|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
Abstract |
|---|
|
|
|---|
Interleukin (IL)-8 is a C-X-C chemokine that potently chemoattracts and activates neutrophils. We determined whether IL-8 could be produced by human airway smooth muscle cells in culture and examined its
regulation. TNF-
stimulated IL-8 mRNA expression and protein release in a time- and dose-dependent
manner, whereas IFN-
alone had no effect. Both cytokines together did not induce greater IL-8 release
compared to TNF-
alone. IL-1
was more potent in inducing IL-8 release and, together with TNF-
,
there was a synergistic augmentation of IL-8 release. IL-8 release induced by TNF-
and IFN-
was partly
inhibited by the Th-2-derived cytokines IL-4, IL-10, and IL-13, as well as by dexamethasone. In addition to its contractile responses, airway smooth muscle cells have synthetic and secretory potential with the release of IL-8 and subsequent recruitment and activation of neutrophils in the airways. Release of IL-8 can
be modulated by Th-2-derived cytokines and corticosteroids.
| |
Introduction |
|---|
|
|
|---|
Airway smooth muscle has been regarded as having mainly contractile properties because of its ability to shorten in response to many contractile inflammatory mediators, leading to a reduction in airway caliber. Airway smooth muscle can also respond to cytokines and growth factors released from resident and/or infiltrating proinflammatory cells by undergoing mitogenesis (1). However, it is not known whether airway smooth muscle cells can act as effector cells in initiating or perpetuating airway inflammation by expressing and releasing inflammatory products such as chemotactic cytokines or chemokines.
Interleukin (IL)-8 is a member of the C-X-C chemokine subfamily of cytokines. It was identified following the original description of a neutrophil chemotactic agent in the supernatants of lipopolysaccharide (LPS)- or phytohemagglutinin-stimulated human monocytes (2, 3). IL-8 induces the full pattern of responses of activated neutrophils. It induces shape change and migration, exocytosis of stored proteins, and respiratory burst resulting in the release of superoxide anions or hydrogen peroxide of neutrophils (4). IL-8 is produced by inflammatory cells such as monocytes/macrophages (3), eosinophils (5), and by a variety of resident cells such as airway epithelial cells (6) and endothelial cells (7).
We have shown that human airway smooth muscle cells
(HASMCs) in culture can express and release the C-C
chemokine RANTES (8). This indicates that airway smooth
muscle not only has contractile function but can also secrete inflammatory products that participate in the airway
inflammatory response. We postulated that HASMCs could
also express and release C-X-C chemokines such as IL-8. In the present study, we demonstrate that HASMCs in culture can be stimulated by tumor necrosis factor
(TNF-
)
and IL-1
to express and release IL-8, and that this effect
can be inhibited by cytokines such as these derived from
Type 2 helper T cell (Th-2 cells): IL-4, IL-10, and IL-13.
Dexamethasone had a similar inhibitory effect. Our results
reinforce the view that HASMCs can participate in the
chemoattraction and activation of neutrophils and of other inflammatory cells.
| |
Materials and Methods |
|---|
|
|
|---|
HASMC Culture
Human bronchial smooth muscle was obtained from the lobar or main bronchus at lung resection from patients of either sex, undergoing surgery for carcinoma of the bronchus, as described previously (9, 10). Once in culture, human airway smooth muscle cells were maintained in Dulbecco's modified Eagle's medium (DMEM) containing fetal calf serum (FCS) (10%, vol/vol) supplemented with sodium pyruvate (1 mM), L-glutamine (2 mM), nonessential amino acid mixture (1:100), gentamicin (50 µg/ml), and amphotericin B (1.5 µg/ml). All cultures were maintained in a humidified atmosphere at 37°C in air/CO2 (95:5%, vol/vol). Fresh medium was replaced every 72 h. As revealed by immunofluorescence techniques for both smooth muscle actin and myosin, more than 95% of the cells displayed the characteristics of smooth muscle cells in culture (10).
Cell Stimulation
Confluent human airway smooth muscle cells (passage 3-
8) were growth arrested by FCS deprivation for 72 h in
DMEM supplemented with sodium pyruvate (1 mM), nonessential amino acids (1:100), L-glutamine (2 mM), gentamicin (50 µg/ml), amphotericin B (1.5 µg/ml) (GIBCO,
Paisley, UK), insulin (1 µM), transferrin (5 µg/ml), ascorbic acid (100 µM), and bovine serum albumin (BSA, 0.1%)
(Sigma, Poole, UK). After 72 h, cells were stimulated in
fresh FCS-free medium containing cytokines IL-1
, TNF-
,
interferon
(IFN-
) alone or in combination in a concentration- and time-dependent manner, and in the presence
of different concentrations of IL-4, IL-10, IL-13 (R&D Laboratories, Oxford, UK), and dexamethasone (Sigma). In
these experiments, dexamethasone and IL-4, IL-10, and
IL-13 were preincubated for 2 h prior to addition of TNF-
, IFN-
, and the mixture of three cytokines (cytomix).
Airway Smooth Muscle Proliferation
To determine any potential effect of IL-1
on airway
smooth muscle (ASM) proliferation, ASM at confluence
and growth arrested by FCS deprivation was incubated
with [3H]thymidine at a final concentration of 1 µCi ml
1
to allow this incorporation into DNA. Cultures were washed
twice in phosphate-buffered saline to rinse loosely associated radioactive tracer from the wells. Acid-soluble radioactivity was removed by a 20-min treatment with 5% trichloroacetic acid at 4°C, followed by washing the cultures
twice in 95% ethanol. The remaining material, which represented the acid-insoluble pools, was solubilized by a 30-min incubation with 2% Na2CO3 in 0.1 M NaOH. The radioactivity was determined by liquid scintillation counting.
Northern Blot Analysis
Total cellular RNA was extracted from adherent cells using a modification of the method of Chomczynski and Sacchi (11). Following two phenol-chloroform extractions
and an isopropanol precipitation, RNA samples were
stored overnight and washed twice with ethanol (75%, vol/
vol; BDH, Poole, UK) and dissolved in RNase-free water.
A total of 20 µg of cytoplasmic RNA was separated by
electrophoresis on a 1% agarose gel containing 7.5%
formaldehyde and transferred to a nylon Hybond-N membrane (Amersham, Bucks, UK) and fixed by ultraviolet irradiation. Filters were then hybridized with a 32P-labeled
human IL-8 cDNA probe using a multiprime DNA labeling kit (Amersham). The IL-8 probe was a 750-bp PstI-
BamHI cDNA fragment. Filters were then washed at a
final stringency of 0.1× SSC and 0.1% sodium dodecyl sulfate (SDS) at 55°C and exposed at
70°C on Kodak
(Rochester, NY) XS 1 100 film for 3-5 d. Probes were stripped by incubating the blot in a 50% formamide solution at 70°C for 2 h before hybridization with a 32P-labeled
1272-bp rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA probe. Densitometric quantification of the Northern blots was performed by laser densitometry (Protein & DNA Imageware System, Discovery Series, New York, NY). Specific RNA levels are expressed as the ratio of IL-8 to GAPDH mRNA.
Reverse Transcriptase-Polymerase Chain Reaction
Total cellular RNA was prepared as for Northern analysis. Reverse transcription of 1 µg of total RNA was performed using avian myeloblastosis virus (AMV) reverse transcriptase (15 U), a 1 mM of dATP, dCTP, dGTP, and dTTP, 0.4 µg oligo(dT)15 primer, 30 U RNase inhibitor, 5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 9.0), and 0.1% Triton X-100 in a total volume of 40 µl (all from Promega, Southampton, UK). Oligo(dT) and dissolved RNA were incubated at 65°C for 10 min and placed on ice for 5 min. The remaining ingredients were then added and samples were incubated at 42°C for 60 min followed by 10 min at 85°C. The cDNA was subsequently diluted to a final volume of 400 µl in nuclease-free water.
Ten microliters of the cDNA solutions were used. The polymerase chain reaction (PCR) was performed using a 7.5 pM concentration of forward and reverse primers; dATP, dGTP, dTTP, and dCTP at a final concentration of 0.2 mM each; Taq polymerase, 1.5 U; MgCl2, 1.5 mM; KCl, 50 mM; Tris-HCl (pH 9.0), 10 mM; and 0.1% Triton X-100 in a final volume of 30 µl. Primers for IL-8 were GTGCCGGTCGAACCTTCAGTA and CTCTTCAAAAACTTCTCCCGACTCTTAAGTATT, giving a product of 298 bp. Primers for GAPDH were TCTAGACGGCAGGTCAGGTCCACC and CCACCCATGGCAAATTCCATGGCA, giving a product of 598 bp. The PCR was carried out in a Techne multiwell thermocycler (Techne, Cambridge, UK) at 95°C for an initial 5 min followed by 24 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 60 s. Final extension was for 10 min at 72°C. The number of cycles was chosen after determination of the linear phase of the product amplification curve from serial sampling with increasing cycles of amplification. Products were distinguished by electrophoresis on a 2% agarose ethidium bromide-stained gel and then visualized and photographed using ultraviolet luminescence. The relative abundance of the product was assessed using laser densitometry measured from the photographic negative and expressed as a ratio of the IL-8 band to the GAPDH band.
IL-8 Radioimmunoassay
IL-8 was measured as described previously (12). All samples were assayed in duplicate, and nonspecific binding was determined by incubation of the radiolabeled ligand under identical conditions but in the absence of the anti-human IL-8 antiserum.
Data Analysis
Data are reported as a mean ± SEM. Comparison between groups was performed using the paired t test. A P value of < 0.05 was considered to be significant.
| |
Results |
|---|
|
|
|---|
Induction of IL-8 Protein and mRNA Expression
by TNF-
and IFN-
HASMCs were stimulated for 24 h with TNF-
(10 ng/ml)
and IFN-
(10 ng/ml) or with both TNF-
and IFN-
.
TNF-
alone induced IL-8 protein and mRNA, as measured on Northern analysis, whereas IFN-
had no significant effect. There was no further induction of IL-8 protein
and mRNA with the combination of both cytokines (Figure 1).
|
or IFN-
alone at concentrations of 0, 1, 3, 10, 30, and 100 ng/ml for 24 h. In addition, TNF-
(10 ng/ml) or IFN-
(10 ng/ml) was added to
each concentration of the alternate cytokine in order to
test any potential dose-dependent synergistic effect of one
cytokine on the other. IFN-
alone had no significant effect up to a concentration of 100 ng/ml, whereas TNF-
induced the release of IL-8, with the highest effect being seen
at 100 ng/ml. In the presence of TNF-
(10 ng/ml), IFN-
did not induce a dose-dependent increase in IL-8 production. Similarly, there was no potentiating effect of IFN-
(10 ng/ml) on the response to increasing concentrations of
TNF-
(Figure 2).
|
or IFN-
or TNF-
plus IFN-
at 10 ng/ml each.
There was a time-dependent increase in IL-8 release after
stimulation with TNF-
and with the combination of TNF-
and IFN-
(Figure 3). There was no synergistic effect of
TNF-
and IFN-
on IL-8 release. The time course of IL-8
release after stimulation with TNF-
plus IFN-
was similar to that of TNF-
alone. IFN-
alone had no effect on
IL-8 release. There was a persistent increase in IL-8 mRNA
as measured by reverse transcriptase (RT)-PCR between
12 and 96 h, with a peak expression at 24 h (Figure 3).
|
Effect of Different Combinations of IL-1
,
TNF-
, and IFN-
on IL-8 Release
HASMCs were stimulated for 24 h with TNF-
(10 ng/ml)
or IFN-
(10 ng/ml) in the presence of IL-1
(10 ng/ml) or
with a combination of the three cytokines (cytomix). The
stimulatory effect of IL-1
and IFN-
was similar to that
of IL-1
alone. Cytomix was significantly less effective
than IL-1
and TNF-
, indicating that IFN-
had inhibitory effects when combined with IL-1
and TNF-
on IL-8 release (Figure 4).
|
HASMCs were stimulated with IL-1
(0, 4, 20, and 100 ng/ml) for 24 h. All concentrations of IL-1
stimulated IL-8
release, with the 4-ng/ml concentration already having a
submaximal effect (Figure 5). Cytomix induced IL-8 release in a time-dependent fashion up to 48 h (Figure 5).
|
Effect of IL-1
on ASM Proliferation
IL-1
(10 ng/ml) decreased [3H]thymidine incorporation
by 36.3 ± 14.8% (n = 3); cytomix (IL-1
, IFN-
, and TNF-
,
at 10 ng/ml each; n = 3) also decreased it by 18.6 ± 9.3%.
Effects of IL-4, IL-10, IL-13, and Dexamethasone on IL-8 Release
HASMCs were stimulated with TNF-
plus IFN-
(10 ng/
ml each) in the presence of IL-4, IL-10, IL-13, or dexamethasone. IL-4, IL-10, and IL-13 significantly reduced
IL-8 production with a maximal effect observed at 10 ng/
ml for IL-4 and IL-10, and 1 ng/ml for IL-13 (Figure 6).
Dexamethasone inhibited IL-8 release by 26.5 ± 12.9% at
10
6 M (P < 0.001) together with a reduction in IL-8
mRNA as assessed by Northern analysis (Figure 1). After
stimulation with cytomix dexamethasone (10
6 M) inhibited IL-8 release by 41.2 ± 6% (Figure 6).
|
| |
Discussion |
|---|
|
|
|---|
We have shown that human airway smooth muscle cells in
culture are able to express IL-8 mRNA and release IL-8
protein in response to TNF-
and IL-1
but not to IFN-
.
This effect is concentration- and time-dependent. IL-1
was more potent than TNF-
and it synergized with TNF-
in terms of IL-8 release. The Th-2-derived cytokines IL-4,
IL-10, and IL-13 inhibited the release of IL-8 protein. Similarly, IL-8 release was inhibited by dexamethasone. Our
results suggest that airway smooth muscle may contribute
to airway inflammation by releasing the neutrophil chemoattractant and activating cytokine, IL-8.
IL-8 gene induction and protein release have been described in many cell types such as airway epithelial cells
(6, 13), mononuclear cells (14), and endothelial cells (7,
15), and our current work demonstrates the expression and
production of IL-8 by airway smooth muscle cells. IL-1
was more potent than TNF-
in inducing IL-8 protein release, and synergized with TNF-
in increasing IL-8 release. IL-1
and TNF-
have also been shown to increase
the expression of IL-8 in other cell types such as airway epithelial cells and fibroblasts (13, 16). We did not observe any effect of IFN-
. However, a synergistic interaction between TNF-
and IFN-
has been described in
airway smooth muscle cells (8) and also in fibroblasts, endothelial cells, and airway epithelial cells for gene expression and protein release of another chemokine, RANTES
(19). Thus, the ultimate effect of these proinflammatory cytokines on airway smooth muscle cells depends on
the particular chemokine generated.
There was a continuing time-dependent increase in IL-8
protein release on exposure to TNF-
or to cytokine mixture up to 48 to 96 h. The parallel increase in IL-8 mRNA
as observed on Northern analysis or reverse transcription
polymerase chain reaction indicates that the increase in
protein release is secondary to IL-8 gene transcription.
This is further supported by the observation that glucocorticosteroids inhibited both IL-8 gene expression together with IL-8 protein release to a similar extent. A negative
GRE site has been described on the 5'-flanking region of
the IL-8 gene (22) and binding of activated glucocorticoid
receptor to that site may lead to inhibition of IL-8 gene expression, as has been reported in a human fibrosarcoma
cell line (18).
It is possible that the time-dependent increase in IL-8
mRNA and protein expression indicates that this response
could be related to increased mitogenesis and changes in
airway smooth muscle cell phenotype. Previous studies
using similar concentrations of TNF-
have shown that it
induces modest proliferation in cultures of human airway
smooth muscle (23) and IL-1
has been reported to increase guinea pig airway smooth muscle cell mitogenesis
(24). However, in the present study, there was a reduction
in proliferation of human airway smooth muscle cells as
measured by thymidine incorporation induced by IL-1
and
also by the mixture of cytokines. It is therefore unlikely that
the increase in IL-8 expression and release observed following cytokine stimulation is due to any induced increase in smooth muscle cell proliferation.
The cytokines IL-4, IL-10, and IL-13 are derived from
Th-2 cells, and IL-10 and IL-13 can also be released from
monocytes/macrophages. The degree of inhibition observed
by these cytokines did not exceed 60%, with IL-10 being the
most effective. We have also observed that these three cytokines can inhibit to a similar extent the release of RANTES
from airway smooth muscle cells (8) and of macrophage
inflammatory protein 1
(MIP-1
) from alveolar macrophages (14, 25, 26). The inhibition observed by these cytokines on the release of IL-8 from airway smooth muscle
cells indicates that Th-2 cells or macrophages may interact
with airway smooth muscle. Activated T cells have been
shown to adhere to airway smooth muscle cells via specific
integrins (27).
Our results indicate that the airway smooth muscle cell should not be regarded solely as a specialized cell capable only of contractile responses. Proinflammatory cytokines and several growth factors can modulate airway smooth muscle phenotype and mitogenesis (1) and the resulting increase in airway smooth muscle mass may contribute to airway obstruction and bronchial hyperresponsiveness in asthma (28). It is not known whether IL-8 could have an autocrine role in the airway smooth muscle in controlling mitogenesis. In preliminary studies of immunostaining with an anti-IL-8 antibody, we have observed positive staining in airway smooth cells of the airways in lungs obtained from patients undergoing lung resection for cancer (T. Gilbey and K. F. Chung, unpublished observations). This indicates that IL-8 may be expressed under basal conditions in vivo, and the role of IL-8 in this situation is not known.
The additional secretory potential of airway smooth
muscle, particularly in terms of IL-8 and RANTES release, adds another dimension to the putative role of airway smooth muscle in airway inflammation. Airway smooth
muscle could contribute directly to the recruitment of inflammatory cells such as neutrophils to the airways by increased expression of IL-8. This could occur through the
release of the proinflammatory cytokines TNF-
and IL-1
from monocytes/alveolar macrophages or T cells within the
vicinity of airway smooth muscle cells. On the other hand,
Th-2 cells may provide cytokines such as IL-4, IL-10, and
IL-13 to inhibit IL-8 expression. Our observations support
the notion that airway smooth muscle could be a major
contributor to the inflammatory features of the airways in
diseases characterized by a neutrophilic airway inflammation such as chronic bronchitis and asthma.
| |
Footnotes |
|---|
Address correspondence to: Dr. K. F. Chung, National Heart and Lung Institute, Dovehouse St., London SW3 6LY, UK. E-mail: f.chung{at}ic.ac.uk
(Received in original form October 21, 1996 and in revised form April 7, 1997).
Acknowledgments: This work was supported by a Program Grant from the British Medical Research Council (K.F.C. and P.J.B.), and a grant from the Overseas German Academic Exchange Service (M.J.).
Abbreviations
ASM, airway smooth muscle;
DMEM, Dulbecco's modified Eagle's
medium;
FCS, fetal calf serum;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase;
HASMC, human airway smooth muscle cells;
IFN-
, interferon
;
IL, interleukin;
LPS, lipopolysaccharide;
RT-PCR, reverse transcriptase-polymerase chain reaction;
Th-2, helper T cell type 2;
TNF-
, tumor necrosis factor
.
| |
References |
|---|
|
|
|---|
1. Hirst, S. J.. 1996. Airway smooth muscle cell culture: application to studies of airway wall remodelling and phenotype plasticity in asthma. Eur. Respir. J. 9: 808-820 [Abstract].
2. Schroder, J. M., U. Mrowietz, E. Morita, and E. Christophers. 1987. Purification and partial biochemical characterisation of a human monocyte- derived, neutrophil-activating peptide that lacks interleukin 1 activity. J. Immunol. 139: 3474-3483 [Abstract].
3. Yoshimura, T., K. Matsushima, J. J. Oppenheim, and E. J. Leonard. 1987. Neutrophil chemotactic factor produced by lipopolysaccharide (LPS)-stimulated human blood mononuclear leukocytes: partial characterization and separation from interleukin 1 (IL-1). J. Immunol. 139: 788-793 [Abstract].
4.
Baggiolini, M.,
B. Dewald, and
B. Moser.
1994.
Interleukin-8 and related
chemotactic cytokines
CXC and CC chemokines.
Adv. Immunol.
55:
97-179
[Medline].
5. Yousefi, S., S. Hemmann, M. Weber, C. Holzer, K. Hartung, K. Blaser, and H. V. Simon. 1995. IL-8 is expressed by human peripheral blood eosinophils: evidence for increased secretion in asthma. J. Immunol. 154: 5481-5490 [Abstract].
6. Kwon, O. J., B. T. Au, P. D. Collins, J. N. Baraniuk, I. M. Adcock, K. F. Chung, and P. J. Barnes. 1994. Inhibition of interleukin-8 expression by dexamethasone in human cultured airway epithelial cells. Immunology 81: 389-394 [Medline].
7.
Strieter, R. M.,
S. L. Kunkel,
H. J. Showell,
D. J. Remick,
S. H. Phan,
P. A. Ward, and
R. M. Marks.
1989.
Endothelial cell gene expression of a neutrophil chemotactic factor by TNF
, LPS and IL-1
.
Science
243:
1467-1469
8. John, M., S. Hirst, P. J. Jose, A. Robichaud, N. Berkman, C. Witt, C. H. Twort, P. J. Barnes, and K. F. Chung. 1997. Human airway smooth muscle cells express and release RANTES in response to T helper 1 cytokines: regulation by Th-2 cytokines and corticosteroids. J. Immunol. 158: 1841-1847 [Abstract].
9. Hirst, S. J., P. J. Barnes, and C. H. L. Twort. 1992. Quantifying proliferation of cultured human and rabbit airway smooth muscle cells in response to serum and platelet-derived growth factor. Am. J. Respir. Cell Mol. Biol. 7: 574-581 .
10. Twort, C. H. C., and C. van Breemen. 1988. Human airway smooth muscle in culture. Tissue Cell 20: 339-344 [Medline].
11. Chomczynski, P., and N. Sacchi. 1987. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-160 [Medline].
12. Au, B. T., T. J. Williams, and P. D. Collins. 1994. Zymosan-induced IL-8 release from human neutrophils involves activation via the CD11b/CD18 receptor and endogenous platelet-activating factor as an autocrine modulator. J. Immunol. 152: 5411-5419 [Abstract].
13. Standiford, T. J., S. L. Kunkel, M. A. Basha, S. W. Chensue, J. P. Lynch, G. B. Toews, J. Westwick, and R. M. Strieter. 1990. Interleukin-8 gene expression by a pulmonary epithelial cell line: a model for cytokine networks in the lung. J. Clin. Invest. 86: 1945-1953 .
14.
Standiford, T. J.,
S. L. Kunkel,
J. M. Liebler,
M. D. Burdick,
A. R. Gilbert, and
R. M. Strieter.
1993.
Gene expression of macrophage inflammatory
protein-1
from human blood monocytes and alveolar macrophages is inhibited by interleukin-4.
Am. J. Respir. Cell Mol. Biol.
9:
192-198
.
15. Schonbeck, U., E. Brandt, F. Petersen, H. D. Flad, and H. Loppnow. 1995. IL-8 specifically binds to endothelial but not to smooth muscle cells. J. Immunol. 154: 2375-2383 [Abstract].
16.
Nakamura, H.,
K. Yoshimura,
H. A. Jaffe, and
R. G. Crystal.
1991.
Interleukin-8 gene expression in human bronchial epithelial cells.
J. Biol. Chem.
266:
19611-19615
17.
Tobler, A.,
R. Meier,
M. Seitz,
B. Dewald,
M. Baggiolini, and
M. F. Fey.
1992.
Glucocorticoids downregulate gene expression of GM-CSF, NAP-1/
IL-8 and IL-6, but not of M-CSF in human fibroblasts.
Blood
79:
45-51
18. Mukaida, N., G. L. Gussella, T. Kasahara, Y. Ko, C. O. Zachariae, T. Kawai, and K. Matsushima. 1992. Molecular analysis of the inhibition of interleukin-8 production by dexamethasone in a human fibrosarcoma cell line. Immunology 75: 674-679 [Medline].
19.
Rathanaswami, P.,
M. Hachicha,
M. Sadick,
T. J. Schall, and
S. R. McColl.
1993.
Expression of the cytokine RANTES in human rheumatoid synovial
fibroblasts: differential regulation of RANTES and interleukin-8 genes by
inflammatory cytokines.
J. Biol. Chem.
268:
5834-5839
20.
Marfaing-Koka, A.,
O. Devergne,
G. Gorgone,
A. Portier,
T. J. Schall,
P. Galanaud, and
D. Emilie.
1995.
Regulation of the production of the
RANTES chemokine by endothelial cells: synergistic induction by IFN
plus TNF-
and inhibition by IL-4 and IL-13.
J. Immunol.
154:
1870-1878
[Abstract].
21. Berkman, N., A. Robichaud, V. L. Krishnan, G. Roesems, R. Robbins, P. J. Jose, P. J. Barnes, and K. F. Chung. 1995. Expression of RANTES in human airway epithelial cells: effect of corticosteroids and interleukin-4, 10 and 13. Immunology 87: 599-603 .
22. Mukaida, N., M. Shiroo, and K. Matsushima. 1989. Genomic structure of the human monocyte-derived neutrophil chemotactic factor IC-8. J. Immunol. 143: 1366-1371 [Abstract].
23.
Stewart, A. G.,
P. R. Tomlinson,
D. J. Fernandes,
J. W. Wilson, and
T. Harris.
1995.
Tumor necrosis factor
modulates mitogenic responses of human cultured airway smooth muscle.
Am. J. Respir. Cell Mol. Biol.
12:
110-119
[Abstract].
24.
De, S.,
E. T. Zelazny,
J. F. Souhrada, and
M. Souhrada.
1995.
IL-1 beta and
IL-6 induce hyperplasia and hypertrophy of cultured guinea pig airway
smooth muscle cells.
J. Appl. Physiol.
78:
1555-1563
25.
Berkman, N.,
M. John,
G. Roesems,
P. J. Jose,
P. J. Barnes, and
K. F. Chung.
1995.
Inhibition of macrophage inflammatory protein-1
by interleukin-10: differential sensitivities in human blood monocytes and alveolar
macrophages.
J. Immunol.
155:
4412-4418
[Abstract].
26.
Berkman, N.,
G. Roesems,
P. J. Jose,
P. J. Barnes, and
K. F. Chung.
1996.
Interleukin-13 inhibits expression of macrophage-inflammatory protein-1
from human blood monocytes and alveolar macrophages.
Am. J. Respir.
Crit. Care Med.
15:
382-389
.
27.
Lazaar, A. L.,
S. M. Albelda,
J. M. Pilewski,
B. Brennan,
E. Pure, and
R. A. Panettieri.
1994.
T lymphocytes adhere to airway smooth muscle cells via
integrins and CD44 and induce smooth muscle cell DNA synthesis.
J. Exp.
Med.
180:
807-816
28. James, A. L., P. D. Pare, and J. C. Hogg. 1989. The mechanics of airway narrowing in asthma. Am. Rev. Respir. Dis. 139: 242-246 [Medline].
This article has been cited by other articles:
![]() |
M. Kaur, N. S. Holden, S. M. Wilson, M. B. Sukkar, K. F. Chung, P. J. Barnes, R. Newton, and M. A. Giembycz Effect of {beta}2-adrenoceptor agonists and other cAMP-elevating agents on inflammatory gene expression in human ASM cells: a role for protein kinase A Am J Physiol Lung Cell Mol Physiol, September 1, 2008; 295(3): L505 - L514. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Martin, R. J. O'Connell, A. Z. Pietrzykowski, S. N. Treistman, M. F. Ethier, and J. M. Madison Interleukin-4 activates large-conductance, calcium-activated potassium (BKCa) channels in human airway smooth muscle cells Exp Physiol, July 1, 2008; 93(7): 908 - 918. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. F. Chung and I. M. Adcock Multifaceted mechanisms in COPD: inflammation, immunity, and tissue repair and destruction Eur. Respir. J., June 1, 2008; 31(6): 1334 - 1356. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Siddiqui, F. Hollins, S. Saha, and C. E. Brightling Inflammatory cell microlocalisation and airway dysfunction: cause and effect? Eur. Respir. J., December 1, 2007; 30(6): 1043 - 1056. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Issa, S. Xie, N. Khorasani, M. Sukkar, I. M. Adcock, K.-Y. Lee, and K. F. Chung Corticosteroid Inhibition of Growth-Related Oncogene Protein-{alpha} via Mitogen-Activated Kinase Phosphatase-1 in Airway Smooth Muscle Cells J. Immunol., June 1, 2007; 178(11): 7366 - 7375. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Berndt, F. J. Derksen, P. J. Venta, S. Ewart, V. Yuzbasiyan-Gurkan, and N. E. Robinson Elevated amount of Toll-like receptor 4 mRNA in bronchial epithelial cells is associated with airway inflammation in horses with recurrent airway obstruction Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L936 - L943. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Ammit, L. M. Moir, B. G. Oliver, J. M. Hughes, H. Alkhouri, Q. Ge, J. K. Burgess, J. L. Black, and M. Roth Effect of IL-6 trans-signaling on the pro-remodeling phenotype of airway smooth muscle Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L199 - L206. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Govindaraju, M.-C. Michoud, M. Al-Chalabi, P. Ferraro, W. S. Powell, and J. G. Martin Interleukin-8: novel roles in human airway smooth muscle cell contraction and migration Am J Physiol Cell Physiol, November 1, 2006; 291(5): C957 - C965. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nozell, T. Laver, K. Patel, and E. N. Benveniste Mechanism of IFN-beta-Mediated Inhibition of IL-8 Gene Expression in Astroglioma Cells J. Immunol., July 15, 2006; 177(2): 822 - 830. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Issa, S. Xie, K.-Y. Lee, R. D. Stanbridge, P. Bhavsar, M. B. Sukkar, and K. F. Chung GRO-{alpha} regulation in airway smooth muscle by IL-1beta and TNF-{alpha}: role of NF-{kappa}B and MAP kinases Am J Physiol Lung Cell Mol Physiol, July 1, 2006; 291(1): L66 - L74. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kanefsky, M. Lenburg, and C.-M. Hai Cholinergic Receptor and Cyclic Stretch-Mediated Inflammatory Gene Expression in Intact ASM Am. J. Respir. Cell Mol. Biol., April 1, 2006; 34(4): 417 - 425. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chiba, M. Murata, H. Ushikubo, Y. Yoshikawa, A. Saitoh, H. Sakai, J. Kamei, and M. Misawa Effect of Cigarette Smoke Exposure In Vivo on Bronchial Smooth Muscle Contractility In Vitro in Rats Am. J. Respir. Cell Mol. Biol., December 1, 2005; 33(6): 574 - 581. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. F. Chung The Role of Airway Smooth Muscle in the Pathogenesis of Airway Wall Remodeling in Chronic Obstructive Pulmonary Disease Proceedings of the ATS, November 1, 2005; 2(4): 347 - 354. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Birrell, E. Hardaker, S. Wong, K. McCluskie, M. Catley, J. De Alba, R. Newton, S. Haj-Yahia, K. T. Pun, C. J. Watts, et al. I{kappa}-B Kinase-2 Inhibitor Blocks Inflammation in Human Airway Smooth Muscle and a Rat Model of Asthma Am. J. Respir. Crit. Care Med., October 15, 2005; 172(8): 962 - 971. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Morris, M. K. B. Whyte, G. F. Martin, P. J. Jose, S. K. Dower, and I. Sabroe Agonists of Toll-like Receptors 2 and 4 Activate Airway Smooth Muscle via Mononuclear Leukocytes Am. J. Respir. Crit. Care Med., April 15, 2005; 171(8): 814 - 822. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. F. M. Wouters Local and Systemic Inflammation in Chronic Obstructive Pulmonary Disease Proceedings of the ATS, April 1, 2005; 2(1): 26 - 33. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Ethier, E. Cappelluti, and J. M. Madison Mechanisms of Interleukin-4 Effects on Calcium Signaling in Airway Smooth Muscle Cells J. Pharmacol. Exp. Ther., April 1, 2005; 313(1): 127 - 133. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Xie, M. B. Sukkar, R. Issa, U. Oltmanns, A. G. Nicholson, and K. F. Chung Regulation of TGF-{beta}1-induced connective tissue growth factor expression in airway smooth muscle cells Am J Physiol Lung Cell Mol Physiol, January 1, 2005; 288(1): L68 - L76. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Sukkar, R. Issa, S. Xie, U. Oltmanns, R. Newton, and K. F. Chung Fractalkine/CX3CL1 production by human airway smooth muscle cells: induction by IFN-{gamma} and TNF-{alpha} and regulation by TGF-{beta} and corticosteroids Am J Physiol Lung Cell Mol Physiol, December 1, 2004; 287(6): L1230 - L1240. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Panettieri Jr. Effects of Corticosteroids on Structural Cells in Asthma and Chronic Obstructive Pulmonary Disease Proceedings of the ATS, November 1, 2004; 1(3): 231 - 234. [Abstract] [Full Text] [PDF] |
||||
![]() |
C E Brightling and I D Pavord Location, location, location: microlocalisation of inflammatory cells and airway dysfunction Thorax, September 1, 2004; 59(9): 734 - 735. [Full Text] [PDF] |
||||
![]() |
I. Nomura, E. Goleva, M. D. Howell, Q. A. Hamid, P. Y. Ong, C. F. Hall, M. A. Darst, B. Gao, M. Boguniewicz, J. B. Travers, et al. Cytokine Milieu of Atopic Dermatitis, as Compared to Psoriasis, Skin Prevents Induction of Innate Immune Response Genes J. Immunol., September 15, 2003; 171(6): 3262 - 3269. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Brusasco and R. Pellegrino Invited Review: Complexity of factors modulating airway narrowing in vivo: relevance to assessment of airway hyperresponsiveness J Appl Physiol, September 1, 2003; 95(3): 1305 - 1313. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Amrani, O. Tliba, D. Choubey, C.-D. Huang, V. P. Krymskaya, A. Eszterhas, A. L. Lazaar, and R. A. Panettieri Jr. IFN-gamma inhibits human airway smooth muscle cell proliferation by modulating the E2F-1/Rb pathway Am J Physiol Lung Cell Mol Physiol, June 1, 2003; 284(6): L1063 - L1071. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Baraldo, D. S. Faffe, P. E. Moore, T. Whitehead, M. McKenna, E. S. Silverman, R. A. Panettieri Jr., and S. A. Shore Interleukin-9 influences chemokine release in airway smooth muscle: role of ERK Am J Physiol Lung Cell Mol Physiol, June 1, 2003; 284(6): L1093 - L1102. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-D. Huang, O. Tliba, R. A. Panettieri Jr., and Y. Amrani Bradykinin Induces Interleukin-6 Production in Human Airway Smooth Muscle Cells: Modulation by Th2 Cytokines and Dexamethasone Am. J. Respir. Cell Mol. Biol., March 1, 2003; 28(3): 330 - 338. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. Patel, M. G. Belvisi, D. Bishop-Bailey, M. H. Yacoub, and J. A. Mitchell Activation of Peroxisome Proliferator-Activated Receptors in Human Airway Smooth Muscle Cells Has a Superior Anti-inflammatory Profile to Corticosteroids: Relevance for Chronic Obstructive Pulmonary Disease Therapy J. Immunol., March 1, 2003; 170(5): 2663 - 2669. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. V. Culpitt, D. F. Rogers, P. Shah, C. De Matos, R. E. K. Russell, L. E. Donnelly, and P. J. Barnes Impaired Inhibition by Dexamethasone of Cytokine Release by Alveolar Macrophages from Patients with Chronic Obstructive Pulmonary Disease Am. J. Respir. Crit. Care Med., January 1, 2003; 167(1): 24 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. T. Gerthoffer and C. A. Singer Secretory Functions of Smooth Muscle: Cytokines and Growth Factors Mol. Interv., November 1, 2002; 2(7): 447 - 456. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Hirst, M. P. Hallsworth, Q. Peng, and T. H. Lee Selective Induction of Eotaxin Release by Interleukin-13 or Interleukin-4 in Human Airway Smooth Muscle Cells Is Synergistic with Interleukin-1beta and Is Mediated by the Interleukin-4 Receptor alpha -Chain Am. J. Respir. Crit. Care Med., April 15, 2002; 165(8): 1161 - 1171. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Varner The Increase in Allergic Respiratory Diseases : Survival of the Fittest? Chest, April 1, 2002; 121(4): 1308 - 1316. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. W. Chalmers, K. J. MacLeod, L. Thomson, S. A. Little, C. McSharry, and N. C. Thomson Smoking and Airway Inflammation in Patients With Mild Asthma Chest, December 1, 2001; 120(6): 1917 - 1922. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. AMRANI, P. E. MOORE, R. HOFFMAN, S. A. SHORE, and R. A. PANETTIERI JR. Interferon-gamma Modulates Cysteinyl Leukotriene Receptor-1 Expression and Function in Human Airway Myocytes Am. J. Respir. Crit. Care Med., December 1, 2001; 164(11): 2098 - 2101. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Page, A. J. Ammit, J. L. Black, and C. L. Armour Human mast cell and airway smooth muscle cell interactions: implications for asthma Am J Physiol Lung Cell Mol Physiol, December 1, 2001; 281(6): L1313 - L1323. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. HALLSWORTH, L. M. MOIR, D. LAI, and S. J. HIRST Inhibitors of Mitogen-activated Protein Kinases Differentially Regulate Eosinophil-activating Cytokine Release from Human Airway Smooth Muscle Am. J. Respir. Crit. Care Med., August 15, 2001; 164(4): 688 - 697. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Madison and M. F. Ethier Interleukin-4 Rapidly Inhibits Calcium Transients in Response to Carbachol in Bovine Airway Smooth Muscle Cells Am. J. Respir. Cell Mol. Biol., August 1, 2001; 25(2): 239 - 244. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. LAPORTE, P. E. MOORE, S. BARALDO, M.-H. JOUVIN, T. L. CHURCH, I. N. SCHWARTZMAN, R. A. PANETTIERI Jr, J.-P. KINET, S. A. SHORE, and S. A. SHORE Direct Effects of Interleukin-13 on Signaling Pathways for Physiological Responses in Cultured Human Airway Smooth Muscle Cells Am. J. Respir. Crit. Care Med., July 1, 2001; 164(1): 141 - 148. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Gibson, J. L. Simpson, and N. Saltos Heterogeneity of Airway Inflammation in Persistent Asthma : Evidence of Neutrophilic Inflammation and Increased Sputum Interleukin-8 Chest, May 1, 2001; 119(5): 1329 - 1336. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Lazzeri, M. G. Belvisi, H. J. Patel, M. H. Yacoub, K. Fan Chung, and J. A. Mitchell Effects of Prostaglandin E2 and cAMP Elevating Drugs on GM-CSF Release by Cultured Human Airway Smooth Muscle Cells . Relevance to Asthma Therapy Am. J. Respir. Cell Mol. Biol., January 1, 2001; 24(1): 44 - 48. [Abstract] [Full Text] |
||||
![]() |
L. PANG and A. J. KNOX Regulation of TNF-{alpha}-induced eotaxin release from cultured human airway smooth muscle cells by {beta}2-agonists and corticosteroids FASEB J, January 1, 2001; 15(1): 261 - 269. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. H. Thomas, M. I. Y. Wickremasinghe, M. Sharland, and J. S. Friedland Synergistic Upregulation of Interleukin-8 Secretion from Pulmonary Epithelial Cells by Direct and Monocyte-Dependent Effects of Respiratory Syncytial Virus Infection J. Virol., September 15, 2000; 74(18): 8425 - 8433. [Abstract] [Full Text] |
||||
![]() |
L. Pang and A. J. Knox Synergistic Inhibition by beta 2-Agonists and Corticosteroids on Tumor Necrosis Factor-alpha -Induced Interleukin-8 Release from Cultured Human Airway Smooth-Muscle Cells Am. J. Respir. Cell Mol. Biol., July 1, 2000; 23(1): 79 - 85. [Abstract] [Full Text] |
||||
![]() |
J. C. Hedges, C. A. Singer, and W. T. Gerthoffer Mitogen-Activated Protein Kinases Regulate Cytokine Gene Expression in Human Airway Myocytes Am. J. Respir. Cell Mol. Biol., July 1, 2000; 23(1): 86 - 94. [Abstract] [Full Text] |
||||
![]() |
S. McKay, S. J. Hirst, M. B.-d. Haas, J. C. de Jongste, H. C. Hoogsteden, P. R. Saxena, and H. S. Sharma Tumor Necrosis Factor-alpha Enhances mRNA Expression and Secretion of Interleukin-6 in Cultured Human Airway Smooth Muscle Cells Am. J. Respir. Cell Mol. Biol., July 1, 2000; 23(1): 103 - 111. [Abstract] [Full Text] |
||||
![]() |
M. R. van Scott, J. P. Justice, J. F. Bradfield, E. Enright, A. Sigounas, and S. Sur IL-10 reduces Th2 cytokine production and eosinophilia but augments airway reactivity in allergic mice Am J Physiol Lung Cell Mol Physiol, April 1, 2000; 278(4): L667 - L674. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. MARUOKA, S. HASHIMOTO, Y. GON, I. TAKESHITA, and T. HORIE PAF-induced RANTES Production by Human Airway Smooth Muscle Cells Requires Both p38 MAP Kinase and Erk Am. J. Respir. Crit. Care Med., March 1, 2000; 161(3): 922 - 929. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Pype, L. J. Dupont, P. Menten, E. Van Coillie, G. Opdenakker, J. Van Damme, K. Fan Chung, M. G. Demedts, and G. M. Verleden Expression of Monocyte Chemotactic Protein (MCP)-1, MCP-2, and MCP-3 by Human Airway Smooth-Muscle Cells . Modulation by Corticosteroids and T-Helper 2 Cytokines Am. J. Respir. Cell Mol. Biol., October 1, 1999; 21(4): 528 - 536. [Abstract] [Full Text] |
||||
![]() |
N. Hagimoto, K. Kuwano, M. Kawasaki, M. Yoshimi, Y. Kaneko, R. Kunitake, T. Maeyama, T. Tanaka, and N. Hara Induction of Interleukin-8 Secretion and Apoptosis in Bronchiolar Epithelial Cells by Fas Ligation Am. J. Respir. Cell Mol. Biol., September 1, 1999; 21(3): 436 - 445. [Abstract] [Full Text] |
||||
![]() |
K F Chung and P J Barnes Cytokines in asthma Thorax, September 1, 1999; 54(9): 825 - 857. [Full Text] |
||||
![]() |
Y. Amrani, A. L. Lazaar, and R. A. Panettieri Jr. Up-Regulation of ICAM-1 by Cytokines in Human Tracheal Smooth Muscle Cells Involves an NF-{kappa}B-Dependent Signaling Pathway That Is Only Partially Sensitive to Dexamethasone J. Immunol., August 15, 1999; 163(4): 2128 - 2134. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Patel, D. E. Faunce, M. S. Gregory, L. A. Duffner, and E. J. Kovacs Elevation in Pulmonary Neutrophils and Prolonged Production of Pulmonary Macrophage Inflammatory Protein-2 after Burn Injury with Prior Alcohol Exposure Am. J. Respir. Cell Mol. Biol., June 1, 1999; 20(6): 1229 - 1237. [Abstract] [Full Text] |
||||
![]() |
O. GHAFFAR, Q. HAMID, P. M. RENZI, Z. ALLAKHVERDI, S. MOLET, J. C. HOGG, S. A. SHORE, A. D. LUSTER, and B. LAMKHIOUED Constitutive and Cytokine-Stimulated Expression of Eotaxin by Human Airway Smooth Muscle Cells Am. J. Respir. Crit. Care Med., June 1, 1999; 159(6): 1933 - 1942. [Abstract] [Full Text] |
||||
![]() |
M. L. Watson, A.-M. White, E. M. Campbell, A. W. Smith, J. Uddin, T. Yoshimura, and J. Westwick Anti-Inflammatory Actions of Interleukin-13 . Suppression of Tumor Necrosis Factor-alpha and Antigen-Induced Leukocyte Accumulation in the Guinea Pig Lung Am. J. Respir. Cell Mol. Biol., May 1, 1999; 20(5): 1007 - 1012. [Abstract] [Full Text] |
||||
![]() |
M. P. Hallsworth, C. P. C. Soh, C. H. C. Twort, T. H. Lee, and S. J. Hirst Cultured human airway smooth muscle cells stimulated by interleukin-1beta enhance eosinophil survival. Am. J. Respir. Cell Mol. Biol., December 1, 1998; 19(6): 910 - 919. [Abstract] [Full Text] |
||||
![]() |
P. J. Barnes, K. F. Chung, and C. P. Page Inflammatory Mediators of Asthma: An Update Pharmacol. Rev., December 1, 1998; 50(4): 515 - 596. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. BARNES Pharmacology of Airway Smooth Muscle Am. J. Respir. Crit. Care Med., November 1, 1998; 158(2007): S123 - S132. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. HIRST and T. H. LEE Airway Smooth Muscle as a Target of Glucocorticoid Action in the Treatment of Asthma Am. J. Respir. Crit. Care Med., November 1, 1998; 158(2007): S201 - S206. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Rahman and W. MacNee Role of transcription factors in inflammatory lung diseases Thorax, July 1, 1998; 53(7): 601 - 612. [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Crit. Care Med. |