help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, C. F.
Right arrow Articles by Limper, A. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, C. F., Jr.
Right arrow Articles by Limper, A. H.
Am. J. Respir. Cell Mol. Biol., Volume 18, Number 3, March 1998 297-306

RAPID COMMUNICATION
Pneumocystis carinii Contains a Functional Cell-division-cycle Cdc2 Homologue

Charles F. Thomas Jr., Robert A. Anders, Michael P. Gustafson, Edward B. Leof, and Andrew H. Limper

Division of Pulmonary, Critical Care and Internal Medicine, and Department of Biochemistry and Molecular Biology, Mayo Clinic and Foundation, Rochester, Minnesota


    Abstract
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Pneumocystis carinii causes life-threatening pneumonia in immunocompromised patients. The inability to culture P. carinii has hampered basic investigations of the organism's life cycle, limiting the development of new therapies directed against it. Recent investigations indicate that P. carinii is a fungus phylogenetically related to other ascomycetes such as Schizosaccharomyces pombe. The cell cycles of S. pombe and homologous fungi are carefully regulated by cell-division-cycle molecules (cdc), particularly cell-division-cycle 2 (Cdc2), a serine-threonine kinase with essential activity at the G1 restriction point and for entry into mitosis. Antibodies to the proline-serine-threonine-alanine-isoleucine-arginine (PSTAIR) amino-acid sequence conserved in Cdc2 proteins specifically precipitated, from P. carinii extracts, a molecule with kinase activity consistent with a Cdc2-like protein. Cdc2 molecules exhibit differential activity throughout the life cycle of the organisms in which they occur. In accord with this, the P. carinii Cdc2 showed greater specific activity in P. carinii trophic forms (trophozoites) than in spore-case forms (cysts). In addition, complete genomic and complementary DNA (cDNA) sequences of P. carinii Cdc2 were cloned and found to be most closely homologus to the corresponding sequences of other pathogenic fungi. The function of P. carinii cdc2 cDNA was further documented through its ability to complement the DNA of mutant strains of S. pombe with temperature-sensitive deficiencies in Cdc2 activity. The P. carinii cdc2 cDNA restored normal Cdc2 function in these mutant strains of S. pombe, and promoted fungal proliferation. These studies represent the first molecular analysis of the cell-cycle-regulatory machinery in P. carinii. Further understanding of P. carinii's life cycle promises novel insights for preventing and treating the intractable infection it causes in immunocompromised patients.


    Introduction
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Pneumocystis carinii causes severe pneumonia in patients with chronic immunosuppression. Although P. carinii pneumonia is most often associated with acquired immunodeficiency syndrome (AIDS), patients with solid tumors, hematologic malignancies, organ transplantation, and inflammatory conditions requiring prolonged immunosuppression with corticosteroids or cytotoxic agents are also at increased risk for developing P. carinii pneumonia (1- 3). The mortality from P. carinii pneumonia remains an unacceptable 15% to 40%, being substantially higher in immunosupressed patients without AIDS (1). In addition, medications currently used for preventing and treating P. carinii pneumonia are associated with significant side effects, which limit their use in many patients. Therefore, the development of newer classes of therapeutic agents for this infection remains a pressing concern.

A complete understanding of life-cycle regulation of P. carinii is currently lacking. P. carinii has recently been shown to be of fungal origin on the basis of ribosomal RNA gene-homology and enzyme-biochemistry studies (6). Recent phylogenetic investigations indicate that P. carinii is a member of the Ascomycetes, located on a deep branch separating it from other members of this phylum (8). As an Ascomycete, P. carinii is related to the fission yeast Schizosaccharomyces pombe, an organism useful in the study of cell-cycle regulation (6, 7, 9, 10). Considerable controversy continues to exist about the most appropriate classification and nomenclature for P. carinii. The terms "trophozoites" and "cysts" are related to the earlier misclassification of this organism as a protozoal parasite. In this regard, the terms "trophic form" and "spore case" are more appropriately applied to these life-cycle stages of P. carinii (11, 12). Ultrastructural studies of infected lung tissue have revealed that P. carinii consists predominantly of diminutive trophic forms (trophozoites) (1 to 2 µ), with varying numbers of the larger spore case (cyst) forms (8 µ) (7, 13, 14).

The interaction of trophic forms of P. carinii with alveolar epithelial cells is an integral component of the organism's life cycle, which modulates cellular proliferation (7, 15). In particular, attachment of P. carinii to cultured alveolar epithelial cells impairs cell-cycle progression and proliferation of host epithelial cells (16). Concurrently, binding of the trophic form to cultured alveolar epithelial cells promotes proliferation of the organism (18, 19). Although it can occasionally be found at other sites in the body in the later stages of AIDS, P. carinii predominantly proliferates within the alveolar spaces (7). Despite numerous efforts employing a variety of cell lines, media, and methodologies, the in vitro cultivation of P. carinii has met with rather limited success, and no system yet exists to maintain P. carinii continuously in a cell-free system (5). The limited availability of short-term culture of P. carinii and the inability to propagate it in cell-free systems have rendered basic biochemical studies of this organism difficult.

The cell cycles of fungi related to P. carinii are precisely controlled by the expression and activation of a number of cell-division-cycle molecules (cdc) (20). In S. pombe, cell-division-cycle 2 (Cdc2) (also referred to as p34cdc2), represents an essential cyclin-dependent serine-threonine kinase whose activation is required for traverse through the G1 restriction START point of the cell cycle and for entry into mitosis (20). Accordingly, we hypothesized that P. carinii has a life cycle regulated by such a Cdc2-like molecule. The current investigation was therefore undertaken to: (1) determine whether P. carinii contains a functional Cdc2-like molecule; (2) evaluate the relative activity of the P. carinii Cdc2-like protein throughout the organism's life cycle, using isolated populations of P. carinii spore cases and trophic forms; and (3) perform molecular cloning of the P. carinii cdc2 gene and to generate complementary DNA (cDNA), and to verify that they encode a functional Cdc2 protein capable of promoting fungal proliferation.

In the current study, we present evidence that P. carinii contains a Cdc2-like molecule with usual protein kinase activity. This Cdc2-like molecule from P. carinii exhibited greater specific activity in trophic forms than in spore-case forms, indicating differential regulation throughout P. carinii's life cycle. In addition, we have completely identified the P. carinii cdc2 gene and cDNA, and provide evidence that the P. carinii cdc2 cDNA is functionally active, as demonstrated by its ability to restore proliferation of S. pombe mutants expressing temperature-sensitive deficiencies in S. pombe Cdc2 activity.

    Materials and Methods
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Materials

All reagents were from Sigma Chemical Co. (St. Louis, MO) unless otherwise specified. [gamma -32P]adenosine triphosphate ([gamma -32P]ATP) was purchased from New England Nuclear (Boston, MA). A polyclonal anti-PSTAIR rabbit antibody and its cognate peptide were purchased from Upstate Biotechnology Inc. (Lake Placid, NY). Nonimmune rabbit IgG was purchased from Sigma Chemial Co. A rat-derived P. carinii genomic DNA library in the lambda gt11 bacteriophage was kindly provided by Dr. James R. Stringer of the University of Cincinnati College of Medicine (23). This rat P. carinii genomic library was derived from P. carinii sp. f. (special form) carinii. Nitrocellulose membranes containing P. carinii chromosomes separated by contour-clamped homogenous-field electrophoreses (CHEFs) were the generous gift of Dr. Melanie T. Cushion of the University of Cincinnati College of Medicine (24). Dr. K. Gould of Vanderbilt University, provided S. pombe cdc2 mutants containing temperature-sensitive deficiencies of S. pombe Cdc2. The pREP41 vector and the pIRT2 plasmid containing the wild-type S. pombe cdc2 gene were also the kind gift of Dr. Gould (25). Ciprofloxacin was donated by Miles Pharmaceuticals, Inc. (West Haven, CT).

Preparation of Pneumocystis carinii

All animal studies were reviewed, approved, and conducted under the auspices of the Mayo Institutional Animal Care and Utilization Committee according to standard laboratory practices. P. carinii pneumonia was induced in Harlan Sprague-Dawley rats (HSD Colony 231; Harlan Inc., Dublin, VA) by immunosuppression with dexamethasone and transtracheal injection with P. carinii, as previously reported (16, 29). Specific-pathogen-free rats were freely provided with drinking water containing dexamethasone (2 mg/liter), tetracycline (500 mg/liter), and nystatin (200,000 U/liter), and were fed an 8% protein diet in order to intensify the severity of infection. On a weekly basis, the animals also received oral ciprofloxacin (0.45 g/liter) for two consecutive days to further reduce the risk of bacterial infections. After 5 d of immunosuppression, rats were transtracheally inoculated with P. carinii (~ 500,000 spore cases), prepared by homogenizing infected rat lung in a Stomacher microbiologic blender. After tracheal injection, the rats were immunosuppressed for an additional 6 to 8 wk and killed. P. carinii were purified by homogenation and differential filtration, in which the homogenates were exhaustively filtered through 10 µm filters, which retain lung cells but allow passage of P. carinii (31). The filtrates were collected and centrifuged (1,500 × g for 30 min), and the pellets were resuspended in 5 ml of Hanks' balanced salt solution (HBSS). Duplicate 10-µl aliquots of suspension were spotted onto slides, and stained with modified Wright- Giemsa (Diff-Quik), and P. carinii quantified as described (16, 30). If other microorganisms were noted on microbiologic examination, the material was discarded.

Immunodetection of a Cdc2-like Molecule from P. carinii

To intially determine whether P. carinii contains a Cdc2-like molecule with typical protein kinase activity, P. carinii extracts were immunoprecipitated with a polyclonal antibody to the proline-serine-threonine-alanine-isoleucine- arginine (PSTAIR) sequence strongly conserved in Cdc2 proteins from related fungi. These P. carinii immunoprecipitates were then assayed for their ability to phosphorylate histone H1, an activity observed for other Cdc2 proteins. P. carinii (~ 5 × 108 organisms) were suspended in kinase lysis buffer (250 mM NaCl; 50 mM Tris-HCl, pH 7.4; 0.1% Triton X-100; 5 mM ethylene diamine tetraacetic acid (EDTA); 5 mM Na vanadate, 5 mM NaF; 50 µg/ml phenylmethyl sulfonyl fluoride (PMSF); 1 µg/ml leupeptin; 0.1 TIU aprotinin) and sonicated to disrupt the cell walls. Soluble proteins were recovered after centrifugation at 12,000 × g for 10 min, the protein concentrations were determined (bicinchoninic acid [BCA] method; Pierce Chemical Company, Rockford, IL), and the extracts were aliquoted. Identical aliquots were preabsorbed with 50% protein A-Sepharose and centrifuged at 12,000 × g for 10 min, and the supernatants were incubated with either anti-PSTAIR antibody or nonimmune rabbit IgG (Upstate Biotechnologies; 50 µg/ml each) at 4°C. To further verify the specificity of the immunoprecipitation, anti-PSTAIR antibody was also pretreated with its cognate peptide for 1 h before incubation with an additional identical aliquot of the P. carinii extract. Protein-antibody complexes were precipitated with 50% protein A-Sepharose and centrifuged at 12,000 × g for 10 min. The immunoprecipitation products were washed twice with lysis buffer and twice with kinase buffer (50 mM Tris HCl, pH 7.4; 10 mM MgCl2; 1 mM dithiothreitol [DTT]). Following the final wash, the pellet was suspended in kinase buffer containing 5 µM ATP, 100 µg/ ml histone H1, and 0.1 µCi/µl [gamma -32P]ATP, and were incubated for 10 min at 30°C. The reaction was stopped with Laemmli buffer containing 5% 2-mercaptoethanol, resolved with 12% sodium dodecyl sulfate-polyacrylamide-gel electrophoresis (SDS-PAGE), and exposed to autoradiography film. As a means of ensuring that the protein kinase activity was derived from P. carinii and was not from rat-lung contamination, the lungs of uninfected rats housed separately from the P. carinii-infected rats were processed under identical conditions. The resulting filtrates were lysed, immunoprecipitated with anti-PSTAIR antibody, and reacted in the histone H1 kinase assay.

Determination of the Relative Specific Activity of the P. carinii Cdc2-like Protein Kinase in Spore Cases and Trophic Forms

As a regulatory protein Cdc2 has its activity controlled over the course of the cell cycle. Therefore, to address whether the P. carinii Cdc2-like protein was differentially regulated throughout the life cycle of the organism, the specific activity of P. carinii Cdc2 was determined in isolated populations of P. carinii spore cases and trophic forms. Differential filtration was used to separate P. carinii spore cases and trophic forms (31). In brief, P. carinii spore cases are retained by a 3-µM nucleopore filter and resuspended after exhaustive washing. P. carinii trophic forms, however, pass through the filter and are collected by centrifugation. This separation procedure yielded trophic form populations containing 99.5% trophic forms and spore-case preparations that were 40-fold enriched in P. carinii spore cases. Equal amounts of protein extracted from spore cases and trophic forms (550 µg each) were aliquoted and adjusted to equal volumes in lysis buffer. Parallel aliquots were preabsorbed with 50% protein A-Sepharose and centrifuged at 12,000 × g for 10 min, and the supernatants were incubated with anti-PSTAIR antibody (50 µg/ml). Protein-antibody complexes were precipitated with 50% protein A-Sepharose and centrifuged at 12,000 × g for 10 min after which protein kinase activity was determined with histone H1 as substrate.

Molecular Cloning of the P. carinii cdc2 Gene and cDNA Sequences

P. carinii were isolated by homogenization and differential filtration from immunosupressed rats, and the genomic DNA was extracted as reported (32). Polymerase chain reaction (PCR) amplification of P. carinii genomic DNA was performed with 30 cycles of replication, using 1 µM of each degenerate primer derived from the conserved PSTAIR aminoacid motif, TTC(A/T/C/G)CG(A/T)AT(A/T)GC (A/T)GT(A/G)CT(A/T)G, and from the ATP-binding region, GG(A/T)GAAGG(A/T)AC(A/T)TATGG(A/T)GT (A/T)G conserved in other fungal Cdc2 proteins (25). The amplification conditions consisted of an initial 4-min hot start at 94°C, followed by 30 cycles at 94°C for 60 s, 48°C for 60 s and 72°C for 60 s, and a final 10 min extension at 72°C. A single 123-bp amplicon was generated, subcloned into the pCRII vector (Invitrogen), and sequenced. Sequence comparisons with DNA sequences in the GenBank were made with the Basic Local Alignment Search Tool (BLAST) genetic analysis program (National Center for Biotechnology Information). To verify that this PCR- derived product was of P. carinii origin, the amplicon was hybridized to a nitrocellulose membrane containing separated P. carinii chromosomes. P. carinii chromosomes were separated by CHEFs, as previously reported (24). The 123-bp amplicon was labeled with [alpha -32P]dATP by the random-primer method (Rediprime System; Amersham). After prehybridization for 30 min (ExpressHyb solution, Clontech), the CHEF nitrocellulose membrane was incubated with the probe (1.5 × 106 cpm/ml) at 60°C for 1 h, washed once at 37°C for 40 min in 2× saline sodium citrate (SSC) buffer containing 0.05% SDS, washed once at 50°C for 40 min in 2× SSC buffer containing 0.1% SDS, and examined with autoradiography.

A rat-derived P. carinii sp. f. carinii genomic DNA library in lambda gt11 was subsequently screened by hybridization to the 123-bp amplicon. Clones were plaque-purified to homogeneity. A 2.7-kb insert was identified and subcloned into pGEM-7Zf(-) (Promega), and both strands were fully sequenced (GenBank Accession Number AF026546). P. carinii cdc2 cDNA was produced by RT-PCR of total RNA extracted from P. carinii with guanidium isothiocyanate. Reverse transcription was performed for 1 h at 37°C, using 10 µg of total RNA in a reaction with 1.5 µM oligo-dT (15-mer) and 400 U Moloney murine leukemia virus (M-MLV) reverse transcriptase. PCR amplification of the cDNA was performed for 30 cycles, using 1 µM of each primer (TTTTCATATGGAGCAATATCAGAGGTTAGAG [containing a 5' NdeI site], and TTTTGGATCCCTATAGCACCACATTAGATCTATT [containing a 3' BamHI site]) (GenBank Accession Number AF026545). The amplification conditions consisted of an initial 4-min hot start at 94°C, followed by 30 cycles of 94°C for 60 s, 56°C for 60 s, and 72°C for 60 s, and a final 10 min extension at 72°C. A single 900-bp product was subcloned into pCRII and sequenced.

Determination of P. carinii cdc2 Activity in Fungal Cell Cycle Progression

As noted, studies of P. carinii have been hampered by an inability to culture this fungus. To overcome the difficulty of P. carinii culture, we have analyzed the functional capacity of P. carinii Cdc2 in cell-cycle control by transforming Cdc2-deficient S. pombe with P. carinii cdc2 cDNA. S. pombe temperature-sensitive cdc2 mutants grow at the permissive temperature of 30°C, but undergo cell-cycle arrest in late G2 phase at the nonpermissive temperature of 37°C, owing to instability of the mutated S. pombe Cdc2 (28). P. carinii cdc2 cDNA was excised from pCRII by digestion with NdeI and BamHI, and was directionally subcloned into the yeast expression vector pREP41. The pREP41 plasmid has a leu2 gene, permitting growth of transformants on media lacking leucine, and an S. pombe nmt1 promoter, which is derepressed (i.e., expressed) in the absence of thiamine (26, 27). S. pombe temperature-sensitive cdc2 mutants were grown to mid-log phase in yeast extract culture (YES) medium at 30°C (OD at 595 nm = 0.5), and were transformed by electroporation (36) with 1 µg of pREP41/PCcdc2cDNA, or 1 µg pREP41 vector alone without insert, or 1 µg of the wild-type S. pombe cdc2 cloned into the pIRT2 vector. Transformants were plated on leucine- and thiamine-deficient plates at 30°C and 37°C, and assessed for their ability to proliferate. Transformed yeast colonies growing on leucine- and thiamine-deficient plates at 37°C were cultured to mid-log phase in leucine- and thiamine-deficient broth, and plasmid DNA was extracted and sequenced to confirm the presence of P. carinii cdc2. Additional incubations of the transformants were also done in the presence of thiamine (10 µM), which represses the pREP41 nmt promoter and hence inhibits expression of P. carinii cdc2 cDNA.

    Results
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

P. carinii Contains a Cdc2-like Molecule with Protein Kinase Activity

To intially determine whether P. carinii exhibits a Cdc2-like molecule, P. carinii extracts were immunoprecipitated with antibody to the PSTAIR amino-acid sequence conserved in Cdc2 proteins, and these precipitates were reacted with [gamma -32P]ATP and histone H1 as substrate (Figure 1). Immunoprecipitates of purified P. carinii extracts produced with anti-PSTAIR antibodies (lanes A through C), but not with non-immune rabbit IgG (lanes D through F ), showed consistent protein kinase activity, as evidenced by their ability to phosphorylate histone H1. In addition, preincubation of anti-PSTAIR antibody with the cognate peptide antigen completely inhibited precipitation of this protein kinase activity from P. carinii extracts (lane G). These findings strongly suggest that P. carinii possesses a Cdc2-like molecule containing a conserved PSTAIR amino-acid sequence and exhibiting usual protein kinase activity. It should be noted that the PSTAIR motif may be found in other cyclin-dependent kinases (cdks). In almost all fungal systems studied, Cdc2 is the predominant or only cdk present (37). Consequently, we assert that the activity precipitated from the P. carinii extracts is largely related to P. carinii Cdc2. However, it remains possible that small amounts of other P. carinii molecules may coprecipitate along with Cdc2 upon exposure to antibodies to PSTAIR. For this reason, we have termed this activity "Cdc2-like" activity.


View larger version (14K):
[in this window]
[in a new window]
 
Figure 1.   P. carinii contains a Cdc2-like molecule with protein kinase activity. Shown is H1 histone phosphorylated with immunoprecipitated Cdc2-like proteins in the presence of [gamma -32P]ATP. P. carinii were isolated from infected rat lung by filtration through a 10-µM filter. To ensure that the observed protein kinase activity was from P. carinii and not the result of host-cell contamination, equal volumes of uninfected rat lung were identically filtered and the filtrate was extracted. The P. carinii and control lung extracts were immunoprecipitated with anti-PSTAIR antibody (50 µg/ ml). The resulting precipitates were reacted with H1 histone in the presence of [gamma -32P]ATP. Lanes A through C: Increasing amounts of H1 histone reaction products demonstrate that P. carinii contains a Cdc2-like protein kinase capable of catalyzing H1 histone phosphorylation (5 µl, 10 µl, and 30 µl of reaction product, respectively). Lanes D through F: Nonimmune IgG (50 µg/ml) immunoprecipitates of P. carinii extract exhibit minimal kinase activity (identical quantities as lanes A through C). Lane G: Preincubation of the anti-PSTAIR antibody with the cognate peptide completely inhibited immunoprecipitation of Cdc2-like protein kinase activity from P. carinii extracts (45 µl of reaction product). Lanes H through J: Minimal host-cell protein kinase activity from uninfected rat lung was present after filtration through a 10-µM filter, extraction, and immunoprecipitation with anti-PSTAIR antibody (identical quantities to those in lanes A through C ). Thus, the kinase activities observed for the P. carinii extracts in lanes A through C are related to the organisms and are not the result of residual host cells passing through the filter during the purification. Lanes K through M: Nonimmune IgG immunoprecipitates of uninfected lung extracts also had minimal kinase activity (same quantities as in lanes A through C ).

Since P. carinii cannot be routinely propagated in articifial media, studies such as those described here must utilize P. carinii derived from infected rats. Therefore, exhaustive controls were used to verify that the observed Cdc2-like protein kinase activity was derived from P. carinii and was not due to rat cellular contamination. To accomplish this, lungs from uninfected rats housed separately from P. carinii-infected animals were homogenized and filtered, and the filtrates were lysed in a manner identical to that with P. carinii-infected rats. These extracts were then analyzed through immunoprecipitation and protein kinase assay (Figure 1, lanes H through M). Uninfected rat lung processed in an identical manner failed to demonstrate any residual protein kinase activity after filtration through the 10-µM filter, extraction, and immunoprecipitation with anti-PSTAIR antibody. Because Cdc2-like proteins are intracellular proteins, and because rat Cdc2 contains a PSTAIR sequence that would have been recognized by the antibody used, these controls verify that the 10-µM filter purification procedure effectively eliminates rat host cells from the final products. Therefore, we assert that the protein kinase activity derived from the P. carinii extracts (lanes A through C ) is related to a P. carinii Cdc2-like activity, and is not the result of residual rat host cell contamination.

The Activity of the P. carinii Cdc2-like Protein Kinase is Differentially Regulated Throughout the Life Cycle

To evaluate whether Cdc2-like protein kinase activity was differentially regulated throughout the life cycle of P. carinii, the relative specific activity of the Cdc2-like protein kinase was determined in protein extracts obtained from enriched P. carinii spore cases and trophic forms. In order to normalize the amount of Cdc2-like activity in different forms of P. carinii, the kinase assays were performed on equal quantities of extracted cytoplasmic proteins. This is necessary, since the trophic forms of P. carinii are only 1 to 2 µ in diameter, whereas spore-case forms are 8 to 10 µ in diameter. Consequently, cellular volume is widely different between these two forms of the organism, rendering it problematic to compare the amount of Cdc2 activity on a "per organism" basis. Normalizing Cdc2-like activity to total extraced protein provides a relative estimate of Cdc2-specific activity as a function of the available cytoplasmic protein from each life form. With the method that we used, separated P. carinii trophic forms and spore-case forms exhibited substantial differences in Cdc2-like protein kinase activity (Figure 2). P. carinii trophic forms consistently exhibited greater total Cdc2-like specific activity than did extracts prepared from spore-case forms (3.8 ± 0.9-fold greater specific activity [mean ± SEM] for trophic forms than for spore-case forms, P = 0.037). These findings suggest differential specific activity of the Cdc2-like protein over the life cycle of P. carinii, further supporting a potential role for Cdc2 in cell-cycle progression of this organism.


View larger version (78K):
[in this window]
[in a new window]
 
Figure 2.   P. carinii trophic forms exhibit substantially greater Cdc2-like protein kinase activity than do spore-case forms. To determine whether Cdc2 activity was regulated over the life cycle of the organism, P. carinii trophic forms and spore-case forms were separated by differential filtration and lysed, and equal amounts of extracted proteins (550 µg each) were assayed for Cdc2-like protein kinase activity following immunoprecipitation with anti-PSTAIR antibody and using histone H1 as substrate. (A) P. carinii trophic forms exhibit substantial Cdc2-like protein kinase activity, as evidenced by substantial phosphorylation of histone H1 (at ~ 30 kDa). (B) Spore-case-form extracts also exhibit histone H1 kinase activity, but at a significantly lower level than that observed for the trophic-form extracts.

Characterization of the P. carinii cdc2 Genomic and cDNA Sequences

Ultimate verification that P. carinii contains a unique Cdc2 protein requires molecular cloning of a cognate gene of P. carinii origin. Therefore, a complete gene encoding the P. carinii Cdc2 protein was cloned, using several methods (Figures 3a through 3c). First, a partial 123-bp clone specific for P. carinii cdc2 was obtained through PCR amplification of P. carinii genomic DNA, using degenerate oligonucleotide primers derived from conserved amino-acid sequences of Cdc2 proteins from S. pombe and other fungi. To limit the degree of degeneracy in the third position of each codon, the adenine + thymine (A+T)-rich (> 65%) coding bias of P. carinii was incorporated into the design of the oligonucleotide primers (38). The 123-bp amplification product was found to be unique on GenBank analysis, but homologous to corresponding cdc2 sequences from other fungi. To further confirm that the PCR product was specifically represented within the P. carinii genome, hybridization of this 123-bp amplicon was performed under high-stringency conditions, using a CHEF nitrocellulose blot of P. carinii chromosomal DNA. The 123-bp amplicon consistently hybridized to a single location, suggesting that P. carinii cdc2 is represented on a single chromosome within the organism (Figure 3c). All known cdc2 genes have similarly been reported to be single-copy genes (39). The hybridization of our PCR product to a unique P. carinii chromosome further indicates that this amplicon was not the result of amplifying sequences obtained from the host or from some other contaminating organism.


View larger version (79K):
[in this window]
[in a new window]
 


View larger version (9K):
[in this window]
[in a new window]
 


View larger version (116K):
[in this window]
[in a new window]
 
Figure 3.   Characterization of the P. carinii cdc2 gene. (a) Nucleotide and predicted amino-acid sequence of P. carinii cdc2. Shown in upper-case are seven exons determined by comparison of the genomic and cDNA clones. The intron 5' donor and 3' acceptor splice sites are underlined. (b) The P. carinii cdc2 genomic clone was sequenced with overlapping primers as shown. Seven exons (boxed) were predicted. (c) The 123-bp P. carinii cdc2 probe obtained through PCR was hybridized to a single P. carinii chromosome under high-stringency conditions. Lane 1 is a lambda DNA ladder, lanes 3 through 6 are P. carinii chromosomes resolved by CHEF. (These sequence data are available from Genbank under accession number AF026546.)

Using the 123-bp amplicon as a probe, a 2.7-kb full length genomic P. carinii cdc2 clone was obtained by screening a rat-derived P. carinii sp. f. carinii lambda gt11 genomic library. In addition, a complete cDNA for P. carinii cdc2 was generated by reverse transcription of P. carinii RNA, followed by PCR amplification employing oligonucleotide primers predicted from the 5' and 3' ends of the genomic coding sequences. Comparison of the genomic and cDNA sequences indicated that the P. carinii cdc2 gene comprises seven exons and six introns, which contain an open reading frame encoding 300 amino acids. The molecular mass predicted from this sequence was 34,430 Daltons. The genomic and cDNA sequences contained regions encoding the conserved PSTAIR domain within exon 2, further confirming the validity of our studies with the polyclonal anti-PSTAIR antibody for detecting immunoreactive P. carinii Cdc2.

Comparison of the complete P. carinii cdc2 gene with the GenBank sequence data base revealed this gene to be unique. The closest homology detected at the nucleotide level (BlastN comparison) was with Candida albicans (72% identity), at the amino acid level (BlastP) with Ajellomyces capsulatum (formerly known as Histoplasma capsulatum; 78% identity), and, following translation into six reading frames (BlastX analysis) with Oryza sativa (rice; 61% identity) (Figure 4a). Variations in proteins derived from P. carinii organisms of different sources have been previously reported, and currently represent an area of active research (32). A 6.3% discrepancy in nucleotide sequence was observed when the genomic clone derived from the University of Cincinnati library was compared with the cDNA sequence generated from P. carinii RNA obtained from our rat colony housed in Rochester, MN (Figure 4b). These minor differences between the genomic and the cDNA P. carinii cdc2 sequences probably represent variations in the P. carinii sources. As previously noted for other P. carinii genes, these differences may well represent species differences rather than simple strain variations of the sources (40). The genomic sequences were derived from the species P. carinii sp. f. carinii, as defined by electrophoretic karyotype (23). Electrophoretic karyotype speciation of the Rochester P. carinii colony source from which the cDNA was derived is not currently available. That the amino-acid sequence of the genomic and cDNA are virtually identical, with only one amino acid substitution, speaks strongly for the Cdc2 cDNA being of P. carinii origin (Figure 4). Because Cdc2 is an essential protein regulating the cell cycle, it would be anticipated that functionally important amino-acid sequences would be conserved among different P. carinii species. Although it is possible that taq-related replication errors might have been introduced into the cDNA sequence, we believe that this is rather unlikely, since nearly all differences were associated with conserved protein sequences when comparisons were made with the genomic sequences obtained by library screening. A single amino-acid substitution of isoleucine for leucine was detected near the carboxy terminus of the molecule, in a region not generally associated with enzymatic activity. Thus, different distinct isolates of P. carinii, from independent rat-colony sources, contain a Cdc2 molecule whose protein sequences are nearly completely conserved. Furthermore, these P. carinii Cdc2 molecules are homologous to Cdc2 proteins from other pathogenic fungi.


View larger version (62K):
[in this window]
[in a new window]
 


View larger version (51K):
[in this window]
[in a new window]
 
Figure 4.   (a) Comparisons of the predicted P. carinii Cdc2 amino-acid sequence with sequences of other eukaryotic Cdc2 proteins. Amino-acid alignments are as follows: Pc, P. carinii; Ca, Candida albicans; Sc, Saccharomyces cerevisiae; Ac, Ajellomyces capsulatum; En, Emericella nidulans; Sp, Schizosaccharomyces pombe; Rn, Rattus norvegicus; Hs, Homo sapiens; Os, Oryza sativa. Boldface type indicates the conserved ATP-binding and PSTAIRE sites from which the degenerate PCR primers were derived. Periods are used to maximize alignment. (b) Comparison of the P. carinii Cdc2 protein sequences predicted from the genomic and cDNA clones. The P. carinii cdc2 cDNA was compared with the genomic cdc2 sequence following deletion of the introns to maximize alignment. Lower-case boldface characters represent nucleotide mismatches. The upper-case boldface L represents a leucine residue from in the genomic clone that corresponds to an isoleucine in P. carinii cdc2 cDNA. (These sequence data are available from Genbank under accession number AF026545.)

P. carinii cdc2 cDNA Can Functionally Rescue S. pombe Strains Containing Temperature-sensitive Mutations of S. pombe Cdc2 and Thereby Permit Fungal Proliferation

Having isolated the P. carinii cdc2 gene and cDNA, we performed subsequent studies to confirm its function in cell-cycle progression. Since P. carinii cannot be routinely cultured, conventional studies for assessing the activity of cdc2 in P. carinii proliferation are difficult. To circumvent this problem, we exploited the functional conservation of Cdc2 kinase activity in fungi, which allows them to complement Cdc2-deficient hosts (20, 21). Through this approach, we assessed the biologic activity of P. carinii Cdc2 for its ability to complement S. pombe mutants exhibiting temperature-sensitive deficiencies in Cdc2 activity (Figure 5). These S. pombe mutants grow at the permissive temperature of 30°C, but fail to enter mitosis and undergo cell-cycle arrest in late G2 at the nonpermissive temperature of 37°C, owing to thermal instability of the mutated S. pombe Cdc2 protein (28). P. carinii cdc2 cDNA was subcloned in the episomal S. pombe expression vector pREP41 (26, 27). Colonies of S. pombe mutants expressing temperature-sensitive Cdc2 were transformed with P. carinii cdc2 in the pREP41 vector, and were isolated through their ability to proliferate at 37°C on plates lacking both leucine and thiamine. Thus, P. carinii cdc2 cDNA was able to rescue and permit proliferation of mutant S. pombe exhibiting temperature-sensitive deficiencies in S. pombe Cdc2 activity under the nonpermissive temperature conditions at 37°C. Isolated colonies were propagated through five generations of growth at the nonpermissive 37°C temperature. Plasmid DNA from P. carinii cdc2-complemented colonies was isolated in order to verify the presence of the P. carinii cdc2 gene in transformants growing at 37°C. S. pombe mutants expressing temperature-sensitive Cdc2 transformed with the pREP41 vector alone failed to grow at the nonpermissive temperature of 37°C. However, mutant S. pombe transformed with the wild-type S. pombe cdc2 gene in the pIRT2 vector also exhibited normal growth at 37°C. It was further observed that addition of thiamine, which represses expression of the pREP41 plasmid, resulted in complete suppression of growth of the S. pombe mutants transformed with P. carinii cdc2 at the non-permissive 37°C temperature. Thus, the P. carinii cdc2 cDNA encodes a fully functional Cdc2 protein that can complement and support the growth of S. pombe mutants with temperature-sensitive deficiencies in Cdc2 even under nonpermissive growth conditions. These data strongly confirm that P. carinii cdc2 is active in promoting fungal-cell-cycle completion.


View larger version (142K):
[in this window]
[in a new window]
 
Figure 5.   P. carinii cdc2 can functionally complement the DNA of S. pombe strains that contain temperature-sensitive mutations of Cdc2, permitting cell-cycle completion and proliferation. The orientations of S. pombe streaks are the same on all plates. 1. S. pombe mutants expressing temperature-sensitive Cdc2 transformed with P. carinii cdc2 cDNA cloned into pREP41 (clone 14). 2. S. pombe mutants transformed with pREP41 vector alone. 3. S. pombe mutants transformed with the pIRT2 vector containing wild-type S. pombe cdc2. (A) Plates incubated at the permissive temperature of 30°C in the absence of thiamine show normal growth of all S. pombe mutants after transformation with these plasmids. (B) Incubation at 30°C in the presence of thiamine (10 µM) also demonstrates normal growth of these S. pombe mutants, verifying that thiamine is not toxic at this concentration. (C) Identical plates at 37°C in the absence of thiamine reveal no growth of S. pombe mutants expressing temperature-sensitive Cdc2 transformed with pREP41 vector alone at the nonpermissive temperature conditions. However, normal growth of the S. pombe mutants occurs in yeast transformed with P. carinii cdc2 cDNA and in organisms transformed with pIRT2 containing wild-type S. pombe cdc2. (D) Incubation of plates at 37°C in the presence of thiamine demonstrates that repression of P. carinii cdc2 results in no growth at the nonpermissive temperature. Therefore, P. carinii Cdc2 is functional and permits cell-cycle completion and proliferation of the fungus even under the nonpermissive temperature conditions.

    Discussion
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

We demonstrated that P. carinii extracts contain a molecule with protein kinase activity that is detectable with antibodies to the conserved PSTAIR amino-acid sequence found in Cdc2 proteins from closely related fungi such as S. pombe. Furthermore, the specific protein kinase activity of P. carinii Cdc2 was observed to be greater in trophic forms than in P. carinii spore cases, suggesting that Cdc2 activity is differentially regulated throughout the organism's life cycle. We have additionally cloned genomic and cDNA sequences related to this protein, demonstrating that the P. carinii cdc2 gene encodes a unique product, homologous to Cdc2 in related fungi, and containing the conserved PSTAIR sequence. We further demonstrate that the P. carinii cdc2 cDNA produces a completely functional Cdc2 protein capable of promoting cell-cycle completion and proliferation of mutant strains of S. pombe that exhibit deficiencies of S. pombe Cdc2 under nonpermissive temperature conditions. Together, these observations strongly suggest a central role for P. carinii Cdc2 in control of the life cycle and proliferation of this important opportunistic fungus.

The orderly progression of the eukaryotic cell cycle is precisely regulated by a number of cell-division-cycle (cdc) control proteins (20, 21, 28). Much of what has been learned of eukaryotic cell-cycle control in species as diverse as fungi and upper eukaryotes has been learned by studying cdc mutants of yeasts, particularly S. pombe, an easily culturable organism with phylogenetic similarity to P. carinii. Studies of the cdc mutants have led to the identification of a number of critical growth regulatory genes in fungi (21, 28). Of particular importance is the cdc2 gene, the product of which has been termed Cdc2 (also referred to as p34cdc2), a serine-threonine protein kinase required for traverse from the G2 to the M phase and for entry into the S phase from the G1 phase of the cell cycle, at a point known as START in these yeasts (20 , 21). The level of expression of Cdc2 protein is generally constituitive throughout most eukaryotic cell cycles, with the relative kinase activity of Cdc2 being controlled over the cell cycle through a number of positively and negatively acting signals. Activation of S. pombe Cdc2 kinase requires association with a regulatory cyclin molecule and both the removal of negatively acting phosphorylations (e.g., tyr 15) and addition of positively acting phosphorylations (e.g., thr 161/167) (21). In the current study, we found that Cdc2-specific activity was greater in trophic forms than in spore-case forms of P. carinii, suggesting that Cdc2 activity is regulated over the life cycle of P. carinii. Further studies will be required to fully understand the mechanisms of control of P. carinii Cdc2 expression and activity.

The P. carinii genomic and cDNA sequences were most homologous to those of other pathogenic fungi including Candida albicans and Ajellomyces (Histoplasma) capsulatum. The current study therefore provides further evidence that P. carinii is substantially more closely related to the eukaryotic fungi than to protozoal parasites. In contrast to our findings with P. carinii, a recently identified gene for a Cdc2-like protein from the protozoan Plasmodium falciparum failed to complement Cdc2/28-deficient yeast (43). Additional studies of coding sequences for P. carinii ribosomal RNA further corroborate the assertion that P. carinii is most appropriately classified as a fungus (6, 7, 9, 10).

The inability to continously culture P. carinii under cell-free conditions has perennially hindered basic investigations of P. carinii biology. Recent studies indicate that the organism can proliferate to a limited degree when placed on feeder cell monolayers, and that attachment of P. carinii organisms to host cells promotes proliferation of P. carinii in vitro (5, 18, 19). Although we cannot routinely culture P. carinii, we further demonstrate that analysis of regulatory elements controlling the life cycle of P. carinii can proceed through transfer of P. carinii genes into susceptible S. pombe, an easily manipulated host organism. Enhanced understanding of the P. carinii life cycle gained through such studies may eventually yield important insights for culture of this elusive parasite.

The observations in the present study support the concept that P. carinii does possess and utilize a cyclin/cdk cell-cycle-regulatory system. Accordingly, much of the extensive knowledge originally gleaned from investigations of S. pombe may be used as a starting point from which to dissect the nature of life-cycle control in P. carinii. It should be cautioned, however, that although homologous cell-cycle-control proteins may be present in related fungi, the general life cycle structure and precise mechanisms of molecular control may differ in important ways even among related species. For instance, under routine culture conditions, the fission yeast S. pombe is predominantly present in a haploid state, whereas the budding yeast S. cerevisiae is diploid (44, 45). Furthermore, Cdc2 from S. pombe and the functional Cdc2 homologue from S. cerevisiae, termed Cdc28, utilize entirely different nonconserved molecules to effect the essential positive phosphorylations that activate these protein kinases (46). Accordingly, further studies of P. carinii Cdc2 activation will be necessary to fully understand Cdc2 function in this organism. Such studies may also provide additional important clues toward understanding the phylogenetic relatedness of P. carinii to these other fungi.

Does enhanced understanding of the P. carinii life cycle hold significant promise for improved methods to stop this important cause of pneumonia? Although Cdc2 antagonists have not yet been applied to infectious diseases, small inhibitors of mammalian cdks and Cdc2 are currently being investigated for their potential activity as antineoplastic agents (47, 48). Increased understanding of structural and functional differences between Cdc2 and related cdks in humans and in P. carinii may well reveal interesting molecular targets for future therapeutic investigations.

We believe that characterization of P. carinii Cdc2 represents an essential first step in understanding molecular control of the life cycle of P. carinii. Our investigation indicates that P. carinii contains cell-cycle-control elements parallel to those found in closely related fungi, and further predicts that the extensive knowlege of fungal cell-cycle control may be applied, at least in part, to understanding the life-cycle regulation of P. carinii. Further studies of P. carinii Cdc2 activity and regulatory mechanisms should yield important new insights for the identification and destruction of this significant cause of morbidity and mortality in patients with AIDS.

    Footnotes

Address correspondence to: Dr. Andrew Limper, Thoracic Diseases Research Unit, 601C Guggenheim Building, Mayo Clinic and Foundation, Rochester, MN 55905. E-mail: limper.andrew{at}mayo.edu

(Received in original form August 4, 1997 and in revised form December 29, 1997).

Acknowledgments: This work was supported by Grants R29-AI34336-05, R01-HL55934-03, and R01-HL57125-02 from the National Institutes of Health. Dr. Thomas was a Glaxo Pulmonary fellowship award recipient during these investigations. The authors thank Dr. Melanie T. Cushion of the University of Cincinnati College of Medicine for providing the CHEF nitrocellulose membrane and corresponding photograph of the ethidium bromide-stained gel, Dr. James R. Stringer of the University of Cincinnati College of Medicine for the rat-derived P. carinii genomic DNA library in the bacteriophage lambda gt11, and Dr. Kathy Gould of Vanderbilt University for temperature-sensitive S. pombe cdc2 mutants, the pREP41 vector, and the pIRT2 plasmid containing wild-type S. pombe cdc2. In addition, they thank Mrs. Kathy Stanke for her assistance in the final preparation of this manuscript.

Abbreviations AIDS, acquired immunodeficiency syndrome; cdc, cell-division cycle molecule; Cdc2, cyclin-dependent serine-threonine kinase encoded by the eukaroyotic cdc2 gene (also referred to as p34cdc2); gpA, glycoprotein A surface antigenic complex of P. carinii; PSTAIR, conserved proline-serine-threonine-alanine-isoleucine-arginine amino-acid motif conserved in cdc2 molecules ; SEM, standard error of the mean.

    References
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Limper, A. H., K. P. Offord, T. F. Smith, and W. J. Martin. 1989. Pneumocystis carinii pneumonia: differences in lung parasite number and inflammation in patients with and without AIDS. Am. Rev. Respir. Dis. 140: 1204-1209 [Medline].

2. Safrin, S.. 1993. Pneumocystis carinii pneumonia in patients with the acquired immunodeficiency syndrome. Semin. Respir. Infect. 8: 96-103 [Medline].

3. Yale, S. H., and A. H. Limper. 1996. Pneumocystis carinii pneumonia in patients without acquired immunodeficiency syndrome: associated disorders and prior corticosteroid therapy. Mayo Clin. Proc. 71: 5-13 [Abstract].

4. Kovacs, J. A., J. W. Hiemenz, A. M. Macher, D. Stover, H. W. Murray, J. Shelhamer, H. C. Lane, C. Urmacher, C. Honig, and D. L. Longo. 1984. Pneumocystis carinii pneumonia: a comparison between patients with the acquired immunodeficiency syndrome and patients with other immunodeficiencies. Ann. Intern. Med. 100: 663-671 .

5. Sloand, E., B. Laughon, M. Armstrong, M. S. Bartlett, W. Blumenfeld, M. Cushion, A. Kalica, J. A. Kovacs, W. J. Martin, and E. Pitt. 1993. The challenge of Pneumocystis carinii culture. J. Eukaryot. Microbiol. 40: 188-195 [Medline].

6. Edman, J. C., J. A. Kovacs, H. Masur, D. V. Santi, H. J. Elwood, and M. L. Sogin. 1988. Ribosomal RNA sequence shows that Pneumocystis carinii to be a member of the fungi. Nature 334: 519-522 [Medline].

7. Limper, A. H.. 1991. Parasite adherence and host responses in the development of Pneumocystis carinii pneumonia. Semin. Respir. Infect. 6: 19-26 [Medline].

8. Gargas, A., P. T. DePriest, M. Grube, and A. Tehler. 1995. Multiple origins of lichen symbioses in fungi suggested by SSU rDNA phylogeny. Science 30; 268:1492-1495.

9. Van Der Peer, Y., L. Hendriks, and A. Goris. 1992. Evolution of basidiomycetous yeasts as deduced from small ribosomal subunit RNA sequences. System Appl. Microbiol. 15: 250-258 .

10. Bruns, T. D., R. Vilgalys, S. M. Barns, D. Gonzalez, D. S. Hibbett, D. J. Lane, L. Simon, S. Stickel, T. M. Szaro, and W. G. Weisburg. 1992. Evolutionary relationships within the fungi: analyses of nuclear small subunit rRNA sequences. Mol. Phylogenet. Evol. 1: 231-241 [Medline].

11. Ruffolo, J. J. 1994. Pneumocystis carinii cell structures. In Pneumocystis carinii Pneumonitis, 2nd ed. P. D. Walzer, editor. Marcel Dekker, New York. 25-43.

12. Cushion, M. T., P. D. Walzer, A. G. Smulian, M. J. Linke, J. J. Ruffolo, E. S. Kaneshiro, and J. R. Stringer. 1997. Terminology for the life cycle of Pneumocystis carinii. Infect. Immun. 65: 4365 [Medline].

13. Campbell, W. G.. 1972. Ultrastructure of Pneumocystis in human lung. Arch. Pathol. 93: 312-330 [Medline].

14. Itatani, C. A., and J. Marshall. 1988. Ultrastructural morphology and staining characteristics of Pneumocystis carinii in situ and from bronchoalveolar lavage. J. Parasitol. 74: 700-712 [Medline].

15. Long, E. G., J. S. Smith, and J. L. Meier. 1986. Attachment of pneumocystis carinii to rat pneumocytes. Lab. Invest. 54: 609-615 [Medline].

16. Limper, A. H., and W. J. Martin. 1990. Pneumocystis carinii: inhibition of lung cell growth mediated by parasite attachment. J. Clin. Invest. 85: 391-396 .

17. Anders, R. A., M. Gustafson, M. Edens, A. H. Limper, and E. B. Leof. 1996. Pneumocystis carinii modulates cyclin-dependant kinase activity in a lung epithelial cell line. J. Eukaryot. Microbiol 43: 13S [Medline].

18. Limper, A. H., C. F. Thomas, R. A. Anders, and E. B. Leof. 1997. Interactions of parasite and host epithelial cell cycle regulation during Pneumocystis carinii pneumonia. J. Lab. Clin. Med 130: 132-138 [Medline].

19. Limper, A. H., J. E. Standing, and E. B. Leof. 1995. Pneumocystis carinii adherence to alveolar epithelial cells promotes organism proliferation. J. Invest. Med. 43: 466A . (Abstr.) .

20. Nurse, P.. 1990. Universal control mechanism regulating onset of M-phase. Nature 344: 503-508 [Medline].

21. Fleig, U. N., and K. L. Gould. 1991. Regulation of cdc2 activity in Schizosaccharomyces pombe: the role of phosphorylation. Semin. Cell Biol. 2: 195-204 [Medline].

22. Thomas, C. F., M. Gustafson, Z. Vuk, Pavlovic, E. B. Leof, and A. H. Limper. 1996. Identification of a cell division cycle (cdc2) homologue in Pneumocystis carinii. J. Eukaryot. Microbiol. 43: S11 .

23. Sunkin, S. M., and J. R. Stringer. 1995. Transcription factor genes from rat Pneumocystis carinii. J. Eukaryot. Microbiol. 42: 12-19 [Medline].

24. Cushion, M. T., M. Kaselis, S. L. Stringer, and J. R. Stringer. 1993. Genetic stability and diversity of Pneumocystis carinii infecting rat colonies. Infect. Immun. 61: 4801-4813 [Abstract/Free Full Text].

25. Osmani, A. H., N. van Peij, M. Mischke, M. J. O'Connell, and S. A. Osmani. 1994. A single p34cdc2 protein kinase (encoded by nimXcdc2) is required at G1 and G2 in Aspergillus nidulans. J. Cell Sci. 107: 1519-1528 [Abstract].

26. Maundrell, K.. 1993. Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene 123: 127-130 [Medline].

27. Basi, G., E. Schmid, and K. Maundrell. 1993. TATA box mutations in the Schizosaccharomyces pombe nmt1 promoter affect transcription efficiency but not the transcription start point or thiamine repressibility. Gene 123: 131-136 [Medline].

28. Hindley, J., G. Phear, M. Stein, and D. Beach. 1987. Sucl+ encodes a predicted 13-kilodalton protein that is essential for cell viability and is directly involved in the division cycle of Schizosaccharomyces pombe. Mol. Cell. Biol. 7: 504-511 [Abstract/Free Full Text].

29. Bartlett, M. S., J. A. Fishman, S. A. Queener, M. M. Durkin, M. A. Jay, and J. W. Smith. 1988. New rat model of Pneumocystis carinii pneumonia. J. Clin. Microbiol. 26: 1100-1102 [Abstract/Free Full Text].

30. O'Riordan, D. M., J. E. Standing, K. Y. Kwon, D. Chang, E. C. Crouch, and A. H. Limper. 1995. Surfactant protein D interacts with Pneumocystis carinii and mediates organism adherence to macrophages. J. Clin. Invest. 95: 2699-2710 .

31. Durkin, M. E., M. M. Shaw, M. S. Bartlett, and J. W. Smith. 1991. Culture and filtration methods for obtaining Pneumocystis carinii trophozoites and cysts. J. Protozool. 38: 210-212 .

32. Cushion, M. T., J. Zhang, M. Kaselis, D. Giuntoli, S. L. Stringer, and J. R. Stringer. 1993. Evidence for two genetic variants of Pneumocystis carinii coinfecting laboratory rats. J. Clin. Microbiol. 31: 1217-1223 [Abstract/Free Full Text].

33. Stringer, J. R.. 1993. The identity of Pneumocystis carinii: not a single protozoan, but a diverse group of exotic fungi. Infect. Agents Dis. 2: 109-117 [Medline].

34. Stringer, J. R., S. L. Stringer, J. Zhang, R. Baughman, A. G. Smulian, and M. T. Cushion. 1993. Molecular genetic distinction of Pneumocystis carinii from rats and humans. J. Eukaryot. Microbiol. 40: 733-741 [Medline].

35. Hong, S. T., P. E. Steele, M. T. Cushion, P. D. Walzer, S. L. Stringer, and J. R. Stringer. 1990. Pneumocystis carinii karyotypes. J. Clin. Microbiol. 28: 1785-1795 [Abstract/Free Full Text].

36. Prentice, H. L.. 1992. High efficiency transformation of Schizosaccharomyces pombe by electroporation. Nucl. Acids Res. 20: 621 [Free Full Text].

37. Carr, A. M.. 1995. DNA structure checkpoints in fission yeast. Semin. Cell Biol. 6: 65-72 [Medline].

38. Fletcher, L. D., L. C. Berger, R. R. Tidwell, and C. C. Dykstra. 1993. Cloning and characterization of the calmodulin-encoding gene from Pneumocystis carinii. Gene 129: 307-308 [Medline].

39. Pines, J.. 1994. The cell cycle kinases. Semin. Cancer Biol. 5: 305-313 [Medline].

40. Keely, S. P., M. T. Cushion, and J. R. Stringer. 1996. Stability of four genetic loci in Pneumocystis carinii sp. f. carinii. J. Eukaryot. Microbiol. 43: 49S [Medline].

41. Smulian, A. G., M. Ryan, C. Staben, and M. Cushion. 1996. Signal transduction in Pneumocystis carinii: characterization of the genes (pcg1) encoding the alpha subunit of the G protein (PCG1) of Pneumocystis carinii carinii and Pneumocystis carinii ratti. Infect. Immun 64: 691-701 [Abstract].

42. Stringer, J. R., and P. D. Walzer. 1996. Molecular biology and epidemiology of Pneumocystis carinii infection in AIDS. AIDS 10: 561-571 [Medline].

43. Ross-McDonald, P. B., R. Graeser, B. Kappes, R. Franklin, and D. H. Williamson. 1994. Isolation and expression of a gene specifying a cdc2-like protein kinase from the human malaria parasite Plasmodium falciparum. Eur. J. Biochem. 220: 693-701 [Medline].

44. MacNiell, S. A., and P. A. Fantes. 1995. Controlling entry into mitosis in fission yeast. In Cell Cycle Control. C. Hutchison and D. M. Glover, editors. IRL Press at Oxford University Press, Oxford. 63-105.

45. Reed, S. I. 1995. START and the G1-S phase transition in budding yeast. In Cell Cycle Control. C. Hutchison and D. M. Glover, editors. IRL Press at Oxford University Press, Oxford. 40-62.

46. Espinoza, F. H., A. Farrell, H. Erdjument-Bromage, P. Tempst, and D. Morgan. 1996. A cyclin dependent kinase-activating kinase (CAK) in budding yeast unrelated to vertebrate CAK. Science 273: 1714-1717 [Abstract/Free Full Text].

47. Filguerira De Azevedo, W., H.-J. Mueller-Dieckmann, U. Schulze-Gahmen, P. J. Worland, E. Sausville, and S.-H. Kim. 1996. Structural basis for specificity and potency and a flavinoid inhibitor of human CDK2, a cell cycle kinase. Proc. Natl. Acad. Sci. USA 93: 2735-2740 [Abstract/Free Full Text].

48. Meijer, L.. 1996. Chemical inhibitors of cyclin-dependent kinases. Trends Cell. Biol. 6: 393-397 .


[Medline]



This article has been cited by other articles:


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. W. Burgess, T. J. Kottom, L. R. Villegas, J. D. Lamont, E. M. Baden, M. Ramirez-Alvarado, and A. H. Limper
The Pneumocystis Meiotic PCRan1p Kinase Exhibits Unique Temperature-Regulated Activity
Am. J. Respir. Cell Mol. Biol., December 1, 2009; 41(6): 714 - 721.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
C. C. Kennedy, T. J. Kottom, and A. H. Limper
Characterization of a Novel ADAM Protease Expressed by Pneumocystis carinii
Infect. Immun., August 1, 2009; 77(8): 3328 - 3336.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. W. Burgess, T. J. Kottom, and A. H. Limper
Pneumocystis carinii Exhibits a Conserved Meiotic Control Pathway
Infect. Immun., January 1, 2008; 76(1): 417 - 425.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
L. Huang, A. Morris, A. H. Limper, J. M. Beck, and on behalf of the ATS Pneumocystis Workshop Partici
An Official ATS Workshop Summary: Recent Advances and Future Directions in Pneumocystis Pneumonia (PCP)
Proceedings of the ATS, November 1, 2006; 3(8): 655 - 664.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
T. J. Kottom and A. H. Limper
Pneumocystis carinii Cell Wall Biosynthesis Kinase Gene CBK1 Is an Environmentally Responsive Gene That Complements Cell Wall Defects of cbk-Deficient Yeast
Infect. Immun., August 1, 2004; 72(8): 4628 - 4636.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
C. F. Thomas Jr. and A. H. Limper
Pneumocystis Pneumonia
N. Engl. J. Med., June 10, 2004; 350(24): 2487 - 2498.
[Full Text] [PDF]


Home page
Infect. Immun.Home page
T. J. Kottom, J. R. Kohler, C. F. Thomas Jr., G. R. Fink, and A. H. Limper
Lung Epithelial Cells and Extracellular Matrix Components Induce Expression of Pneumocystis carinii STE20, a Gene Complementing the Mating and Pseudohyphal Growth Defects of ste20 Mutant Yeast
Infect. Immun., November 1, 2003; 71(11): 6463 - 6471.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
I. J. Morales, P. K. Vohra, V. Puri, T. J. Kottom, A. H. Limper, and C. F. Thomas Jr.
Characterization of a Lanosterol 14{alpha}-Demethylase from Pneumocystis carinii
Am. J. Respir. Cell Mol. Biol., August 1, 2003; 29(2): 232 - 238.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S.-J. Yong, Z. Vuk-Pavlovic, J. E. Standing, E. C. Crouch, and A. H. Limper
Surfactant Protein D-Mediated Aggregation of Pneumocystis carinii Impairs Phagocytosis by Alveolar Macrophages
Infect. Immun., April 1, 2003; 71(4): 1662 - 1671.
[Abstract] [Full Text]


Home page
J. Bacteriol.Home page
T. J. Kottom, C. F. Thomas Jr., and A. H. Limper
Characterization of Pneumocystis carinii PHR1, a pH-Regulated Gene Important for Cell Wall Integrity
J. Bacteriol., December 1, 2001; 183(23): 6740 - 6745.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
T. J. Kottom, C. F. Thomas Jr., K. K. Mubarak, E. B. Leof, and A. H. Limper
Pneumocystis carinii Uses a Functional Cdc13 B-Type Cyclin Complex during Its Life Cycle
Am. J. Respir. Cell Mol. Biol., June 1, 2000; 22(6): 722 - 731.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
R. Vassallo, J. E. Standing, and A. H. Limper
Isolated Pneumocystis carinii Cell Wall Glucan Provokes Lower Respiratory Tract Inflammatory Responses
J. Immunol., April 1, 2000; 164(7): 3755 - 3763.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
C. F. Thomas Jr., E. B. Leof, and A. H. Limper
Analysis of Pneumocystis carinii Introns
Infect. Immun., November 1, 1999; 67(11): 6157 - 6160.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. F. Thomas Jr., T. J. Kottom, E. B. Leof, and A. H. Limper
Characterization of a mitogen-activated protein kinase from Pneumocystis carinii
Am J Physiol Lung Cell Mol Physiol, July 1, 1998; 275(1): L193 - L199.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. J. Kottom and A. H. Limper
Cell Wall Assembly by Pneumocystis carinii. EVIDENCE FOR A UNIQUE Gsc-1 SUBUNIT MEDIATING beta -1,3-GLUCAN DEPOSITION
J. Biol. Chem., December 15, 2000; 275(51): 40628 - 40634.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. P. Gustafson, C. F. Thomas Jr., F. Rusnak, A. H. Limper, and E. B. Leof
Differential Regulation of Growth and Checkpoint Control Mediated by a Cdc25 Mitotic Phosphatase from Pneumocystis carinii
J. Biol. Chem., January 5, 2001; 276(1): 835 - 843.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, C. F.
Right arrow Articles by Limper, A. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, C. F., Jr.
Right arrow Articles by Limper, A. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 1998 American Thoracic Society.