial characterization and separation from interleukin 1 (IL-1). J. Immunol. 139: 788-793 [Abstract].

4. Baggiolini, M., B. Dewald, and B. Moser. 1994. Interleukin-8 and related chemotactic cytokines---CXC and CC chemokines. Adv. Immunol. 55: 97-179 [Medline].

5. Yousefi, S., S. Hemmann, M. Weber, C. Holzer, K. Hartung, K. Blaser, and H. V. Simon. 1995. IL-8 is expressed by human peripheral blood eosinophils: evidence for increased secretion in asthma. J. Immunol. 154: 5481-5490 [Abstract].

6. Kwon, O. J., B. T. Au, P. D. Collins, J. N. Baraniuk, I. M. Adcock, K. F. Chung, and P. J. Barnes. 1994. Inhibition of interleukin-8 expression by dexamethasone in human cultured airway epithelial cells. Immunology 81: 389-394 [Medline].

7. Strieter, R. M., S. L. Kunkel, H. J. Showell, D. J. Remick, S. H. Phan, P. A. Ward, and R. M. Marks. 1989. Endothelial cell gene expression of a neutrophil chemotactic factor by TNFalpha , LPS and IL-1beta . Science 243: 1467-1469 [Abstract/Free Full Text].

8. John, M., S. Hirst, P. J. Jose, A. Robichaud, N. Berkman, C. Witt, C. H. Twort, P. J. Barnes, and K. F. Chung. 1997. Human airway smooth muscle cells express and release RANTES in response to T helper 1 cytokines: regulation by Th-2 cytokines and corticosteroids. J. Immunol. 158: 1841-1847 [Abstract].

9. Hirst, S. J., P. J. Barnes, and C. H. L. Twort. 1992. Quantifying proliferation of cultured human and rabbit airway smooth muscle cells in response to serum and platelet-derived growth factor. Am. J. Respir. Cell Mol. Biol. 7: 574-581 .

10. Twort, C. H. C., and C. van Breemen. 1988. Human airway smooth muscle in culture. Tissue Cell 20: 339-344 [Medline].

11. Chomczynski, P., and N. Sacchi. 1987. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-160 [Medline].

12. Au, B. T., T. J. Williams, and P. D. Collins. 1994. Zymosan-induced IL-8 release from human neutrophils involves activation via the CD11b/CD18 receptor and endogenous platelet-activating factor as an autocrine modulator. J. Immunol. 152: 5411-5419 [Abstract].

13. Standiford, T. J., S. L. Kunkel, M. A. Basha, S. W. Chensue, J. P. Lynch, G. B. Toews, J. Westwick, and R. M. Strieter. 1990. Interleukin-8 gene expression by a pulmonary epithelial cell line: a model for cytokine networks in the lung. J. Clin. Invest. 86: 1945-1953 .

14. Standiford, T. J., S. L. Kunkel, J. M. Liebler, M. D. Burdick, A. R. Gilbert, and R. M. Strieter. 1993. Gene expression of macrophage inflammatory protein-1alpha from human blood monocytes and alveolar macrophages is inhibited by interleukin-4. Am. J. Respir. Cell Mol. Biol. 9: 192-198 .

15. Schonbeck, U., E. Brandt, F. Petersen, H. D. Flad, and H. Loppnow. 1995. IL-8 specifically binds to endothelial but not to smooth muscle cells. J. Immunol. 154: 2375-2383 [Abstract].

16. Nakamura, H., K. Yoshimura, H. A. Jaffe, and R. G. Crystal. 1991. Interleukin-8 gene expression in human bronchial epithelial cells. J. Biol. Chem. 266: 19611-19615 [Abstract/Free Full Text].

17. Tobler, A., R. Meier, M. Seitz, B. Dewald, M. Baggiolini, and M. F. Fey. 1992. Glucocorticoids downregulate gene expression of GM-CSF, NAP-1/ IL-8 and IL-6, but not of M-CSF in human fibroblasts. Blood 79: 45-51 [Abstract/Free Full Text].

18. Mukaida, N., G. L. Gussella, T. Kasahara, Y. Ko, C. O. Zachariae, T. Kawai, and K. Matsushima. 1992. Molecular analysis of the inhibition of interleukin-8 production by dexamethasone in a human fibrosarcoma cell line. Immunology 75: 674-679 [Medline].

19. Rathanaswami, P., M. Hachicha, M. Sadick, T. J. Schall, and S. R. McColl. 1993. Expression of the cytokine RANTES in human rheumatoid synovial fibroblasts: differential regulation of RANTES and interleukin-8 genes by inflammatory cytokines. J. Biol. Chem. 268: 5834-5839 [Abstract/Free Full Text].

20. Marfaing-Koka, A., O. Devergne, G. Gorgone, A. Portier, T. J. Schall, P. Galanaud, and D. Emilie. 1995. Regulation of the production of the RANTES chemokine by endothelial cells: synergistic induction by IFN plus TNF-alpha and inhibition by IL-4 and IL-13. J. Immunol. 154: 1870-1878 [Abstract].

21. Berkman, N., A. Robichaud, V. L. Krishnan, G. Roesems, R. Robbins, P. J. Jose, P. J. Barnes, and K. F. Chung. 1995. Expression of RANTES in human airway epithelial cells: effect of corticosteroids and interleukin-4, 10 and 13.  Immunology 87: 599-603 .

22. Mukaida, N., M. Shiroo, and K. Matsushima. 1989. Genomic structure of the human monocyte-derived neutrophil chemotactic factor IC-8. J. Immunol. 143: 1366-1371 [Abstract].

23. Stewart, A. G., P. R. Tomlinson, D. J. Fernandes, J. W. Wilson, and T. Harris. 1995. Tumor necrosis factor alpha  modulates mitogenic responses of human cultured airway smooth muscle. Am. J. Respir. Cell Mol. Biol. 12: 110-119 [Abstract].

24. De, S., E. T. Zelazny, J. F. Souhrada, and M. Souhrada. 1995. IL-1 beta and IL-6 induce hyperplasia and hypertrophy of cultured guinea pig airway smooth muscle cells. J. Appl. Physiol. 78: 1555-1563 [Abstract/Free Full Text].

25. Berkman, N., M. John, G. Roesems, P. J. Jose, P. J. Barnes, and K. F. Chung. 1995. Inhibition of macrophage inflammatory protein-1alpha by interleukin-10: differential sensitivities in human blood monocytes and alveolar macrophages. J. Immunol. 155: 4412-4418 [Abstract].

26. Berkman, N., G. Roesems, P. J. Jose, P. J. Barnes, and K. F. Chung. 1996. Interleukin-13 inhibits expression of macrophage-inflammatory protein-1alpha from human blood monocytes and alveolar macrophages. Am. J. Respir. Crit. Care Med. 15: 382-389 .

27. Lazaar, A. L., S. M. Albelda, J. M. Pilewski, B. Brennan, E. Pure, and R. A. Panettieri. 1994. T lymphocytes adhere to airway smooth muscle cells via integrins and CD44 and induce smooth muscle cell DNA synthesis. J. Exp. Med. 180: 807-816 [Abstract/Free Full Text].

28. James, A. L., P. D. Pare, and J. C. Hogg. 1989. The mechanics of airway narrowing in asthma. Am. Rev. Respir. Dis. 139: 242-246 [Medline].





This article has been cited by other articles:


Home page
J. Immunol.Home page
D. Prefontaine, S. Lajoie-Kadoch, S. Foley, S. Audusseau, R. Olivenstein, A. J. Halayko, C. Lemiere, J. G. Martin, and Q. Hamid
Increased Expression of IL-33 in Severe Asthma: Evidence of Expression by Airway Smooth Muscle Cells
J. Immunol., October 15, 2009; 183(8): 5094 - 5103.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. Kaur, N. S. Holden, S. M. Wilson, M. B. Sukkar, K. F. Chung, P. J. Barnes, R. Newton, and M. A. Giembycz
Effect of {beta}2-adrenoceptor agonists and other cAMP-elevating agents on inflammatory gene expression in human ASM cells: a role for protein kinase A
Am J Physiol Lung Cell Mol Physiol, September 1, 2008; 295(3): L505 - L514.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
G. Martin, R. J. O'Connell, A. Z. Pietrzykowski, S. N. Treistman, M. F. Ethier, and J. M. Madison
Interleukin-4 activates large-conductance, calcium-activated potassium (BKCa) channels in human airway smooth muscle cells
Exp Physiol, July 1, 2008; 93(7): 908 - 918.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
K. F. Chung and I. M. Adcock
Multifaceted mechanisms in COPD: inflammation, immunity, and tissue repair and destruction
Eur. Respir. J., June 1, 2008; 31(6): 1334 - 1356.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
S. Siddiqui, F. Hollins, S. Saha, and C. E. Brightling
Inflammatory cell microlocalisation and airway dysfunction: cause and effect?
Eur. Respir. J., December 1, 2007; 30(6): 1043 - 1056.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Issa, S. Xie, N. Khorasani, M. Sukkar, I. M. Adcock, K.-Y. Lee, and K. F. Chung
Corticosteroid Inhibition of Growth-Related Oncogene Protein-{alpha} via Mitogen-Activated Kinase Phosphatase-1 in Airway Smooth Muscle Cells
J. Immunol., June 1, 2007; 178(11): 7366 - 7375.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. Berndt, F. J. Derksen, P. J. Venta, S. Ewart, V. Yuzbasiyan-Gurkan, and N. E. Robinson
Elevated amount of Toll-like receptor 4 mRNA in bronchial epithelial cells is associated with airway inflammation in horses with recurrent airway obstruction
Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L936 - L943.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. J. Ammit, L. M. Moir, B. G. Oliver, J. M. Hughes, H. Alkhouri, Q. Ge, J. K. Burgess, J. L. Black, and M. Roth
Effect of IL-6 trans-signaling on the pro-remodeling phenotype of airway smooth muscle
Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L199 - L206.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
V. Govindaraju, M.-C. Michoud, M. Al-Chalabi, P. Ferraro, W. S. Powell, and J. G. Martin
Interleukin-8: novel roles in human airway smooth muscle cell contraction and migration
Am J Physiol Cell Physiol, November 1, 2006; 291(5): C957 - C965.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Nozell, T. Laver, K. Patel, and E. N. Benveniste
Mechanism of IFN-beta-Mediated Inhibition of IL-8 Gene Expression in Astroglioma Cells
J. Immunol., July 15, 2006; 177(2): 822 - 830.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. Issa, S. Xie, K.-Y. Lee, R. D. Stanbridge, P. Bhavsar, M. B. Sukkar, and K. F. Chung
GRO-{alpha} regulation in airway smooth muscle by IL-1beta and TNF-{alpha}: role of NF-{kappa}B and MAP kinases
Am J Physiol Lung Cell Mol Physiol, July 1, 2006; 291(1): L66 - L74.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. Kanefsky, M. Lenburg, and C.-M. Hai
Cholinergic Receptor and Cyclic Stretch-Mediated Inflammatory Gene Expression in Intact ASM
Am. J. Respir. Cell Mol. Biol., April 1, 2006; 34(4): 417 - 425.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
Y. Chiba, M. Murata, H. Ushikubo, Y. Yoshikawa, A. Saitoh, H. Sakai, J. Kamei, and M. Misawa
Effect of Cigarette Smoke Exposure In Vivo on Bronchial Smooth Muscle Contractility In Vitro in Rats
Am. J. Respir. Cell Mol. Biol., December 1, 2005; 33(6): 574 - 581.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
K. F. Chung
The Role of Airway Smooth Muscle in the Pathogenesis of Airway Wall Remodeling in Chronic Obstructive Pulmonary Disease
Proceedings of the ATS, November 1, 2005; 2(4): 347 - 354.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
M. A. Birrell, E. Hardaker, S. Wong, K. McCluskie, M. Catley, J. De Alba, R. Newton, S. Haj-Yahia, K. T. Pun, C. J. Watts, et al.
I{kappa}-B Kinase-2 Inhibitor Blocks Inflammation in Human Airway Smooth Muscle and a Rat Model of Asthma
Am. J. Respir. Crit. Care Med., October 15, 2005; 172(8): 962 - 971.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
G. E. Morris, M. K. B. Whyte, G. F. Martin, P. J. Jose, S. K. Dower, and I. Sabroe
Agonists of Toll-like Receptors 2 and 4 Activate Airway Smooth Muscle via Mononuclear Leukocytes
Am. J. Respir. Crit. Care Med., April 15, 2005; 171(8): 814 - 822.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
E. F. M. Wouters
Local and Systemic Inflammation in Chronic Obstructive Pulmonary Disease
Proceedings of the ATS, April 1, 2005; 2(1): 26 - 33.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
M. F. Ethier, E. Cappelluti, and J. M. Madison
Mechanisms of Interleukin-4 Effects on Calcium Signaling in Airway Smooth Muscle Cells
J. Pharmacol. Exp. Ther., April 1, 2005; 313(1): 127 - 133.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Xie, M. B. Sukkar, R. Issa, U. Oltmanns, A. G. Nicholson, and K. F. Chung
Regulation of TGF-{beta}1-induced connective tissue growth factor expression in airway smooth muscle cells
Am J Physiol Lung Cell Mol Physiol, January 1, 2005; 288(1): L68 - L76.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. B. Sukkar, R. Issa, S. Xie, U. Oltmanns, R. Newton, and K. F. Chung
Fractalkine/CX3CL1 production by human airway smooth muscle cells: induction by IFN-{gamma} and TNF-{alpha} and regulation by TGF-{beta} and corticosteroids
Am J Physiol Lung Cell Mol Physiol, December 1, 2004; 287(6): L1230 - L1240.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
R. A. Panettieri Jr.
Effects of Corticosteroids on Structural Cells in Asthma and Chronic Obstructive Pulmonary Disease
Proceedings of the ATS, November 1, 2004; 1(3): 231 - 234.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
C E Brightling and I D Pavord
Location, location, location: microlocalisation of inflammatory cells and airway dysfunction
Thorax, September 1, 2004; 59(9): 734 - 735.
[Full Text] [PDF]


Home page
J. Immunol.Home page
I. Nomura, E. Goleva, M. D. Howell, Q. A. Hamid, P. Y. Ong, C. F. Hall, M. A. Darst, B. Gao, M. Boguniewicz, J. B. Travers, et al.
Cytokine Milieu of Atopic Dermatitis, as Compared to Psoriasis, Skin Prevents Induction of Innate Immune Response Genes
J. Immunol., September 15, 2003; 171(6): 3262 - 3269.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
V. Brusasco and R. Pellegrino
Invited Review: Complexity of factors modulating airway narrowing in vivo: relevance to assessment of airway hyperresponsiveness
J Appl Physiol, September 1, 2003; 95(3): 1305 - 1313.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Y. Amrani, O. Tliba, D. Choubey, C.-D. Huang, V. P. Krymskaya, A. Eszterhas, A. L. Lazaar, and R. A. Panettieri Jr.
IFN-gamma inhibits human airway smooth muscle cell proliferation by modulating the E2F-1/Rb pathway
Am J Physiol Lung Cell Mol Physiol, June 1, 2003; 284(6): L1063 - L1071.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Baraldo, D. S. Faffe, P. E. Moore, T. Whitehead, M. McKenna, E. S. Silverman, R. A. Panettieri Jr., and S. A. Shore
Interleukin-9 influences chemokine release in airway smooth muscle: role of ERK
Am J Physiol Lung Cell Mol Physiol, June 1, 2003; 284(6): L1093 - L1102.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
C.-D. Huang, O. Tliba, R. A. Panettieri Jr., and Y. Amrani
Bradykinin Induces Interleukin-6 Production in Human Airway Smooth Muscle Cells: Modulation by Th2 Cytokines and Dexamethasone
Am. J. Respir. Cell Mol. Biol., March 1, 2003; 28(3): 330 - 338.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. J. Patel, M. G. Belvisi, D. Bishop-Bailey, M. H. Yacoub, and J. A. Mitchell
Activation of Peroxisome Proliferator-Activated Receptors in Human Airway Smooth Muscle Cells Has a Superior Anti-inflammatory Profile to Corticosteroids: Relevance for Chronic Obstructive Pulmonary Disease Therapy
J. Immunol., March 1, 2003; 170(5): 2663 - 2669.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. V. Culpitt, D. F. Rogers, P. Shah, C. De Matos, R. E. K. Russell, L. E. Donnelly, and P. J. Barnes
Impaired Inhibition by Dexamethasone of Cytokine Release by Alveolar Macrophages from Patients with Chronic Obstructive Pulmonary Disease
Am. J. Respir. Crit. Care Med., January 1, 2003; 167(1): 24 - 31.
[Abstract] [Full Text] [PDF]


Home page
Mol. Interv.Home page
W. T. Gerthoffer and C. A. Singer
Secretory Functions of Smooth Muscle: Cytokines and Growth Factors
Mol. Interv., November 1, 2002; 2(7): 447 - 456.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. J. Hirst, M. P. Hallsworth, Q. Peng, and T. H. Lee
Selective Induction of Eotaxin Release by Interleukin-13 or Interleukin-4 in Human Airway Smooth Muscle Cells Is Synergistic with Interleukin-1beta and Is Mediated by the Interleukin-4 Receptor alpha -Chain
Am. J. Respir. Crit. Care Med., April 15, 2002; 165(8): 1161 - 1171.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
A. E. Varner
The Increase in Allergic Respiratory Diseases : Survival of the Fittest?
Chest, April 1, 2002; 121(4): 1308 - 1316.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
G. W. Chalmers, K. J. MacLeod, L. Thomson, S. A. Little, C. McSharry, and N. C. Thomson
Smoking and Airway Inflammation in Patients With Mild Asthma
Chest, December 1, 2001; 120(6): 1917 - 1922.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
Y. AMRANI, P. E. MOORE, R. HOFFMAN, S. A. SHORE, and R. A. PANETTIERI JR.
Interferon-gamma Modulates Cysteinyl Leukotriene Receptor-1 Expression and Function in Human Airway Myocytes
Am. J. Respir. Crit. Care Med., December 1, 2001; 164(11): 2098 - 2101.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Page, A. J. Ammit, J. L. Black, and C. L. Armour
Human mast cell and airway smooth muscle cell interactions: implications for asthma
Am J Physiol Lung Cell Mol Physiol, December 1, 2001; 281(6): L1313 - L1323.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
M. P. HALLSWORTH, L. M. MOIR, D. LAI, and S. J. HIRST
Inhibitors of Mitogen-activated Protein Kinases Differentially Regulate Eosinophil-activating Cytokine Release from Human Airway Smooth Muscle
Am. J. Respir. Crit. Care Med., August 15, 2001; 164(4): 688 - 697.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. M. Madison and M. F. Ethier
Interleukin-4 Rapidly Inhibits Calcium Transients in Response to Carbachol in Bovine Airway Smooth Muscle Cells
Am. J. Respir. Cell Mol. Biol., August 1, 2001; 25(2): 239 - 244.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
J. C. LAPORTE, P. E. MOORE, S. BARALDO, M.-H. JOUVIN, T. L. CHURCH, I. N. SCHWARTZMAN, R. A. PANETTIERI Jr, J.-P. KINET, S. A. SHORE, and S. A. SHORE
Direct Effects of Interleukin-13 on Signaling Pathways for Physiological Responses in Cultured Human Airway Smooth Muscle Cells
Am. J. Respir. Crit. Care Med., July 1, 2001; 164(1): 141 - 148.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
P. G. Gibson, J. L. Simpson, and N. Saltos
Heterogeneity of Airway Inflammation in Persistent Asthma : Evidence of Neutrophilic Inflammation and Increased Sputum Interleukin-8
Chest, May 1, 2001; 119(5): 1329 - 1336.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
N. Lazzeri, M. G. Belvisi, H. J. Patel, M. H. Yacoub, K. Fan Chung, and J. A. Mitchell
Effects of Prostaglandin E2 and cAMP Elevating Drugs on GM-CSF Release by Cultured Human Airway Smooth Muscle Cells . Relevance to Asthma Therapy
Am. J. Respir. Cell Mol. Biol., January 1, 2001; 24(1): 44 - 48.
[Abstract] [Full Text]


Home page
FASEB J.Home page
L. PANG and A. J. KNOX
Regulation of TNF-{alpha}-induced eotaxin release from cultured human airway smooth muscle cells by {beta}2-agonists and corticosteroids
FASEB J, January 1, 2001; 15(1): 261 - 269.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
L. H. Thomas, M. I. Y. Wickremasinghe, M. Sharland, and J. S. Friedland
Synergistic Upregulation of Interleukin-8 Secretion from Pulmonary Epithelial Cells by Direct and Monocyte-Dependent Effects of Respiratory Syncytial Virus Infection
J. Virol., September 15, 2000; 74(18): 8425 - 8433.
[Abstract] [Full Text]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
L. Pang and A. J. Knox
Synergistic Inhibition by beta 2-Agonists and Corticosteroids on Tumor Necrosis Factor-alpha -Induced Interleukin-8 Release from Cultured Human Airway Smooth-Muscle Cells
Am. J. Respir. Cell Mol. Biol., July 1, 2000; 23(1): 79 - 85.
[Abstract] [Full Text]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. C. Hedges, C. A. Singer, and W. T. Gerthoffer
Mitogen-Activated Protein Kinases Regulate Cytokine Gene Expression in Human Airway Myocytes
Am. J. Respir. Cell Mol. Biol., July 1, 2000; 23(1): 86 - 94.
[Abstract] [Full Text]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
S. McKay, S. J. Hirst, M. B.-d. Haas, J. C. de Jongste, H. C. Hoogsteden, P. R. Saxena, and H. S. Sharma
Tumor Necrosis Factor-alpha Enhances mRNA Expression and Secretion of Interleukin-6 in Cultured Human Airway Smooth Muscle Cells
Am. J. Respir. Cell Mol. Biol., July 1, 2000; 23(1): 103 - 111.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. R. van Scott, J. P. Justice, J. F. Bradfield, E. Enright, A. Sigounas, and S. Sur
IL-10 reduces Th2 cytokine production and eosinophilia but augments airway reactivity in allergic mice
Am J Physiol Lung Cell Mol Physiol, April 1, 2000; 278(4): L667 - L674.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. MARUOKA, S. HASHIMOTO, Y. GON, I. TAKESHITA, and T. HORIE
PAF-induced RANTES Production by Human Airway Smooth Muscle Cells Requires Both p38 MAP Kinase and Erk
Am. J. Respir. Crit. Care Med., March 1, 2000; 161(3): 922 - 929.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. L. Pype, L. J. Dupont, P. Menten, E. Van Coillie, G. Opdenakker, J. Van Damme, K. Fan Chung, M. G. Demedts, and G. M. Verleden
Expression of Monocyte Chemotactic Protein (MCP)-1, MCP-2, and MCP-3 by Human Airway Smooth-Muscle Cells . Modulation by Corticosteroids and T-Helper 2 Cytokines
Am. J. Respir. Cell Mol. Biol., October 1, 1999; 21(4): 528 - 536.
[Abstract] [Full Text]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
N. Hagimoto, K. Kuwano, M. Kawasaki, M. Yoshimi, Y. Kaneko, R. Kunitake, T. Maeyama, T. Tanaka, and N. Hara
Induction of Interleukin-8 Secretion and Apoptosis in Bronchiolar Epithelial Cells by Fas Ligation
Am. J. Respir. Cell Mol. Biol., September 1, 1999; 21(3): 436 - 445.
[Abstract] [Full Text]


Home page
ThoraxHome page
K F Chung and P J Barnes
Cytokines in asthma
Thorax, September 1, 1999; 54(9): 825 - 857.
[Full Text]


Home page
J. Immunol.Home page
Y. Amrani, A. L. Lazaar, and R. A. Panettieri Jr.
Up-Regulation of ICAM-1 by Cytokines in Human Tracheal Smooth Muscle Cells Involves an NF-{kappa}B-Dependent Signaling Pathway That Is Only Partially Sensitive to Dexamethasone
J. Immunol., August 15, 1999; 163(4): 2128 - 2134.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
P. J. Patel, D. E. Faunce, M. S. Gregory, L. A. Duffner, and E. J. Kovacs
Elevation in Pulmonary Neutrophils and Prolonged Production of Pulmonary Macrophage Inflammatory Protein-2 after Burn Injury with Prior Alcohol Exposure
Am. J. Respir. Cell Mol. Biol., June 1, 1999; 20(6): 1229 - 1237.
[Abstract] [Full Text]


Home page
Am. J. Respir. Crit. Care Med.Home page
O. GHAFFAR, Q. HAMID, P. M. RENZI, Z. ALLAKHVERDI, S. MOLET, J. C. HOGG, S. A. SHORE, A. D. LUSTER, and B. LAMKHIOUED
Constitutive and Cytokine-Stimulated Expression of Eotaxin by Human Airway Smooth Muscle Cells
Am. J. Respir. Crit. Care Med., June 1, 1999; 159(6): 1933 - 1942.
[Abstract] [Full Text]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. L. Watson, A.-M. White, E. M. Campbell, A. W. Smith, J. Uddin, T. Yoshimura, and J. Westwick
Anti-Inflammatory Actions of Interleukin-13 . Suppression of Tumor Necrosis Factor-alpha and Antigen-Induced Leukocyte Accumulation in the Guinea Pig Lung
Am. J. Respir. Cell Mol. Biol., May 1, 1999; 20(5): 1007 - 1012.
[Abstract] [Full Text]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. P. Hallsworth, C. P. C. Soh, C. H. C. Twort, T. H. Lee, and S. J. Hirst
Cultured human airway smooth muscle cells stimulated by interleukin-1beta enhance eosinophil survival.
Am. J. Respir. Cell Mol. Biol., December 1, 1998; 19(6): 910 - 919.
[Abstract] [Full Text]


Home page
Pharmacol. Rev.Home page
P. J. Barnes, K. F. Chung, and C. P. Page
Inflammatory Mediators of Asthma: An Update
Pharmacol. Rev., December 1, 1998; 50(4): 515 - 596.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
P. J. BARNES
Pharmacology of Airway Smooth Muscle
Am. J. Respir. Crit. Care Med., November 1, 1998; 158(2007): S123 - S132.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. J. HIRST and T. H. LEE
Airway Smooth Muscle as a Target of Glucocorticoid Action in the Treatment of Asthma
Am. J. Respir. Crit. Care Med., November 1, 1998; 158(2007): S201 - S206.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
I. Rahman and W. MacNee
Role of transcription factors in inflammatory lung diseases
Thorax, July 1, 1998; 53(7): 601 - 612.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by John, M.
Right arrow Articles by Fan Chung, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by John, M.
Right arrow Articles by Fan Chung, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 1998 American Thoracic Society.