help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Borger, P.
Right arrow Articles by Kauffman, H. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Borger, P.
Right arrow Articles by Kauffman, H. F.
Am. J. Respir. Cell Mol. Biol., Volume 19, Number 3, September 1998 400-407

beta -Adrenoceptor-mediated Inhibition of IFN-gamma , IL-3, and GM-CSF mRNA Accumulation in Activated Human T Lymphocytes Is Solely Mediated by the beta 2-Adrenoceptor Subtype

Peter Borger, Yke Hoekstra, Mariet T. Esselink, Dirkje S. Postma, Johan Zaagsma, Edo Vellenga, and Henk F. Kauffman

Divisions of Allergology, Pulmonology, Molecular Pharmacology, and Hematology, Department of Internal Medicine and University Centre for Pharmacy, University of Groningen, Groningen, The Netherlands


    Abstract
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cytokine gene expression in T lymphocytes is a strictly regulated process, involving both stimulatory and inhibitory signals. beta -Adrenoceptor (beta AR) agonists are widely used in the treatment of asthma and are able to induce an inhibitory signal on immunological responses after binding to their specific receptors. In this study, the characterization of beta AR subtype(s) (beta 1, beta 2, and beta 3) involved in the regulation of interleukin (IL)-3, IL-4, granulocyte-macrophage colony-stimulating factor (GM-CSF), and interferon-gamma (IFN-gamma ) mRNA accumulation was studied by using various beta AR agonists and antagonists. Concanavalin A (Con A)-induced IFN-gamma , GM-CSF, and IL-3 mRNAs are dose-dependently inhibited by the nonselective beta AR agonist isoproterenol and by the selective beta 2AR agonist fenoterol. IL-4 mRNA accumulation was not susceptible to beta AR stimulation. The observed inhibition on IFN-gamma , GM-CSF, and IL-3 mRNA was blocked by the selective beta 2AR antagonist ICI 118,551 (10-6 M) and by timolol (10-6 M), a nonselective antagonist. The selective beta 1AR antagonist atenolol (0.3 × 10-6 M) did not have any effect. Secretion of GM-CSF protein in the presence of increasing concentrations of isoproterenol followed a similar pattern as observed for GM-CSF mRNA. In addition, the beta AR-mediated inhibition of IFN-gamma , GM-CSF, and IL-3 mRNA accumulation and GM-CSF protein secretion were related to the accumulation of intracellular cyclic adenosine monophosphate (cAMP) levels. Although beta 3AR mRNA was detectable in Con A-activated T lymphocytes, we could not demonstrate a functional activity in the regulation of cytokine expression: the beta 3AR agonist BRL 37344 had no effect on the accumulation of the studied cytokine mRNAs, and did not significantly affect cellular cAMP levels. These data demonstrate that beta -agonist-induced inhibition of IFN-gamma , GM-CSF, and IL-3 mRNA accumulation is solely mediated by beta 2-adrenoceptors.


    Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The expression and secretion of cytokines by activated T lymphocytes is a strictly regulated process, involving interactions between hematopoetic cells and nonhematopoetic cells (1). T lymphocytes stimulated with mitogen or a combination of antibodies against CD2, CD3, and CD28 synthesize and secrete a variety of cytokines, including interleukin (IL)-3, IL-4, granulocyte-macrophage colony-stimulating factor (GM-CSF), and interferon-gamma (IFN-gamma ) (2). Obviously, a balanced cytokine expression requires both stimulatory and inhibitory signals. An increase in intracellular cyclic adenosine monophosphate (cAMP) levels might be stimulatory or inhibitory in the regulation of cytokine expression and is dependent on the cell type studied. In general, cAMP initiates an inhibitory signal and diminishes the responsiveness to exogenous activators (7).

Under physiological conditions, increase of intracellular cAMP can be achieved by binding of beta -adrenoceptor (beta AR) agonists to their specific receptors. This results in activation of membrane-bound adenylyl cyclase and subsequent increase of intracellular cAMP (7, 10, 11). beta -Adrenoceptors are present in several cell types, including T lymphocytes (12, 13). It has been reported that beta AR agonists have an inhibitory effect on T-lymphocyte activation (14). Furthermore, it has been suggested that the outcome of Th1 or Th2 cytokine profiles are differentially regulated by the adenylyl cyclase system, the Th2-derived cytokines (IL-4, IL-5) being less inhibitable by cAMP elevations (15). In this respect, it is interesting that both beta AR number and adenylyl cyclase responses are reduced after an allergen challenge-induced asthmatic attack (18). Thus, allergen exposure may contribute to the Th2 type immunoresponse as observed in allergic asthma (19). In addition, concanavalin A (Con A)-induced IL-3, GM-CSF, and IL-4 mRNA accumulation and protein secretion are diminished by simultaneous activation of adenylyl cyclase (5, 6).

It has been demonstrated that the beta AR family consists of three subtypes designated beta 1, beta 2, and beta 3, which share about 50% sequence homology (10, 20). In rat and human adipocytes it has been shown that they are distinct in their ability to generate cAMP, the beta 3AR being less potent to generate cAMP (21). beta -Adrenoceptors in T lymphocytes have been classified as beta 1 and beta 2 using radioligand displacement experiments (13). At present, it is unknown whether T lymphocytes have beta 3-adrenoceptors as well.

In this study we investigated the involvement of these beta AR subtypes in the regulation of four T lymphocyte- derived cytokines that are important in the regulation of the asthmatic inflammatory response (IL-3, IL-4, IFN-gamma , and GM-CSF) by using various beta AR agonists and antagonists. The data showed that downregulation of IL-3, IFN-gamma , and GM-CSF mRNA accumulation and protein secretion of GM-CSF are selectively mediated by the beta 2AR and are related to the intracellular accumulation of cAMP induced by the agonist, whereas IL-4 mRNA accumulation was not sensitive to beta 2AR stimulation.

    Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Preparation of Cells

Peripheral blood cells were obtained from healthy volunteer platelet donors, and mononuclear cell suspensions were prepared by Ficoll-Hypaque (Lymphoprep; Nycomed, Oslo, Norway) density-gradient centrifugation. T lymphocytes were isolated by 2-aminoethylisothiouronium bromide-treated sheep red blood cell (SRBC) rosetting. The SRBC were lysed with 155 mmol/liter NH4Cl, 10 mmol/liter KHCO3, 0.1 mmol/liter ethylenediamine tetraacetic acid (EDTA) and the remaining cell preparations contained more than 98% T lymphocytes as assessed by flow cytometric analysis after staining with an anti-CD2 monoclonal antibody (Becton Dickinson, Sunnyville, CA) and less than 1% CD14-positive cells (Becton Dickinson). After isolation, T lymphocytes were cultured overnight at 37°C in RPMI 1640 medium (Flow, Rockville, MD) containing 10% fetal bovine serum (FBS; Hyclone, Logan, UT) supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mmol/liter L-glutamine and 6 ng/ml colistine.

Stimulation

Cells (5 × 106/ml) were incubated in RPMI 1640/FBS medium for 6 h with 25 µg/ml Con A (Calbiochem, La Jolla, CA) as described previously (5, 6), in the absence or presence of several beta AR (ant)agonists. Sodium metabisulfite (10-5 M) was added to the medium as an antioxidant. (-)Isoproterenol hydrochloride (Sigma, St. Louis, MO) was used as a nonselective beta AR agonist at concentrations of 10-4 to 10-8 mol/liter. Fenoterol hydrobromide (Sigma) was used as a beta 2AR selective agonist at concentrations of 10-5 and 10-6 mol/liter. Timolol maleate (gift from Merck, Sharp and Dohme, Haarlem, The Netherlands) was used as a nonselective beta AR antagonist at a concentration of 10-6 mol/liter. Atenolol hydrochloride (Sigma) was used as a beta 1AR selective antagonist at a concentration of 3 × 10-7 mol/liter. ICI 118,551 hydrochloride (gift from Zeneca, Macclesfield, UK) was used as a beta 2AR antagonist at a concentration of 10-6 mol/liter. BRL 37344 (gift from Smith Kline Beecham, Epsom, UK) was used as a selective beta 3AR agonist at variable concentrations.

Extraction of mRNA and Analysis

Total cellular RNA was isolated by the guanidinium isthiocyanate/cesium chloride method (22). Twelve micrograms of total RNA was electrophoresed in 2.2 mol/liter formaldehyde, 1.1% agarose gels, and blotted onto nylon membranes (Hybond N+; Amersham, Buckinghamshire, UK) (23). cDNA probes were labeled with [alpha -32P]dCTP (3,000 Ci/mol; Amersham) by the random hexamer priming method (24). The following cDNA probes were used: (1) the 0.3-kb EcoRI/HindIII insert of human IL-3 cDNA purified from the phM1 plasmid (gift from Dr. H. Burger, TNO, Rijswijk, The Netherlands); (2) the 0.3-kb EcoRI/ NheI insert of human IL-4 cDNA (gift from Dr. S. Narula, Schering Plough, Bloomfield, NJ); (3) the 0.6-kb EcoRI/ HindIII insert of human IFN-gamma cDNA purified from the pSP65 plasmid (gift from Dr. C. B. Wilson, University of Washington, Seattle, WA); (4) the 0.45-kb, EcoRI/AvaII insert of human GM-CSF cDNA (gift from Dr. S. Gillis, Immunex, Seattle, WA); and (5) the EcoRI linearized pBR322 plasmid containing a 7.8-kb human 28S cDNA insert.

Hybridization was performed at 65°C for 18 h in 0.5 mol/liter Na2HPO4, pH 7.2, 1 mmol/liter EDTA, and 7% sodium dodecyl sulfate (SDS). Membranes were washed once in 2× saline sodium citrate (SSC), 0.1% SDS; once in 1× SSC, 0.1% SDS; and finally in 0.3× SSC, 0.1% SDS for 20 min at 65°C. The membranes were exposed to Kodak X-omat XAR films (Eastman Kodak, Rochester, NY) at -80°C using an intensifying screen. Quantification of mRNA levels was performed by densitometry using a Gel Scan laser densitometer (Pharmacia LKB, Uppsala, Sweden).

Reverse Transcription (RT) and Polymerase Chain Reaction (PCR)

Reverse transcription. Total cellular RNA, 1 µg, was resuspended in 15 µl diethylpyrocarbonate (DEPC; Sigma)- treated H2O and incubated at 68°C for 10 min. After they were cooled on ice the samples were spun briefly (20'', 2,000 × g) in a microcentrifuge. Next, 10 µl of 10 × RT mix (135 mM Tris-HCl, pH 8.3, 204 mM KCl, 27 mM MgCl2, 0.24 mg/ml bovine serum albumin (BSA), 5.4 mM of each dNTP, 14.3% glycerol) and 3 U of reverse transcriptase (Promega Corporation, Madison, WI) were added to the samples. The samples were spun briefly (20'', 2,000 × g) and incubated at 37°C for 60 min.

Polymerase chain reaction. A specific primer pair for the beta 3-adrenergic receptor was synthesized on a Gene Assembler Plus DNA synthesizer (Pharmacia) and purified using NAP 10 columns (Pharmacia). The primers shared no sequence homology with the beta 1 or beta 2 adrenergic receptor. The sense primer was 5' CCTGTGCACCTTGGGTCTCA 3' (position 907-927), the antisense primer was 5' TCGAGCCGTTGGCAAAGCCT 3' (position 1239-1219).

One microliter of 100 µM sense and antisense beta 3AR primers were added to each RT reaction sample and DEPC-treated H2O was added to a final volume of 100 µl. Next, the samples were heated for 3 min at 94°C, spun briefly in a microcentrifuge, and placed on ice. Taq DNA polymerase, 0.5 µl of 5 U/µl (Promega), was added to each sample. The tubes were placed in a thermal cycler (Perkin-Elmer, Foster City, CA). PCR was performed for 25 cycles: 1 min denaturation at 94°C, 1 min annealing at 55°C, and 1 min extension at 72°C. With these primers a fragment spanning 332 basepairs (bp) was amplified. After 25 PCR cycles 10 µl of the reaction mixture was run on a 2% agarose gel, containing 0.2 µg/ml ethidium bromide in 1× TAE buffer. A 100-bp ladder (Pharmacia) was used as the DNA marker.

Measurement of cAMP Production

T lymphocytes were washed twice in Tris buffer containing 120 mmol/liter NaCl, 1 mmol/liter MgCl2, 5 mmol/liter KCl, 0.6 mmol/liter CaCl2, 25 mmol/liter Tris (hydroxymethyl-amino-ethane), 5 mmol/liter glucose, and 0.1 mmol/liter human albumin, adjusted to pH 7.4 with HCl. Cells were suspended in RPMI 1640/FBS medium to a final density of 2.0 × 106 cells/ml. Stimulation of cAMP production was performed as described before (25). In short, the samples were preincubated with 1-methyl-3-isobutylxantine (0.5 mmol/ liter) for 10 min. After preincubation, the samples were stimulated for 10 min with Con A (25 µg/ml) in the absence or presence of the beta AR agonist, without or with an antagonist. Reactions were terminated by adding 2 N HCl-0.1 mol/liter EDTA followed by incubating the samples at 80°C for 10 min. After centrifugation of precipitated protein, the samples were neutralized by CaCO3 and cAMP was measured using an enzyme immunoassay (Biotrak, Amersham, UK) as specified by the manufacturers. cAMP concentrations are expressed as pmol cAMP/106 T lymphocytes.

Measurement of GM-CSF Protein

Human T lymphocytes (106/ml) were stimulated with Con A (25 µg/ml) plus isoproterenol (10-4 to 10-8 mol/liter) in the absence and presence of timolol (10-6 M) for 24 h. Vitality of cells was controlled by the trypan blue exclusion method. Secreted protein was quantified in cell-free supernatants using a human GM-CSF enzyme-linked immunosorbent assay (ELISA) kit (Genzyme Corp., Cambridge, MA) as recommended by the manufacturers.

Data Analysis

pEC50 (-log EC50) values were derived from the individual agonist concentration response curves. pKB values of the antagonists were derived from the EC50 values obtained in the absence and presence of the antagonist according to pKB = -log{[antagonist]/(DR-1)} (26). Statistical analysis was performed using Student's t test for paired observations. Statistically significant changes are reported when P < 0.05.

    Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

To study the involvement of beta AR subtypes in the regulation of IL-3, IL-4, GM-CSF, and IFN-gamma mRNA expression, human T lymphocytes were incubated for 6 h with Con A, in the absence and presence of isoproterenol or fenoterol with or without selective or nonselective beta AR antagonists. As shown in Figure 1, Con A-induced accumulation of IL-3, IFN-gamma , and GM-CSF mRNA was found to be dose-dependently inhibited by isoproterenol. IFN-gamma mRNA accumulation was most sensitive to the beta AR agonist, followed by GM-CSF and IL-3. -Log EC50 values for inhibition by isoproterenol of Con A-induced IFN-gamma , GM-CSF, and IL-3 mRNA accumulation as calculated from the individual plots were found to be 6.32 ± 0.03, 6.13 ± 0.19, and 5.96 ± 0.28 (mean ± SEM; n = 3). In contrast, IL-4 mRNA accumulation was not significantly inhibited by isoproterenol. The dose-dependent inhibition of IFN-gamma , GM-CSF, and IL-3 mRNA accumulation induced by isoproterenol was strongly antagonized by simultaneous addition of the selective beta 2AR antagonist ICI 118,551 (10-6 M) (Figure 1); from the parallel shifts to the right, pKB values of 7.82 ± 0.31, 7.71 ± 0.09, and 7.37 ± 0.16, respectively, were derived. As depicted in Figure 2, simultaneous addition of atenolol (0.3 × 10-6 M) to Con A-activated T lymphocytes (i.e., under selective blockade of beta 1AR) did not antagonize at all the isoproterenol-induced inhibition of mRNA accumulation for IFN-gamma , GM-CSF, and IL-3, indicating that beta 1AR was not involved.


View larger version (62K):
[in this window]
[in a new window]
 

View larger version (26K):
[in this window]
[in a new window]
  		Figure 1.   Dose-response curves (A) of the effect of isoproterenol (ISO) on the accumulation of Con A-induced IFN-gamma , GM-CSF, IL-3, and IL-4 mRNA. Northern blot analysis of total cellular RNA extracted from T lymphocytes after 6 h of stimulation in the absence (solid squares) and presence (solid triangles) of 10-6 M ICI 118,551 (ICI). mRNA levels of three independently performed experiments were quantified by densitometric scanning and normalized to the respective 28S signals. Representative mRNA data are shown in B.


View larger version (41K):
[in this window]
[in a new window]
  		Figure 2.   The effect of two concentrations of isoproterenol (ISO) and fenoterol on the accumulation of Con A-induced IFN-gamma , GM-CSF, and IL-3 mRNA. Northern blot analysis of total cellular RNA extracted from T lymphocytes after 6 h of stimulation in the absence and presence of 0.3 × 10-6 M atenolol. The corresponding bar diagrams represent relative mRNA values of a representative experiment after normalization to the respective 28S signals.

Next, fenoterol was added to the T-lymphocyte cultures as a selective beta 2AR agonist at concentrations of 10-5 and 10-6 M. As shown in Figures 2 and 3, these concentrations of fenoterol strongly inhibited the Con A-induced IFN-gamma , GM-CSF, and IL-3 mRNA accumulation. Simultaneous addition of atenolol (0.3 × 10-6 M) had no effect (Figure 2), whereas timolol (10-6 M)---able to antagonize strongly both beta 1AR and beta 2AR---markedly decreased the fenoterol-induced inhibition of IFN-gamma , GM-CSF, and IL-3 mRNA accumulation. Fenoterol did not significantly affect IL-4 mRNA accumulation at these concentrations (data not shown). The foregoing data indicate that isoproterenol and fenoterol exert their inhibitory effects on IFN-gamma , GM-CSF, and IL-3 mRNA accumulation via the beta 2AR without involvement of beta 1AR.


View larger version (30K):
[in this window]
[in a new window]
  		Figure 3.   The effect of two concentrations of fenoterol on the accumulation of Con A-induced IFN-gamma (filled bars), GM-CSF (hatched bars), and IL-3 (open bars) mRNA. Northern blot analysis of total cellular RNA extracted from T lymphocytes after 6 h of stimulation in the absence and presence of 10-6 M timolol. The corresponding bar diagrams represent relative mRNA values of a representative experiment after normalization to the 28S signals.

Next, we questioned whether or not the expression of these cytokines could be modulated by the selective beta 3AR agonist BRL 37344, because we were able to detect beta 3AR mRNA in T lymphocytes by RT-PCR (Figure 4A). As shown in Figure 4B, the accumulation of Con A-induced IL-4, IFN-gamma , and GM-CSF mRNAs was not affected by BRL 37344, used at concentrations up to 10-4 M. Similar results were observed for IL-3 mRNA accumulation (data not shown).


View larger version (29K):
[in this window]
[in a new window]
  		Figure 4.   Ethidium bromide-stained agarose gel (A) demonstrating high levels of RT-PCR amplified product with the predicted 332 bp size. Total RNA obtained from four different donors was isolated from Con A-stimulated T lymphocytes, reverse transcribed, and amplified in the presence of beta 3AR specific primers (lanes 1-4). Lane 5, 100-bp marker. Effect of BRL 37344 (B) on the accumulation of IFN-gamma , GM-CSF, and IL-4 mRNA. Northern blot analysis of total cellular RNA extracted from T lymphocytes activated with Con A in the absence and presence of different concentrations (as indicated) of BRL 37344. The 28S signal shows comparable levels of RNA in each lane.

To study whether the observed mRNA data have biological significance, GM-CSF protein secretion was measured in supernatants of T lymphocytes (106 cells/ml) obtained from four individual donors. As depicted in Figure 5A, the data for GM-CSF mRNA accumulation were reflected in the protein secretion data. Isoproterenol showed a dose-dependent inhibitory effect on the secretion of Con A-induced GM-CSF protein, which was strongly antagonized by timolol (10-6 M). Unstimulated T lymphocytes did not secrete detectable levels of GM-CSF protein (< 0.1 ng/ml). Con A-stimulated T lymphocytes secreted 6.9 ± 0.4 ng/ml GM-CSF protein. In the presence of Con A plus isoproterenol (10-6 M, 10-5 M, and 10-4 M), a significant reduction in GM-CSF protein was observed: 3.8 ± 0.9 ng/ ml (P < 0.02), 2.6 ± 0.8 ng/ml (P < 0.02) 2.7 ± 0.4 ng/ml (P < 0.01), respectively, whereas lower concentrations of isoproterenol (10-7 and 10-8 M) did not have significant effects. The pEC50 value of isoproterenol turned out to be 6.38 ± 0.17 (n = 4). In the presence of timolol (10-6 M) a marked shift to the right was observed, yielding a pKB value of 8.23 ± 0.37 (n = 4). Atenolol (0.3 × 10-6 M) did not antagonize the inhibitory effect of isoproterenol on the Con A-induced production of GM-CSF protein (data not shown).


View larger version (13K):
[in this window]
[in a new window]
  		Figure 5.   Dose-response curves (A) for isoproterenol on Con A-induced GM-CSF protein secretion in the absence (solid squares) and presence (solid triangles) of 10-6 M timolol. GM-CSF was measured in supernatants of T lymphocytes (106/ml) harvested after 24 h of stimulation. Values are the means ± SEM of four independent experiments. Dose-response curves (B) for isoproterenol-induced cAMP production (expressed as pmol/106 T cells) in Con A-activated T lymphocytes in the absence (solid squares) and presence (solid triangles) of 10-6 M timolol. Values are presented as the means ± SEM of five independent experiments.

In addition, we determined the accumulation of intracellular cAMP in T lymphocytes obtained from five individual donors in relation to the inhibitory effect of isoproterenol on Con A-induced GM-CSF secretion. T lymphocytes stimulated with Con A alone demonstrated a basal level of cAMP (0.41 ± 0.10 pmol). Concentrations of 10-6 M, 10-5 M, and 10-4 M isoproterenol significantly enhanced accumulation of intracellular cAMP levels (1.51 ± 0.26 pmol, P < 0.05; 2.17 ± 0.24 pmol, P < 0.02; 1.76 ± 0.16 pmol, P < 0.02), whereas lower concentrations did not. Again, timolol (10-6 M) strongly antagonized the isoproterenol-induced cAMP accumulation, which resulted in a parallel shift to the right of 2.6 log units (Figure 5B); the pKB value of timolol amounted to 8.54 ± 0.38 (n = 5). The concentration-dependent accumulation of cAMP by isoproterenol and the antagonism by timolol were inversely related to the effect of isoproterenol on GM-CSF protein secretion (compare Figure 5B with 5A). In contrast, the beta 3AR agonist BRL 37344 did not significantly affect cAMP accumulation: even in the presence of 10-4 M BRL 37344 the level of generated cAMP did not significantly differ from basal levels (Figure 6).


View larger version (16K):
[in this window]
[in a new window]
  		Figure 6.   Effect of increasing concentrations of isoproterenol and BRL 37344 on the production of cAMP (expressed as pmol/ 106 T cells) in Con A-activated T lymphocytes. The data are presented as means ± SEM of five independent experiments.

    Discussion
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

It is now known that T lymphocytes express both beta 1 and beta 2 adrenoceptors on their membranes (13). The effects of several cytokines on the expression of these receptors have been studied extensively (27). On the other hand, although we have previously shown that IL-3 and GM-CSF mRNA accumulation and protein secretion can be inhibited by isoproterenol (6), there is lack of information regarding the identity of beta AR subtype(s) involved. In this study we have characterized the beta AR subtype(s) involved in the regulation of four T lymphocyte-derived cytokines: IL-3, IL-4, IFN-gamma , and GM-CSF. We observed that the nonselective beta AR agonist isoproterenol dose dependently diminished the Con A-induced accumulation of IL-3, GM-CSF, and IFN-gamma mRNA. IL-3, GM-CSF, and IFN-gamma mRNA levels were also inhibited by the selective beta 2AR agonist fenoterol, whereas the highest concentration of isoproterenol (10-4 M) had no significant effect on IL-4 mRNA accumulation. These observations correspond with similar observations showing that the Th2-derived cytokine IL-4 is less sensitive to cAMP elevations compared with IFN-gamma , which is a Th1-derived cytokine (15). However, it recently was demonstrated that the sensitivity for cAMP is dependent on the mode of activation of the T lymphocytes. IL-4 mRNA accumulation was not inhibited by prostaglandin E2 (PGE2) in A23187 plus phorbol myristate acetate (PMA)-stimulated T lymphocytes, whereas IL-4 mRNA was dose dependently decreased by PGE2 in Con A- or anti-CD3 plus anti-CD28-stimulated T lymphocytes (5).

The observed downregulation of the studied cytokines was selectively mediated by the beta 2AR. Evidence was derived from the experiments carried out with selective beta AR antagonists. ICI 118,551---a selective beta 2AR antagonist (20)---was able to antagonize the inhibitory effect of isoproterenol on the accumulation of IFN-gamma , GM-CSF, and IL-3 mRNA with pKB values of 7.82 ± 0.31, 7.71 ± 0.09, and 7.37 ± 0.16, respectively. Although these values are intermediate between the pA2 values reported for beta 2AR in guinea pig tracheal smooth muscle (8.72) and beta 1AR guinea pig atria (7.19) (30), it should be realized that binding of lipophilic beta -adrenoceptor antagonists like ICI 118,551 to serum proteins present in the incubation medium may strongly diminish the free drug concentration that will lower pKB or pA2 values (31). Moreover, coincubation with the (very hydrophilic) selective beta 1AR antagonist atenolol had no effect at all on the inhibition of isoproterenol or fenoterol. Therefore, the observed downregulation of the Con A-induced cytokine expression by isoproterenol and fenoterol is selectively mediated by the beta 2AR, whereas apparently no beta 1AR is involved.

In addition, we also demonstrated the occurrence of beta 3AR mRNA in T lymphocytes by using the RT-PCR technique. Although significant levels of beta 3AR mRNA were detectable in T lymphocytes from four different donors, we did not find functional activity of the beta 3AR in the cytokine regulation of T lymphocytes. A possible explanation for this observation might be that beta 3AR mRNA in T lymphocytes is, at most, partially translated into protein. Besides, stimulation by the selective beta 3AR agonist BRL 37344 did not result in increased intracellular cAMP levels. Interestingly, human adipocytes, in contrast to rat adipocytes, also have a very low responsiveness for BRL 37344 with respect to cAMP accumulation as well as lipolysis, indicating the marginal role of beta 3AR in human adipocyte lipolysis compared with beta 1AR and beta 2AR (32).

In conclusion, our data present evidence that beta AR stimulation exerts an important negative regulatory feedback control mechanism in the expression of T-cell- derived cytokines, which is solely mediated by the beta 2AR subtype. In asthmatic patients, a reduced responsiveness of the cAMP-dependent signaling pathway has been observed after an allergen challenge (18, 33). As a consequence of this disturbed inhibitory control mechanism, an augmented expression of IL-3, GM-CSF, and IFN-gamma , which are potent mediators in the development and course of airway inflammation, should be envisaged.

    Footnotes

Address correspondence to: Henk F. Kauffman, Ph.D., Department of Allergology, Clinic for Internal Medicine, University Hospital Groningen, P.O. Box 30001, 9700 RB Groningen, The Netherlands. E-mail: H.F. Kauffman{at}med.rug.nl

(Received in original form September 3, 1996 and in revised form January 13, 1998).

Acknowledgments: The authors thank Dr. S. Gilles and Dr. H. Burger for providing the GM-CSF and IL-3 cDNA probes, respectively. They also thank Dr. C. B. Wilson for providing the IFN-gamma cDNA probe, Dr. S. Narula for the IL-4 cDNA probe, and Zeneca, Merck, Sharp and Dohme, and Smith Kline Beecham for providing ICI 118,551, timolol, and BRL 37344, respectively. This study was supported by a research grant from the Nederlands Astma Fonds (Netherlands Asthma Foundation; grant 92.32).

Abbreviations beta AR, beta -adrenoceptor; cDNA, complementary DNA; Con A, concanavalin A; cAMP, cyclic adenosine monophosphate; cDTP, deoxycytidine triphosphate; DEPC, diethylpyrocarbonate; EC50, effective concentration leading to 50% of the maximal response; FBS, fetal bovine serum; GM-CSF, granulocyte-macrophage colony-stimulating factor; IFN-gamma , interferon-gamma ; IL, interleukin; mRNA, messenger RNA; PCR, polymerase chain reaction; RT, reverse transcriptase; SSC, saline sodium citrate.

    References
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Spengler, R. N., S. W. Chensue, D. A. Giacherio, N. Blenk, and S. L. Kunkel. 1994. Endogenous norepinephrine regulates tumor necrosis factor-alpha production from macrophages in vitro. J. Immunol. 152: 3024-3031 [Abstract].

2. Dokter, W. H. A., M. T. Esselink, S. J. Sierdsema, M. R. Halie, and E. Vellenga. 1993. Transcriptional and post-transcriptional regulation of the interleukin-4 and interleukin-3 genes in human T-cells. Blood 81: 35-40 [Abstract/Free Full Text].

3. Schwarz, R. H.. 1992. Costimulation of T-lymphocytes: the role of CD28, CTLA-4, and B7/BB1 in interleukin 2 production and immunotherapy. Cell 71: 1065-1068 [Medline].

4. Borger, P., H. F. Kauffman, D. S. Postma, and E. Vellenga. 1996. IL-7 differentially modulates the expression of IFN-gamma and IL-4 in activated human T lymphocytes by transcriptional and post-transcriptional mechanisms. J. Immunol. 156: 1333-1338 [Abstract].

5. Borger, P., H. F. Kauffman, D. S. Postma, and E. Vellenga. 1996. Interleukin-4 gene expression in activated human T lymphocytes is regulated by the cyclic adenosine monophosphate-dependent signaling pathway. Blood 87: 691-698 [Abstract/Free Full Text].

6. Borger, P., J. M. J. Vijgen, H. F. Kauffman, D. S. Postma, and E. Vellenga. 1996. Activation of the cAMP dependent signaling pathway downregulates the expression of interleukin-3 and granulocyte/macrophage colony-stimulating factor in activated human T-lymphocytes. Exp. Hematol. 24: 108-115 [Medline].

7. Bourne, H. R., L. M. Lichtenstein, K. L. Melmon, C. S. Henney, Y. Weinstein, and G. M. Shearer. 1974. Modulation of inflammation and immunity by cyclic AMP. Science 184: 19-28 [Free Full Text].

8. Rappaport, R. S., and G. R. Dodge. 1982. Prostaglandin E inhibits the production of human interleukin 2.  J. Exp. Med. 155: 943-948 [Abstract/Free Full Text].

9. Novak, T. J., and E. V. Rothenberg. 1990. cAMP inhibits the expression of interleukin 2 but not of interleukin 4 in T cells. Proc. Natl. Acad. Sci. USA 87: 9353-9357 [Abstract/Free Full Text].

10. Emorine, L. J., S. Marullo, M. M. Briend-Sutren, G. Patey, K. Tate, C. Delavier-Klutchko, and A. D. Strosberg. 1989. Molecular characterization of the human beta 3-adrenergic receptor. Science 245: 1118-1121 [Abstract/Free Full Text].

11. Lefkowitz, R. J., J. M. Stadel, and M. G. Caron. 1983. Adenylyl cyclase coupled beta-adrenergic receptors: structure and mechanism of activation and desensitization. Annu. Rev. Biochem. 52: 159-186 [Medline].

12. Griese, M., U. Korholz, D. Korholz, K. Seeger, V. Wahn, and D. Reinhardt. 1988. Density and agonist-promoted high and low affinity states of the beta -adrenoceptor on human B- and T-cells. Eur. J. Clin. Invest. 18: 213-217 [Medline].

13. Landmann, R. 1992. Beta-adrenergic receptors in human leukocyte subpopulations. Eur. J. Clin. Invest. 22(Suppl. 1):30-36.

14. Paegelow, I., and H. Werner. 1987. Influence of adrenergic agonists and antagonists on lymphokine secretion in vitro. Int. J. Immunopharmacol. 9: 761-768 [Medline].

15. Betz, M., and B. S. Fox. 1991. Prostaglandin E2 inhibits the production of Th1 lymphokines but not of Th2 lymphokines. J. Immunol. 146: 108-113 [Abstract].

16. Muñoz, E., A. M. Zubiaga, M. Merrow, N. P. Sauter, and B. T. Huber. 1990. Cholera toxin discriminates between Th1 and 2 cell receptor mediated activation: role of cAMP in T cell proliferation. J. Exp. Med. 172: 95-103 [Abstract/Free Full Text].

17. Snijdewint, F. G. M., P. Kalinski, E. A. Wierenga, J. D. Bos, and M. L. Kapsenberg. 1993. Prostaglandin E2 differentially modulates secretion profiles of human T helper lymphocytes. J. Immunol. 150: 5321-5329 [Abstract].

18. Meurs, H., G. H. Koëter, K. de Vries, and H. F. Kauffman. 1982. The beta-adrenergic system and allergic bronchial asthma: changes in lymphocyte beta-adrenergic receptor number and adenylyl cyclase activity after an allergen induced attack. J. Allergy Clin. Immunol. 70: 272-280 [Medline].

19. Ying, S., S. R. Durham, C. J. Corrigan, Q. Hamid, and B. Kay. 1995. Phenotype of cells expressing mRNA for TH2-type (interleukin 4 and interleukin 5) and TH1-type (interleukin 2 and interferon gamma ) cytokines in bronchoalveolar lavage and bronchial biopsies from atopic asthmatic and normal control subjects. Am. J. Respir. Cell Mol. Biol. 12: 477-487 [Abstract].

20. Zaagsma, J., and S. R. Nahorski. 1990. Is the adipocyte beta -adrenoceptor a prototype for the recently cloned atypical beta 3-adrenoceptor? TIPS 11: 3-7 .

21. Hollenga, C., F. Brouwer, and J. Zaagsma. 1991. Differences in functional cyclic AMP compartments mediating lipolysis by non-selective agonists in four adipocyte types. Eur. J. Pharmacol. 200: 325-330 [Medline].

22. Vellenga, E., A. Rambaldi, T. J. Ernst, D. Ostapovicz, and J. D. Griffin. 1988. Independent regulation of M-CSF and G-CSF gene expression in human monocytes. Blood 71: 1529-1532 [Abstract/Free Full Text].

23. Maniatis, T., E. F. Fritsch, and A. Sambrook. 1982. Molecular Cloning---A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

24. Feinberg, A. P., and B. Vogelstein. 1983. A technique for labeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132: 6-13 [Medline].

25. Meurs, H., H. F. Kauffman, G. Koëter, and K. de Vries. 1980. Extraction of cyclic AMP for the determination in the competitive protein binding assay. Clin. Chim. Acta 106: 91-97 [Medline].

26. Mackay, D.. 1978. How should values of pA2 and affinity constants for pharmacological competitive antagonists be estimated? J. Pharm. Pharmacol. 30: 312-313 [Medline].

27. Bishopric, N. H., H. J. Cohen, and R. J. Lefkowitz. 1980. Beta-adrenergic receptors in lymphocyte subpopulations. J. Allergy Clin. Immunol. 65: 29-33 [Medline].

28. Dailey, M. O., J. Schreurs, and H. Schulman. 1988. Hormone receptors on cloned T lymphocytes. J. Immunol. 140: 2931-2936 [Abstract].

29. Nijkamp, F. P., F. Engels, P. A. Hendricks, and A. J. M. van Oosterhout. 1992. Mechanisms of beta -adrenergic receptor regulation in lungs and its implications for physiological responses. Physiol. Rev. 72: 323-367 [Free Full Text].

30. Arch, J. R. S., A. T. Ainsworth, M. A. Cawthorne, V. Piercy, M. V. Sennit, V. E. Thody, C. Wilson, and S. Wilson. 1984. Atypical beta -adrenoceptor on brown adipocytes as target for anti-obesity drugs. Nature 309: 163-165 [Medline].

31. Zaagsma, J., L. Meems, and M. Boorsma. 1977. Influence of albumin on in vitro beta -adrenoceptor blocking and antiarrhythmic properties of propranolol, pindolol, practolol and metoprolol. Naunyn-Schmiedeberg's Arch. Pharmacol. 298: 29-36 [Medline].

32. Hollenga, C., M. Haas, J. T. Deinum, and J. Zaagsma. 1991. Differences in functional cyclic AMP mediating lipolysis by isoprenaline and BRL 37344 in four adipocyte types. Eur. J. Pharmacol. 200: 325-330 .

33. Dooper, M. W. S. M., A. Timmermans, E. J. M. Weersink, J. G. R. de Monchy, and H. F. Kauffman. 1995. Defect in potentiation of adenylyl cyclase correlates with bronchial hyperreactivity. J. Allergy Clin. Immunol. 96: 628-634 [Medline].




This article has been cited by other articles:


Home page
 J. Pharmacol. Exp. Ther.Home page
I. Ahmet, M. Krawczyk, W. Zhu, A. Y.-H. Woo, C. Morrell, S. Poosala, R.-p. Xiao, E. G. Lakatta, and M. I. Talan
Cardioprotective and Survival Benefits of Long-Term Combined Therapy with {beta}2 Adrenoreceptor (AR) Agonist and {beta}1 AR Blocker in Dilated Cardiomyopathy Postmyocardial Infarction
J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 491 - 499.
[Abstract] [Full Text] [PDF]

Home page
 CirculationHome page
M. Nishii, T. Inomata, H. Niwano, H. Takehana, I. Takeuchi, H. Nakano, H. Shinagawa, T. Naruke, T. Koitabashi, J.-i. Nakahata, et al.
{beta}2-Adrenergic Agonists Suppress Rat Autoimmune Myocarditis: Potential Role of {beta}2-Adrenergic Stimulants as New Therapeutic Agents for Myocarditis
Circulation, August 29, 2006; 114(9): 936 - 944.
[Abstract] [Full Text] [PDF]

Home page
 Ann. N. Y. Acad. Sci.Home page
E. CALCAGNI and I. ELENKOV
Stress System Activity, Innate and T Helper Cytokines, and Susceptibility to Immune-Related Diseases
Ann. N.Y. Acad. Sci., June 1, 2006; 1069(1): 62 - 76.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
N. W. Kin and V. M. Sanders
It takes nerve to tell T and B cells what to do
J. Leukoc. Biol., June 1, 2006; 79(6): 1093 - 1104.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
M. J. Loza, S. Foster, S. P. Peters, and R. B. Penn
Beta-agonists modulate T-cell functions via direct actions on type 1 and type 2 cells
Blood, March 1, 2006; 107(5): 2052 - 2060.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
D. Chalothorn, H. Zhang, J. A. Clayton, S. A. Thomas, and J. E. Faber
Catecholamines augment collateral vessel growth and angiogenesis in hindlimb ischemia
Am J Physiol Heart Circ Physiol, August 1, 2005; 289(2): H947 - H959.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
E. J. Peek, D. F. Richards, A. Faith, P. Lavender, T. H. Lee, C. J. Corrigan, and C. M. Hawrylowicz
Interleukin-10-Secreting "Regulatory" T Cells Induced by Glucocorticoids and {beta}2-Agonists
Am. J. Respir. Cell Mol. Biol., July 1, 2005; 33(1): 105 - 111.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. Tse, B. A. Marroquin, D. R. Dorscheid, and S. R. White
{beta}-Adrenergic agonists inhibit corticosteroid-induced apoptosis of airway epithelial cells
Am J Physiol Lung Cell Mol Physiol, August 1, 2003; 285(2): L393 - L404.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurol. Neurosurg. PsychiatryHome page
Y Zoukos, T N Thomaides, D Kidd, M L Cuzner, and A Thompson
Expression of {beta}2 adrenoreceptors on peripheral blood mononuclear cells in patients with primary and secondary progressive multiple sclerosis: a longitudinal six month study
J. Neurol. Neurosurg. Psychiatry, February 1, 2003; 74(2): 197 - 202.
[Abstract] [Full Text] [PDF]

Home page
 ThoraxHome page
P A Beckett and P H Howarth
Pharmacotherapy and airway remodelling in asthma?
Thorax, February 1, 2003; 58(2): 163 - 174.
[Abstract] [Full Text] [PDF]

Home page
 Ann. N. Y. Acad. Sci.Home page
I. J. ELENKOV and G. P. CHROUSOS
Stress Hormones, Proinflammatory and Antiinflammatory Cytokines, and Autoimmunity
Ann. N.Y. Acad. Sci., June 1, 2002; 966(1): 290 - 303.
[Abstract] [Full Text] [PDF]

Home page
 Pharmacol. Rev.Home page
A. P. Kohm and V. M. Sanders
Norepinephrine and beta 2-Adrenergic Receptor Stimulation Regulate CD4+ T and B Lymphocyte Function in Vitro and in Vivo
Pharmacol. Rev., December 1, 2001; 53(4): 487 - 525.
[Abstract] [Full Text] [PDF]

Home page
 Eur Respir JHome page
S.H. Korn, A. Jerre, and R. Brattsand
Effects of formoterol and budesonide on GM-CSF and IL-8 secretion by triggered human bronchial epithelial cells
Eur. Respir. J., June 1, 2001; 17(6): 1070 - 1077.
[Abstract] [Full Text] [PDF]

Home page
 Pharmacol. Rev.Home page
I. J. Elenkov, R. L. Wilder, G. P. Chrousos, and E. S. Vizi
The Sympathetic Nerve---An Integrative Interface between Two Supersystems: The Brain and the Immune System
Pharmacol. Rev., December 1, 2000; 52(4): 595 - 638.
[Abstract] [Full Text] [PDF]

Home page
 Ann. N. Y. Acad. Sci.Home page
I. J. ELENKOV, G. P. CHROUSOS, and R. L. WILDER
Neuroendocrine Regulation of IL-12 and TNF-{alpha}/IL-10 Balance: Clinical Implications
Ann. N.Y. Acad. Sci., January 1, 2000; 917(1): 94 - 105.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Borger, P.
Right arrow Articles by Kauffman, H. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Borger, P.
Right arrow Articles by Kauffman, H. F.