|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
Abstract |
|---|
|
|
|---|
Previously, we identified macrophage-stimulating protein (MSP) as being expressed during hamster lung injury induced by nitrosamine carcinogens. Transient, generalized epithelial-cell hyperplasia during the preneoplastic period, and eventually nonneuroendocrine (non-NE) lung tumors, are known to develop in these nitrosamine-treated hamsters. We wished to test the hypothesis that MSP and its tyrosine kinase receptor, RON, might represent an autocrine/paracrine system involved in the pathogenesis of human nonneuroendocrine lung tumors, the non-small-cell carcinomas (NSCLCs). We found that this occurred in a paracrine fashion in three of eight primary human NSCLCs that expressed messenger RNA (mRNA) for MSP at high levels in histologically normal lung adjacent to the tumor, but not in the primary tumor, together with mRNA for RON in both normal and tumor tissue. MSP and RON could also constitute an autocrine/paracrine system in human NSCLC cell lines: five of 16 cell lines (squamous and adenosquamous) expressed both MSP and RON; and an additional five of 16 cell lines expressed RON without detectable MSP. Although three cases of primary squamous-cell carcinomas expressed MSP (two of three in the tumor and one of three in nonneoplastic lung), mRNA for RON was not detectable in these cases. RON was functional in all tested RON mRNA-positive cell lines, with exogenous MSP inducing RON-mediated tyrosine phosphorylation. Treatment of a RON-positive adenosquamous carcinoma cell line with MSP additionally resulted in increased motility in a cell-migration assay, suggesting that MSP might promote cell migration of some NSCLCs. In conclusion, MSP and RON might represent an autocrine/paracrine system involved in the pathogenesis of lung cancer, although the nature of the biologic responses in different cell types might vary considerably.
| |
Introduction |
|---|
|
|
|---|
Our laboratory has been investigating gene expression in a hamster model of preneoplastic lung injury leading to nonneuroendocrine (non-NE) lung tumors (1). Hamsters are treated with diethylnitrosamine (DEN) or the tobacco-specific nitrosamine 4-(methylnitrosamine)-1-(3-pyridyl)- 1-butanone (NNK), with or without 65% hyperoxia (O2). Pulmonary epithelial-cell hyperplasia is present after 2 to 3 mo of treatment, with non-NE cells being the epithelial-cell population most mitotically active (2), as demonstrated by immunostaining for proliferating cell nuclear antigen (PCNA) and c-myc antigen. Similarly treated hamsters develop only non-NE lung tumors after 40 wk (3); these tumors have a high rate of K-ras mutations and rare p53 mutations, consistent with deregulated growth of non-NE epithelial cells (4, 5). Therefore, the hamster non-NE lung tumors are similar to human non-small-cell lung carcinomas (NSCLCs), predominantly adenocarcinomas, squamous-cell carcinomas, and bronchioloalveolar carcinomas (3, 6).
One possible explanation for the exclusive development of NSCLC-like tumors in rodents is that other genes promoting tumorigenesis, in addition to c-myc, might be upregulated in non-NE cells during nitrosamine-induced lung injury. Previously, we identified hepatocyte growth factor-like/macrophage-stimulating protein (MSP), and its tyrosine kinase receptor, RON, as being transiently expressed in this lung-injury model during the peak period of epithelial hyperplasia; MSP and RON were consistently undetectable in lung tissues from age-matched normal hamsters (7). We wished to test the hypothesis that MSP and RON might represent an autocrine/paracrine system involved in the pathogenesis of a subset of human NSCLCs. Our data indicate that this could occur in an autocrine or paracrine fashion in a subset of primary human NSCLCs and NSCLC cell lines. RON is functional in all tested RON mRNA-positive cell lines, with exogenous MSP inducing RON-mediated tyrosine phosphorylation. One adenosquamous carcinoma cell line additionally responded to MSP with increased cell motility, suggesting that MSP might promote cell migration of some NSCLCs. In conclusion, MSP and RON might represent an autocrine/paracrine system involved in the pathogenesis of lung cancer, although the nature of the biologic responses in different cell types might vary considerably.
| |
Materials and Methods |
|---|
|
|
|---|
Human Tumor Tissues and Cell Lines
Samples of primary lung tumors (verified by frozen-section histopathology to consist of > 90% tumor cells) and adjacent nonneoplastic lung were obtained immediately after therapeutic surgical resection (lobectomy or pneumonectomy), and were snap-frozen in liquid nitrogen prior to RNA preparation for reverse transcription-polymerase chain reaction (RT-PCR) analyses. These protocols were conducted according to strict institutional and National Institutes of Health (NIH) guidelines for use of human tissues that would otherwise be discarded. Nonneoplastic lung was defined as grossly and histologically normal lung tissue adjacent to the primary tumor; because bronchial epithelial cells in such tissue frequently have multiple cytogenetic abnormalities, which can be considered to represent preneoplastic lung injury (8), we do not refer to these specimens as "normal" lung. The histopathology of all surgical tissue samples was confirmed by frozen-section examination, with primary tumor samples composed of over 90% viable tumor cells with less than 10% other cells, consisting predominantly of fibrovascular stromal cells.
Human lung-carcinoma cell lines were cultured as described previously (9, 10). These cell lines included: (1) large-cell carcinomas (H460, H661, and SL6); (2) bronchioloalveolar carcinomas (H322 and H549); (3) adenocarcinomas (H23 and H441); (4) squamous-cell carcinomas (CaLu1, ChaGoK1, EPL65H, EPLC103, H157, H520, and U1752); and (5) adenosquamous carcinomas (H125, H292, and H596).
PCR on Reverse-transcribed RNA for MSP, RON, and Actin Transcripts
Complementary DNA (cDNA) was prepared with 10 µg
total RNA as described in detail previously (2, 11). Synthetic oligodeoxynucleotides were designed with conserved sequences for human
-actin (yielding a 240-bp
fragment) (12, 13), human MSP (base pairs 886 to 1,555, yielding a 669-bp product, for human RNA analyses) (14), and human RON (base pairs 1,642 to 2,862, yielding an
~ 1,200-bp product) (15). PCRs were conducted for 35 cycles for MSP and RON or 22 cycles for actin, each cycle including denaturation (0.5 min, 93°C), annealing (1.0 min,
50°C), and extension (1 to 3 min, 72°C), as detailed previously (2, 11). Southern blots of the PCR products were
probed with the corresponding end-labeled internal oligonucleotides specific for MSP, RON, or
-actin (all human). The actual sequences of the primers are:
Actin:
5': GTGGGGCGCCCCAGGCACCA
3': TGGCCTTGGGGTTCAGGGGG
Probe: AACTGGGACGACATGGAGAAAATCTG GCAC
MSP:
5': AATACCACCACTGCGGGCGT
3': TCAGTATCCACTGCTCCTTCA
Probe: TGTACAACGCCGGATCTGGTAGCA
RON:
5': CATGGCAT T T CATGGGCTGT
3': GGTGACCACTCTACCCAGGATATGACA
Probe: CTGGTCTGAGT T T TGAGGTG
All of these primer pairs yielded products that spanned at
least one intron, to permit distinction between cDNA and
any contaminating genomic DNA. For semiquantitative
RT-PCR, conditions were determined such that the number of cycles was approximately one-third maximal and
thus within the linear range of detection (2, 7), allowing for semiquantitative comparison of relative amounts of
MSP, RON, and actin mRNAs present in the same RT reaction mixture, normalized with actin mRNA as an internal control. Increased RNA input from a positive control
cell line (H596, adenosquamous carcinoma of the lung) led
to linear increases in the RT-PCR signals for MSP, its receptor, RON, and
-actin, on the basis of a comparison of different quantities (over a two-log scale) of total RNA in
the RT reaction (7).
Detection of RON Receptor Phosphorylation
Details of the assay of RON receptor phosphorylation are reported elsewhere (7, 16). Three cell lines were used: RON-negative H82, an SCLC cell line as a negative control (7), along with RON-positive NSCLC lines H596 and H661. Cells at 1 × 107/ml in RPMI 1640 medium were incubated with or without 5 nM MSP at 37°C for 10 min. RON-transfected Madin-Darby canine kidney (MDCK) cells (clone RE7, 4 × 106 cells) were used as a positive control (7, 16). After stimulation, cells were lysed, proteins were precipitated with rabbit anti-RON peptide IgG coupled with protein G-sepharose beads, and samples were electrophoresed on 8.0% acrylamide gels under reducing conditions, as described previously (16). After electrophoresis, proteins were transferred to Immobilon-P membranes and incubated overnight with 0.2 µg/ml IgG antiphosphotyrosine (4G10), and then with horseradish peroxidase-conjugated goat antimouse IgG (16). The antibody binding was developed with ECL detection reagents (Amersham, Arlington Heights, IL) according to the manufacturer's instructions.
Growth Assays
Cell lines were treated with MSP (1, 3, and 10 nM) for 5 d, and viable cell counts were determined in the presence of 0.5% trypan blue, using a hemocytometer. For [3H]thymidine incorporation, cells grown in 96-well plates at 104 cells per well in a volume of 200 µl were treated with MSP (1, 3, and 10 nM) for 2 to 5 d; fresh MSP (or medium alone for the negative controls) was added every 2 d. For the last 4 h of culture, 1 µCi of [3H]thymidine was added per well. Cells were harvested on filter mats, using a semiautomatic cell harvester (Model 1004; Skatron, Inc., Sterling, VA). Four to eight replicates were used per group in each experiment. Radioactivity counts on filters were determined according to standard protocols.
Cell-migration Assay
The cell-migration assay was performed as previously described (16). In brief, bottom wells of a multiwell chemotaxis chamber were filled with 30 µl RPMI 1640 medium containing different amounts of MSP in duplicate, and were covered with a coated polycarbonate membrane, and upper wells were filled with 45-µl aliquots of H596 or H661 cell suspension (4 × 106 cells/ml in serum-free RPMI 1640 medium). The RON-negative SCLC cell line H82 was used as a negative control (7). After a 5-h incubation at 37°C, chambers were disassembled and the membranes were air dried, stained with Diff-Quik (American Scientific Products, McGaw Park, IL) and the migrated cells were counted using an image analyzer (17). The results were expressed as the percentage of input cells that migrated.
Statistical Analyses
Numerical data were analyzed with the unpaired Student's t test, with values expressed as mean ± 1 SEM or 1 SD.
| |
Results |
|---|
|
|
|---|
MSP Gene Expression in Primary Human Lung Tumors and Adjacent Nonneoplastic Lung Tissues, and in Human Tumor-Cell Lines
To address the question of whether the MSP gene might be expressed in nonneoplastic lung or lung tumors, we used RT-PCR analyses of total RNA from eight primary NSCLCs and the corresponding adjacent nonneoplastic lung (Figure 1 and Table 1), and a panel of lung carcinoma cell lines (Figure 2 and Table 2).
|
|
|
|
|
The results of analyses of all eight cases of primary NSCLC are given in Figure 1 and Table 1. There were three main patterns of MSP expression, as follows: (1) MSP mRNA was expressed at moderate to high levels in nonneoplastic lung adjacent to two of two large-cell carcinomas of the lung (LCLCs), one of three adenocarcinomas, and one of three squamous-cell carcinomas. In contrast, these transcripts were conspicuously absent from the corresponding primary tumor specimens, despite good actin mRNA levels. One of these cases, LCLC case 2, demonstrated an mRNA species of smaller size (which did hybridize strongly to an internal MSP-specific oligonucleotide probe in the MSP RT-PCR Southern blot analysis), suggesting aberrant gene expression and/or splicing, which could reflect point mutations. (2) Two of three squamous-cell carcinomas expressed moderate levels of MSP mRNA whereas the corresponding nonneoplastic lung was negative for MSP mRNA. (3) In two of three cases of adenocarcinoma, MSP was not expressed in either the tumor or in nonneoplastic lung.
However, these primary-tumor specimens were composed only of 90% tumor cells, plus the supporting fibrovascular stroma. Available MSP antisera, developed for Western blot analysis, did not reveal MSP in immunohistochemical analyses of positive control human liver tissues under any conditions tested (paraformaldehyde-fixed versus frozen tissue, with or without Triton-X-100, trypsin, or microwave retrieval). In situ hybridization did not yield interpretable results with the available paraffin-embedded and frozen-tissue blocks.
To further evaluate whether MSP gene expression occurs in specific histopathologic subtypes of lung cancer, we screened a panel of tumor cell lines with RT-PCR. The results are given in Figure 2 and Table 2. Strong expression of the MSP gene occurred in cell lines derived from adenocarcinomas (one of two being positive), squamous-cell carcinomas (two of seven being strongly positive, another two of seven moderately positive), and adenosquamous carcinomas (two of three being strongly positive). MSP was undetectable in cell lines derived from two LCLCs and two bronchioloalveolar carcinomas. The negative control ("no RT"), run in parallel, with water instead of reverse transcriptase (Figure 2), was devoid of a hybridization signal. All lanes demonstrated good actin control bands (the upper band was of the expected molecular weight, and specifically hybridized to an internal actin primer; the lower band, appearing on ethidium gels, was not reproducible and is believed to have been due to a gel-loading artefact in two experiments), except for the no-RT negative control.
Expression of mRNA Encoding RON, the Receptor Protein Tyrosine Kinase for MSP in Human Tumor Cell Lines
We hypothesized that MSP might be a paracrine regulatory factor for some NSCLCs. To determine whether RON, the tyrosine kinase receptor for MSP, is transcribed in specific histopathologic subtypes of lung cancer, we used RT-PCR to screen a panel of tumor cell lines, as was done with the cell lines shown in Figure 2. The results are shown in Figure 3 and Table 2. A single band was detected in these human specimens at ~ 1,200 bp, as expected. Strong expression of the RON gene occurred in cell lines derived from two of three LCLCs (H460 and H661, both MSP-negative), one of seven squamous-cell carcinomas (CaLu1, MSP-negative) and one of three adenosquamous carcinomas (H596, strongly MSP-positive). Weak to moderate levels of RON mRNA were also present in one of two bronchioloalveolar carcinoma cell lines (H322), one of two adenocarcinoma cell lines (H23, MSP-negative), three additional squamous-cell carcinoma cell lines (ChaGoK1, EPL65H, and H157, all MSP-positive), and one additional adenosquamous carcinoma cell line (H125, MSP-positive). All lanes showed good actin control bands, except for the no-RT negative controls.
RON mRNA is also detected in some primary NSCLCs and the corresponding nonneoplastic tissue (Table 1 and data not shown). In two cases of large-cell carcinoma, RON was expressed at low to moderate levels in both primary tumors (MSP-negative) and nonneoplastic lung (both MSP-positive). In adenocarcinoma cases 2 and 3 (Figure 1), there was weak RON mRNA expression in both the tumor and nonneoplastic tissue samples; the nonneoplastic lung in one of these cases expressed MSP mRNA (Table 1). RON mRNA was undetectable in the tumor and nonneoplastic lung from the remaining cases (adenocarcinoma case 1 and all three squamous-cell carcinomas).
In summary, the results for MSP and RON gene expression in the cell lines and the solid tumors were generally in agreement with regard to the major observations that: (1) the highest MSP mRNA levels occurred in the majority (60 to 67%) of tumors/cell lines with a squamous phenotype; (2) prominent RON expression occurred in most large-cell carcinomas (both of two tumors and two of three cell lines); and (3) detectable but lower-level RON expression occurred in 50 to 67% of adenocarcinomas (one of two cell lines and two of three tumors). The only notable difference between the tumors and cell lines was that two of 10 squamous cell lines expressed high levels of RON, whereas none of the three primary squamous-cell carcinomas expressed detectable RON mRNA under our assay conditions.
Tyrosine Phosphorylation of RON in Lung Cancer Cell Lines
To determine whether RON gene expression is associated
with specific cellular responses, we first conducted assays
of RON phosphorylation in response to human native
MSP, using representative cell lines that expressed moderate to high levels of RON mRNA versus cell lines lacking
detectable RON mRNA. The results are given in Figure 4.
The control cell line MDCK-RE7 was included to demonstrate positive phosphorylation of the RON
chain at ~ 150 kD (16). The highest levels of RON phosphorylation in response to recombinant MSP were observed in
H596 and H661. The same cell lines showed an absence of
phosphorylation when MSP treatment was omitted (data
not shown). There is no detectable RON phosphorylation
in H82, a SCLC cell line that lacks detectable RON
mRNA (24), indicating that RON phosphorylation occurs
in cells containing RON mRNA.
|
There is no significant effect of two to five days of treatment with MSP on proliferation or apoptosis of RON-positive cell lines H596 or H661, or RON-negative H82 or H720 as determined by viable cell counting (trypan blue exclusion), morphological evidence of apoptic bodies, and thymidine incorporation (data not shown).
Cell Migration
To define additional cellular functions affected by MSP, the cell lines shown in Figure 4 were used for cell migration assays. The only response in these experiments is a strong, dose-dependent migration of H596 (Figure 5), an adenosquamous carcinoma cell line. Peak migration occurred at a dose of MSP as low as 3 nM. A small decline in migration was observed at 10 nM, which might be due to receptor downregulation. None of the other RON mRNA-positive cell lines (H661, SCLC line H187, or carcinoid line H835) (24) migrated in response to MSP. The RON-negative cell lines H82 and H720 did not demonstrate increased motility in response to MSP.
|
| |
Discussion |
|---|
|
|
|---|
In the present study, we wished to test the hypothesis that MSP and its tyrosine kinase receptor, RON, might represent an autocrine/paracrine system involved in the pathogenesis of human non-NE lung tumors, the NSCLCs. There are four major pieces of evidence supporting this hypothesis:
1. The MSP and RON genes are not expressed in normal adult hamster lung (tested at ages 8 to 22 wk), but are induced in hamster lung during preneoplastic injury induced by nitrosamines (7), which coincides with the period during which generalized epithelial-cell proliferation and c-myc overexpression in non-NE cells occur (2).
2. Paracrine and/or autocrine effects could occur via MSP/ RON signaling. We observed three of eight primary human NSCLCs that expressed MSP mRNA at high levels in histologically normal lung adjacent to tumor but not in the primary tumor, together with RON mRNA in both normal and tumor tissue. Although three cases of primary squamous-cell carcinoma expressed MSP (two of three cases in the tumor and one of three in nonneoplastic lung), RON mRNA was not detectable in these cases. MSP and RON could also constitute an autocrine and/or paracrine system in human NSCLC cell lines: five of 16 cell lines (squamous and adenosquamous) expressed both MSP and RON; an additional five of 16 cell lines expressed RON without detectable MSP. These data suggest that MSP and RON might compose a paracrine regulatory pathway with MSP gene expression induced in injured lung, such as in foci of squamous metaplasia triggered by cigarette smoking.
The difference in RON gene expression between the primary squamous tumors and squamous-cell lines is consistent with observations in other laboratories that cell lines can have significant genotypic and/or phenotypic differences from similar primary tumors (18, 19). This could be due directly to selection of cells with greater proliferative potential in tissue culture, and/or could be linked to generalized chromosomal instability in lung cancer, leading to phenotypic shifting (20, 21).
3. Phosphorylation of RON occurred in response to MSP in two NSCLC cell lines that expressed high levels of RON mRNA, but not in a cell line with undetectable RON mRNA. Although we did not observe increased cell numbers or increased thymidine incorporation after treatment of these cells with MSP for 2 to 5 d, it is possible that there are more subtle effects of MSP on cell proliferation that will require longer culture periods or soft-agar clonogenic assay for demonstration. The induction of RON tyrosine phosphorylation by MSP in all RON mRNA-positive cell lines suggests that MSP could synergistically enhance the effects of other growth factors or cytokines on tumor-cell growth. Testing of this hypothesis would necessitate treatment of cell lines with MSP at a wide spectrum of doses, in combination with growth factors and/or cytokines such as epidermal growth factor-receptor ligands or keratinocyte growth factor (22, 23).
4. RON and MSP mRNAs were both expressed at moderate to high levels by three NSCLC cell lines: H157 (squamous-cell carcinoma) and H125 and H596 (both adenosquamous carcinomas). The potential for autocrine regulatory effects in NSCLCs is suggested by the observation of increased cell motility in H596. However, the presence of MSP mRNA alone does not guarantee that functional MSP will be produced. Pro-MSP must be cleaved proteolytically to become biologically active (24). It is also possible that additional ligands and/or receptors (present or absent) could act as antagonistic or agonistic factors in this system.
These effects of MSP on NSCLCs are not unprecedented. The related protein, hepatocyte growth factor (HGF)/scatter factor (SF) (50% amino-acid homology with MSP), has a variety of effects on different epithelial and mesenchymal cell types, including acting as a growth factor for hepatocytes, nonparenchymal hepatic epithelial cells, type II pneumocytes, and other cells (23, 25), and inducing tubular morphogenesis (32), cell motility (7, 35), cell adhesion (7), and cell spreading (7, 29, 36).
Additionally, the observation of MSP gene overexpression in squamous-cell carcinomas and/or adenocarcinomas suggests that MSP might be a new marker for NSCLCs. Only low levels of MSP mRNA have been observed in two of six SCLC cell lines, and neither MSP nor RON mRNAs were detected in either tumor or nonneoplastic lung from four cases of primary SCLC (7). The induction of apoptosis together with RON tyrosine phosphorylation in RON-positive NE lung carcinoma cell lines (7) differs from our observations with NSCLCs, in which there was no morphologic evidence of apoptosis. Cumulatively, these data suggest a scenario in which MSP expression by non-NE epithelial cells leads to NE cell death and non-NE-cell expansion during preneoplastic lung injury. In support of this hypothesis, we have observed NE-cell apoptosis in hamster lung during preneoplasia (7). This, in turn, would lead to preferential outgrowth of non-NE cell tumors.
Molecular mechanisms for regulation of MSP and/or
RON gene expression in lung injury and NSCLCs remain
to be determined. HGF and HGF-receptor mRNAs are
inducible by a variety of cytokines, including IL-1 and
TNF-
(38), which could explain their high levels in kidney, liver, and lung (29) during injury processes. Similarly,
the genes encoding MSP and its receptor could be upregulated by cytokines during lung injury. These studies open
new roads for investigation of a potential paracrine regulatory factor that might also promote cell motility for a subset of NSCLCs.
| |
Footnotes |
|---|
(Received in original form April 2, 1997 and in revised form November 14, 1997)
Address correspondence to: Dr. Mary E. Sunday, Brigham & Women's Hospital, Department of Pathology, 75 Francis Street, Boston, MA 02115. E-mail: sunday{at}a1.tch.harvard.eduAcknowledgments: The authors thank Dr. Ben Neel and Dr. Herbert Oie for providing the lung-cancer cell lines and some RNAs, and Dr. Cynthia Morton for helpful discussions. They also thank Dr. E. J. Leonard for providing human serum MSP, and Dr. Ron Breathnach for rabbit anti-RON IgG. This work was supported by an American Cancer Society Career Investigator Award (C.G.W.) and NIH grant HL44984 (M.E.S.).
Abbreviations DEN, diethylnitrosamine; FCS, fetal calf serum; LCLC, large-cell carcinoma of the lung; MSP, macrophage-stimulating protein; NE, neuroendocrine; NNK, 4-(methylnitrosamine)-1-(3-pyridyl)-1-butanone; NSCLC, non-small-cell carcinoma of the lung; PBS, phosphate-buffered saline; Rb, retinoblastoma susceptibility gene; RT-PCR, reverse transcription-polymerase chain reaction; SCLC, small-cell carcinoma of the lung.
| |
References |
|---|
|
|
|---|
1.
Sunday, M. E., and
C. G. Willett.
1992.
Induction and spontaneous regression of intense pulmonary neuroendocrine cell differentiation in a model
of preneoplastic lung injury.
Cancer Res.
52(Suppl.):
2677s-2686s
2. Sunday, M. E., C. G. Willett, K. Patidar, and S. A. Graham. 1994. Modulation of oncogene and tumor suppressor gene expression in a hamster model of chronic lung injury with varying degrees of pulmonary neuroendocrine cell hyperplasia. Lab. Invest. 70: 875-888 [Medline].
3. Sunday, M. E., C. G. Willett, S. A. Graham, V. I. C. Oreffo, R. I. Linnoila, and H. Witschi. 1995. Histochemical characterization of non-neuroendocrine tumors and neuroendocrine cell hyperplasia induced in hamster lung by 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone with or without hyperoxia. Am. J. Pathol. 147: 740-752 [Abstract].
4.
Oreffo, V. I. C.,
H.-W. Lin,
R. Padmanbhan, and
H. Witschi.
1993.
K-ras and p53 point mutations in 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone induced hamster lung tumors.
Carcinogenesis
14:
451-455
5. Oreffo, V. I. C., H. W. Lin, P. H. Gumerlock, S. A. Kraegel, and H. P. Witschi. 1992. Mutational analysis of a dominant oncogene (c-Ki-ras-2) and a tumor suppressor gene (p53) in hamster lung tumorigenesis. Mol. Carcinogen. 6: 199-202 [Medline].
6. Sunday, M. E., N. Choi, E. R. Spindel, W. W. Chin, and E. Mark. 1991. Gastrin-releasing peptide gene expression in small cell and large cell undifferentiated lung carcinomas. Hum. Pathol. 22: 1030-1039 [Medline].
7. Willett, C. G., D. I. Smith, V. Shridhar, M. H. Wang, R. L. Emanuel, K. Patidar, S. A. Graham, F. Zhang, D. Sugarbaker, T. Hatch, and M. E. Sunday. 1997. Differential screening of a human chromosome 3 library identifies hepatocyte growth factor-like/macrophage stimulating protein and its receptor in injured lung: possible implications for neuroendocrine cell survivial. J. Clin. Invest. 99: 2979-2991 [Medline].
8.
Lee, J. S.,
S. M. Lippman,
W. K. Hong,
J. Y. Ro,
S. Y. Kim,
R. Lotan, and
W. N. Hittelman.
1992.
Determination of biomarkers for intermediate end
points in chemoprevention trials.
Cancer Res.
52(Suppl.):
2707s-2710s
9. Gebert, J. F., N. Moghal, J. V. Frangioni, D. J. Sugarbaker, and B. G. Neel. 1991. High frequency of retinoic acid receptor beta abnormalities in human lung cancer. Oncogene 6: 1859-1868 [Medline].
10.
Carney, D. N.,
A. F. Gazdar,
G. Bepler,
J. G. Guccio,
P. J. Marangos,
T. W. Moody,
M. H. Zweig, and
J. D. Minna.
1985.
Establishment and identification of small cell lung cancer cell lines having classic and variant features.
Cancer Res.
45:
2913-2923
11.
Fridman, R.,
G. Giaccone,
T. Kanemoto,
G. R. Martin,
A. F. Gazdar, and
J. L. Mulshine.
1990.
Reconstituted basement membrane (Matrigel) and
laminin can enhance the tumorigenicity and the drug resistance of small
cell lung cancer cell lines.
Proc. Natl. Acad. Sci. USA
87:
6698-6702
12. Alonso, S., A. Minty, Y. Bourlet, and M. Buckingham. 1986. Comparison of three actin-coding sequences in the mouse: evolutionary relationships between the actin genes of warm-blooded vertebrates. J. Mol. Evol. 23: 11-22 [Medline].
13.
Ng, S. Y.,
P. Gunning,
P. Eddy,
P. Ponte,
J. Leavitt,
T. Shows, and
L. Kedes.
1985.
Evolution of the functional human beta-actin gene and its multi-pseudogene family: conservation of noncoding regions and chromosomal
dispersion of pseudogenes.
Mol. Cell. Biol.
5:
2720-2732
14.
Yoshimura, T.,
N. Yuhki,
M. H. Wang,
A. Skeel, and
E. J. Leonard.
1993.
Cloning, sequencing, and expression of human macrophage stimulating
protein (MSP, MST1) confirms MSP as a member of the family of kringle
proteins and locates the MSP gene on chromosome 3.
J. Biol. Chem.
268:
15461-15468
15. Ronsin, C., F. Muscatelli, M. G. Mattei, and R. Breathnach. 1993. A novel putative receptor protein tyrosine kinase of the met family. Oncogene 8: 1195-1202 [Medline].
16.
Wang, M. H.,
C. Ronsin,
M. C. Gesnel,
L. Coupey,
A. Skeel,
E. J. Leonard, and
R. Breathnach.
1994.
Identification of the ron gene product as the receptor for the human macrophage stimulating protein.
Science
266:
117-119
17.
Skeel, A.,
T. Yashimura,
S. D. Showalter,
S. Tanaka,
E. Appella, and
E. J. Leonard.
1991.
Macrophage stimulating protein: purification, partial
amino acid sequence, and cellular activity.
J. Exp. Med.
173:
1227-1234
18. Hoelting, T., Q. Y. Duh, O. H. Clark, and C. Herfarth. 1996. Somatostatin analog octreotide inhibits the growth of differentiated thyroid cancer cells in vitro, but not in vivo. J. Clin. Endocrinol. Metab. 81: 2638-2641 [Abstract].
19. Swafford, D. S., S. K. Middleton, W. A. Palmisano, K. J. Nikula, J. Tesfaigzi, S. B. Baylin, J. G. Herman, and S. A. Belinsky. 1997. Frequent aberrant methylation of p16INK4a in primary rat lung tumors. Mol. Cell. Biol. 17: 1366-1374 [Abstract].
20.
Mao, L.,
D. J. Lee,
M. S. Tockman,
Y. S. Erozan,
F. Askin, and
D. Sidransky.
1994.
Microsatellite alterations as clonal markers for the detection of
human cancer.
Proc. Natl. Acad. Sci. USA
91:
9871-9875
21. Hirano, T., B. Franzen, H. Kato, Y. Ebihara, and G. Auer. 1994. Genesis of squamous cell lung carcinoma: sequential changes of proliferation, DNA ploidy, and p53 expression. Am. J. Pathol. 144: 296-302 [Abstract].
22.
Schmiegel, W.,
C. Roeder,
J. Schmielau,
U. Rodeck, and
H. Kalthoff.
1993.
Tumor necrosis factor induces the expression of transforming growth factor and the epidermal growth factor receptor in human pancreatic cancer
cells.
Proc. Natl. Acad. Sci. USA
90:
863-867
23. Panos, R. J., J. S. Rubin, S. A. Aaronson, and R. J. Mason. 1993. Keratinocyte growth factor and hepatocyte growth factor/scatter factor are heparin-binding growth factors for alveolar type II cells in fibroblast-conditioned medium. J. Clin. Invest. 92: 969-977 .
24. Wang, M. H., A. Skeel, and E. J. Leonard. 1996. Proteolytic cleavage and activation of pro-macrophage-stimulating protein by resident peritoneal macrophage membrane proteases. J. Clin. Invest. 97: 720-727 [Medline].
25. Johnson, M., G. Koukoulis, K. Matsumoto, T. Nakamura, and A. Iyer. 1993. Hepatocyte growth factor induces proliferation and morphogenesis in nonparenchymal epithelial liver cells. Hepatology 17: 1052-1061 [Medline].
26.
Rubin, J. S.,
A. M. Chan,
D. P. Bottaro,
W. H. Burgess,
W. G. Taylor,
A. C. Cech,
D. W. Hirschfield,
J. Wong,
T. Miki,
P. W. Finch, and
S. A. Aaronson.
1991.
A broad-spectrum human lung fibroblast-derived mitogen is a
variant of hepatocyte growth factor.
Proc. Natl. Acad. Sci. USA
88:
415-419
27. Hu, Z., R. P. Evarts, K. Fujio, E. R. Marsden, and S. S. Thorgeirsson. 1993. Expression of hepatocyte growth factor and c-met genes during hepatic differentiation and liver development in the rat. Am. J. Pathol. 142: 1823-1830 [Abstract].
28. Mason, R. J., C. C. Leslie, K. McCormick-Shannon, R. R. Deterding, T. Nakamura, J. S. Rubin, and J. M. Shannon. 1994. Hepatocyte growth factor is a growth factor for rat alveolar type II cells. Am. J. Respir. Cell Mol. Biol. 11: 561-567 [Abstract].
29.
Gohda, E.,
S. Nakamura,
I. Yamamoto, and
J. Minowada.
1995.
Hepatocyte growth factor
pleiotropic cytokine produced by human leukemia cells.
Leukemia Lymphoma
19:
197-205
.
30. Michalopoulos, G. K.. 1995. HGF in liver regeneration and tumor promotion. Progr. Clin. Biol. Res. 391: 179-185 [Medline].
31. Cortner, J., G. F. Vande, Woude, and S. Rong. 1995. The met-HGF/SF autocrine signaling mechanism is involved in sarcomagenesis. EXS 74: 89-121 [Medline].
32. Montesano, R., K. Matsumoto, T. Nakamura, and L. Orci. 1991. Identification of a fibroblast-derived epithelial morphogen as hepatocyte growth factor. Cell 67: 901-908 [Medline].
33. Bronner-Fraser, M.. 1995. Hepatocyte growth factor/scatter factor (HGF/ SF) in early development: evidence for a role in neural induction. Trends Genet. 11: 423-425 [Medline].
34. Kelly, O. G., and D. A. Melton. 1995. Induction and patterning of the vertebrate nervous system. Trends Genet. 11: 273-278 [Medline].
35.
Takebayashi, T.,
M. Iwamoto,
A. Jikko,
T. Matsumura,
M. Enomoto-Iwamoto,
F. Myoukai,
E. Koyama,
T. Yamaai,
K. Matsumoto, and
T. Nakamura.
1995.
Hepatocyte growth factor/scatter factor modulates cell motility, proliferation, and proteoglycan synthesis of chondrocytes.
J. Cell Biol.
129:
1411-1419
36. Jiang, W. G., D. Lloyds, M. C. Puntis, T. Nakamura, and M. B. Hallett. 1993. Regulation of spreading and growth of colon cancer cells by hepatocyte growth factor. Clin. Exp. Metastasis 11: 235-242 [Medline].
37. Tajima, H., K. Matsumoto, and T. Nakamura. 1992. Regulation of cell growth and motility by hepatocyte growth factor and receptor expression in various cell species. Exp. Cell Res. 202: 423-431 [Medline].
38. Zarnegar, R.. 1995. Regulation of HGF and HGFR gene expression. EXS 74: 33-49 [Medline].
This article has been cited by other articles:
![]() |
P. S. Hodkinson, A. MacKinnon, and T. Sethi Targeting Growth Factors in Lung Cancer Chest, May 1, 2008; 133(5): 1209 - 1216. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Thangasamy, J. Rogge, and S. Ammanamanchi Regulation of RON Tyrosine Kinase-mediated Invasion of Breast Cancer Cells J. Biol. Chem., February 29, 2008; 283(9): 5335 - 5343. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Rampino, G. Soccio, M. Gregorini, C. Guidetti, M. Marasa, M. Maggio, V. Panichi, M. Migliori, C. Libetta, and A. Dal Canton Neutralization of Macrophage-Stimulating Protein Ameliorates Renal Injury in Anti-Thy 1 Glomerulonephritis J. Am. Soc. Nephrol., May 1, 2007; 18(5): 1486 - 1496. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. O'Toole, K. E. Rabenau, K. Burns, D. Lu, V. Mangalampalli, P. Balderes, N. Covino, R. Bassi, M. Prewett, K. J. Gottfredsen, et al. Therapeutic Implications of a Human Neutralizing Antibody to the Macrophage-Stimulating Protein Receptor Tyrosine Kinase (RON), a c-MET Family Member. Cancer Res., September 15, 2006; 66(18): 9162 - 9170. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Germano, D. Barberis, M. M. Santoro, L. Penengo, A. Citri, Y. Yarden, and G. Gaudino Geldanamycins Trigger a Novel Ron Degradative Pathway, Hampering Oncogenic Signaling J. Biol. Chem., August 4, 2006; 281(31): 21710 - 21719. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. R. Camp, W. Liu, F. Fan, A. Yang, R. Somcio, and L. M. Ellis RON, a Tyrosine Kinase Receptor Involved in Tumor Progression and Metastasis Ann. Surg. Oncol., April 1, 2005; 12(4): 273 - 281. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Peace, K. Toney-Earley, M. H. Collins, and S. E. Waltz Ron Receptor Signaling Augments Mammary Tumor Formation and Metastasis in a Murine Model of Breast Cancer Cancer Res., February 15, 2005; 65(4): 1285 - 1293. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Angeloni, A. Danilkovitch-Miagkova, A. Miagkov, E. J. Leonard, and M. I. Lerman The Soluble Sema Domain of the RON Receptor Inhibits Macrophage-stimulating Protein-induced Receptor Activation J. Biol. Chem., January 30, 2004; 279(5): 3726 - 3732. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-Q. Chen, Y.-Q. Zhou, L.-H. Fu, D. Wang, and M.-H. Wang Multiple pulmonary adenomas in the lung of transgenic mice overexpressing the RON receptor tyrosine kinase Carcinogenesis, November 1, 2002; 23(11): 1811 - 1819. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Rampino, C. Collesi, M. Gregorini, M. Maggio, G. Soccio, P. Guallini, and A. D. Canton Macrophage-Stimulating Protein Is Produced by Tubular Cells and Activates Mesangial Cells J. Am. Soc. Nephrol., March 1, 2002; 13(3): 649 - 657. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Stella, A. Vercelli, M. Repici, A. Follenzi, and P. M. Comoglio Macrophage Stimulating Protein Is a Novel Neurotrophic Factor Mol. Biol. Cell, May 1, 2001; 12(5): 1341 - 1352. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Crit. Care Med. |