Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

Pulmonary surfactant is a lipoprotein substance, synthesized and secreted by alveolar type II cells, that reduces surface tension at the air-alveolar interface (1). Surfactant protein (SP)-A is the most abundant and best characterized surfactant-associated protein (2). SP-A, in combination with SP-B and SP-C, facilitates the spreading and surface-tension lowering properties of pulmonary surfactant phospholipids (3). SP-A has also been shown to regulate surfactant phospholipid synthesis, secretion, and recycling (4). There is increasing evidence that SP-A is also involved in local defense mechanisms against pathogens such as bacteria and viruses (7).

Human SP-A protein migrates at about 35 kD and is a sialoglycoprotein with an acidic isoelectric point (~ pI 4.5) (8, 9). Human SP-A is encoded by two genes, SP-A1 and SP-A2, that are 94% identical in nucleotide sequence and 96% identical in amino acid sequence (10, 11). It has been hypothesized that the human SP-A trimer is a heterotrimer composed of two SP-A1 molecules and one SP-A2 molecule (12). The native SP-A molecule found in the lung is thought to be a trimer of the 35-kD SP-A protein that aggregates in clusters of six SP-A trimers, forming a flower-bouquet-type arrangement (12).

SP-A protein and messenger RNA (mRNA) have been detected in alveolar type II cells and in bronchiolar epithelial cells in adult human lung tissue (13, 14). In mid-trimester fetal human lung, SP-A protein and mRNA have been detected in the tracheal and bronchial epithelium and in submucosal glands (15, 16). Toward the end of gestation in the human fetus, SP-A protein is found in alveolar type II cells (17). SP-A protein has also been detected in middle- ear epithelium, which is a respiratory epithelium similar to the epithelium that lines the trachea and lung bronchi (18). In addition, SP-A has been detected in epithelial cells of the intestine (19).

In the present study, we characterized the SP-A mRNA present in mid-trimester human fetal trachea and airways. We found that only the SP-A2 gene was expressed in the fetal airway epithelium and submucosal glands. Thus, it is possible that the SP-A produced in the lung airways may differ from the SP-A produced in the type II cells of the distal lung.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

Tissue

The experimental protocol for this study was approved by the Human Subjects Research Review Committee at the University of Iowa (Iowa City, IA). Fetal lung tissue was obtained from mid-trimester abortuses and placed in serum-free Waymouth's MB 752/1 medium that contained 100 U/ml penicillin G, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin B (GIBCO BRL, Grand Island, NY). For some experiments, tissue was obtained from Advanced Bioscience Resources (Alameda, CA). Peripheral lung tissue was separated from the trachea, major bronchi, and blood vessels using forceps and a dissecting microscope. The trachea, primary bronchi, and the next four to five orders of bronchi were dissected, placed in sterile microfuge tubes, and snap-frozen in liquid N₂. A piece of distal lung tissue was also collected and frozen for comparison. Cultured human fetal lung explants were also used in the study. Peripheral lung tissue was minced and maintained in explant culture for 6 d, as described previously (20). Experiments were repeated four to five times for each protocol, using tissue from a different fetus for each experiment.

Immunostaining

The frozen tissues were mounted in O.C.T. compound, then 7-µm frozen sections were prepared with a cryostat and thaw-mounted on glass slides. Sections were fixed for 10 min at room temperature in freshly prepared 10% formalin in phosphate-buffered saline (PBS). The sections were then rinsed twice, 10 min per rinse, in PBS. The sections were immunostained for SP-A using a Vectastain Elite kit (Vector Labs, Burlingame, CA). Nonspecific binding sites were blocked by incubating the sections with 2% normal goat serum at room temperature. The sections were quickly rinsed in PBS, then incubated for 1 h in a humidified chamber at room temperature with guinea-pig antihuman SP-A antiserum at a dilution of 1:500 in PBS. The tissue sections were washed twice in PBS, 5 min per rinse, then incubated for 30 min in a biotinylated secondary antibody, then rinsed twice in PBS, 5 min per rinse. The sections were then incubated for 45 min in avidin-peroxidase reagent. After rinsing twice in PBS, 5 min per rinse, the sections were incubated in diaminobenzidine (0.7 mg/ml; Sigma, St. Louis, MO) for 1 to 3 min. Sections were rinsed in PBS for 5 min, quickly rinsed in distilled water, then dehydrated and mounted with coverslips. In some experiments, the sections were counterstained with hematoxylin for 30 s. Negative controls involved incubating the sections with either nonimmune guinea pig serum at the same concentration as the primary antibody, with antiserum that had been preabsorbed overnight at 4°C with purified human SP-A (10 µg) or with secondary antibody alone, and were performed in all experiments. The human SP-A was purified from alveolar proteinosis lavage material (21). Sections were viewed and photographed with a Nikon FX photomicroscope (Nikon, Melville, NY).

RNA Isolation

The frozen tissues (50-100 mg) were homogenized in 1 ml of RNA extraction mixture, and total RNA was isolated as described previously (22, 23). The precipitated total RNA pellet was washed with 1 ml 75% ethanol, air-dried, and resuspended in 25 ml sterile diethylpropylcarbonate-treated water (24). Following quantitation of total RNA by determining the ultraviolet (UV) absorbence at 260 nm, equal amounts of total RNA (10 µg) from each sample were separated by gel electrophoresis on a 1.0% agarose/5% formaldehyde gel, and was capillary transferred to Nytran Plus membranes (Schleicher & Schuell, Keene, NH) using a phosphate buffer as described previously (23). The ethidium bromide-stained ribosomal RNA bands in the agarose gel were photographed on a UV lightbox. The RNA was cross-linked to the Nytran membrane by UV irradiation for 2 min in a GS Gene Linker (Bio-Rad, Hercules, CA).

Northern Blot Analysis

The human complementary DNA (cDNA) probe for SP-A (a kind gift of Dr. J. Whitsett, University of Cincinnati, Cincinnati, OH) was radiolabeled with [³²P]deoxycytosine triphosphate (~ 3,000 Ci/mmol; Amersham, Bedford, MA) using a random primer kit (Boehringer Mannheim, Indianapolis, IN). Northern blot analysis was performed essentially as described previously (23). The Nytran membranes were prehybridized for 6 h at 42°C in hybridization buffer, then the radiolabeled cDNA probe (1 × 10⁶ cpm/ml final concentration) was added and the membranes incubated overnight. The membranes were then washed, wrapped in plastic wrap, and exposed to X-ray film (Eastman Kodak Co., Rochester, NY) with an intensifier screen for up to 5 d at 70°C. Northern blot analysis for SP-A mRNA was performed on 13 different airway specimens.

Primer Extension Analysis

An oligonucleotide primer (GGGGATACCAGGGCTTCCAACACAAACG) that is complimentary to nucleotides 1117-1144 of human SP-A1 gene (25) and nucleotides 1144-1171 of human SP-A2 gene (11) was labeled at its 5' end using ³²P-adenosine triphosphate (5,000 Ci/mmol; Amersham) and T4 polynucleotide kinase (New England Biolabs, Beverly, MA), as described previously (26, 27). The unincorporated radioactive nucleotide was removed with a Sephadex G-25 quick-spin column (Boehringer Mannheim). Primer extension was carried out using a modification of a standard protocol (23). Primer extension analysis was performed only on airway RNA samples in which SP-A mRNA was detectable by Northern blot analysis. Five micrograms of total RNA were incubated with 0.2 pmol of the radiolabeled primer for 10 min at 70°C and then cooled on ice for 10 min. The primer was extended using 200 units of Superscript II reverse transcriptase (GIBCO BRL) at 42°C for 1 h in 20 µl reaction buffer containing Tris-HCl (50 mM, pH 8.3), KCl (75 mM), MgCl₂ (3 mM), dATP, dGTP, dCTP, and dTTP (1 mM of each), 20 U of ribonuclease (RNase) inhibitor, dithiothreitol (1 mM), and actinomycin D (50 µg/ ml). The reaction was stopped by adding 1 µl of ethylenediamenetetraacetic acid (EDTA; 0.5 M, pH 8.0), and the RNA was digested by adding 1 µl of deoxyribonuclease-free RNase (5 µg/ml) and incubating at 37°C for 30 min. The radiolabeled DNA transcripts were extracted by adding 150 µl TEN 100 buffer (Tris-HCl [10 mM, pH 7.6], EDTA [1 mM], and NaCl [100 mM]) and 200 µl of 25:24:1 phenol:chloroform:isoamyl alcohol, mixing, then centrifuging at 12,000 × g for 5 min at room temperature. The supernatant was transferred to a microcentrifuge tube containing 500 µl of ice-cold 100% ethanol and the labeled transcripts were precipitated by incubation at 20°C for 1 h followed by centrifugation at 12,000 × g for 10 min at 4°C. The pellet was washed with 75% ethanol and resuspended in 4 µl buffer (10 mM Tris-HCl, pH 7.6, and 1 mM EDTA). A total of 6 µl of formamide loading buffer (80% formamide, 10 mM EDTA [pH 8.0], 1 mg/ml xylene cyanol, and 1 mg/ml bromophenol blue) was added to each sample. A 6% polyacrylamide/7 M urea sequencing gel was poured and allowed to polymerize for at least 2 h. The gel was pre-run at a constant power of 58 W for 30 min. The samples were denatured at 95°C for 2 min, placed on ice for 5 min, and then loaded into the sequencing gel wells. The loaded gel was electrophoresed at 58 W until the blue tracking dye reached the bottom of the gel. The gel was transferred to a filter paper and dried using a gel drier (Bio-Rad). The dried gel was exposed to X-ray film with an intensifier screen (Lighting Plus; Dupont, Wilmington, DE) at 70°C.

In Situ Hybridization

Frozen sections (7-µm thick) were cut at 20°C and mounted on glass slides (Superfrost Plus; Fisher, Chicago, IL). Sections from trachea, primary bronchi, smaller bronchi, undifferentiated distal lung tissue, and cultured human fetal lung explants were mounted on each slide to facilitate comparison. The methods used for in situ hybridization were modifications of those originally described by Angerer and Angerer (28). The sections were allowed to come to room temperature, then fixed in freshly prepared paraformaldehyde (4%, wt/vol, pH 7.5). After several rinses in PBS (pH 7.4), the tissues were incubated in a Pronase solution (0.25 mg/ml in Tris-HCl [50 mM, pH 7.5] and EDTA [5 mM]). After incubation in PBS that contained glycine (2 mg/ml) for 10 min, the sections were rinsed in triethanolamine buffer (0.1 M, pH 8.0), then treated with acetic anhydride (0.25%) in the same buffer for 10 min. Sections were rinsed in 2× sodium chloride, sodium citrate buffer (SSC) (1× = sodium chloride [NaCl, 150 mM], sodium citrate [15 mM], pH 7.0), then dehydrated through an ethanol series.

A total of 50 µl of hybridization buffer (NaCl [300 mM], Tris-HCl [10 mM, pH 8.0], EDTA [1 mM], formamide [50%, vol/vol], 1× Denhardt's solution [Sigma], dextran sulfate [10%, wt/vol], and yeast transfer RNA [0.28 mg/ml]) that contained the sense or antisense [³H]cRNA probe (~ 3 × 10⁵ cpm) was applied to each slide. A coverslip (HybriWell Chambers; Lab Vision Corp., Fremont, CA) was then placed on top of the sections and sealed. The slides were incubated at 60°C overnight in a humid chamber. After removal of the coverslip, the slides were rinsed four times in 4× SSC for 10 min. The sections were then incubated for 30 min at 37°C in a solution of RNase A (20.0 µg/ml) and RNase T1 (3.0 U/ml) in buffer (Tris-HCl [10 mM, pH 8.0], EDTA [1 mM], and NaCl [0.5 M]). The sections were then rinsed for 30 min at 37°C in buffer (Tris-HCl [10 mM, pH 8.0], EDTA [2.5 mM], and NaCl [0.5 M]), then in 2× SSC for 30 min at room temperature, 0.1× SSC at 56°C for 30 min, and 0.1× SSC at room temperature for 30 min. The sections were dehydrated through an ethanol series and air-dried, then coated with NTB-2 emulsion (Kodak), dried in a slide oven, and exposed in light-proof boxes at 4°C. The photographs of SP-A mRNA hybridization presented in the manuscript are taken from slides that were exposed for approximately 3 wk. The autoradiograms were developed in D-19 developer, rinsed in distilled water, fixed in rapid fixer, rinsed in distilled water, stained in hematoxylin, then dehydrated and mounted with coverslips.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

SP-A protein was localized in human fetal trachea and bronchi using avidin-biotin-immunoperoxidase staining and an antiserum directed against human SP-A. SP-A protein was detected in scattered surface epithelial cells (Figure 1A). However, the strongest immunoreactivity was present in submucosal glands present in the trachea and bronchi (Figure 1A). Staining controls were negative (Figure 1B). In experiments in which the antiserum was preabsorbed with purified human SP-A, all staining was abolished (data not shown). Preabsorption with human serum did not alter the SP-A staining pattern or intensity (data not shown).

View larger version (72K): [in this window] [in a new window]   Figure 1.   Immunolocalization of SP-A protein in human fetal trachea. Frozen sections of trachea obtained from a 20-wk gestational-age fetus were immunostained using a guinea pig antihuman SP-A antiserum (A) or nonimmune guinea pig serum as a control (B). Scattered epithelial cells within the tracheal surface epithelium were stained (A, arrows). The most intense staining was observed in submucosal glands (A, arrowheads). Only background staining was observed in the nonimmune guinea pig serum control (B). The lumen of the trachea is indicated by L and cartilage is indicated by C. The bar represents 50 µm.

Northern blot analysis was used to detect SP-A mRNA in human fetal trachea, primary bronchi, smaller bronchi, and distal fetal lung tissue, and in cultured human fetal lung explants (Figure 2). SP-A mRNA was detectable in seven of 13 trachea and pulmonary airway samples and, when detected, was present in very low levels in the distal fetal lung tissue (Figure 2, top). SP-A mRNA was detected in the primary bronchus and, in smaller amounts, in the more distal bronchi. SP-A mRNA was barely detectable in the distal lung tissue of eight of 13 specimens (Figure 2, bottom). However, after explants of distal fetal lung tissue were cultured for 6 d, abundant SP-A mRNA was present in all specimens (Figure 2, bottom). The size of the SP-A mRNA detected in the Northern blots of the tracheal and bronchial samples versus the cultured fetal lung explant tissue did not appear to differ.

View larger version (73K): [in this window] [in a new window]   View larger version (58K): [in this window] [in a new window]   Figure 2.   Northern blot analysis of SP-A mRNA in human fetal trachea, primary bronchi, distal airways, and distal peripheral lung tissue, and in cultured human fetal lung explants. Ten micrograms of total RNA from each sample were separated by agarose gel electrophoresis, transferred to a membrane, and hybridized with a human SP-A cDNA probe. (Top panel ) A 2.2-kb SP-A mRNA band was detected in the trachea and distal lung tissue obtained from one fetus (lanes A and B, respectively). In tissues obtained from another fetus, SP-A mRNA was present in the trachea and primary bronchi, and was barely detectable in the distal lung (lanes C, D, and E, respectively). (Bottom panel ) SP-A mRNA was detected in human fetal primary bronchus (lane A), distal bronchi (lane B), and distal peripheral lung tissue (lane C), all from the same fetus, and in cultured human fetal lung explants (lane D). The relative amount of SP-A mRNA was high in the fetal primary bronchus, decreased in the more distal airways, and barely detectable in the distal lung. The cultured human fetal lung explants contained abundant SP-A mRNA.

Human SP-A is encoded by two genes, SP-A1 and SP-A2 (11). We used primer extension analysis to characterize the relative amounts of SP-A1 and SP-A2 mRNA present in human fetal airways, distal human fetal lung tissue, cultured human fetal lung explants, and adult human distal lung tissue (26, 27). Both SP-A1 and SP-A2 mRNA transcripts were present in all of the cultured human fetal lung explants and in adult human lung tissue (Figure 3, right panel ). In five distal human fetal lung specimens analyzed by primer extension, only two had detectable SP-A mRNA, and they contained only SP-A1 mRNA (Figure 3, left panel ). In the seven human lung airway specimens in which SP-A mRNA was detected by Northern blot analysis, only SP-A2 mRNA was detected by primer extension (Figure 3). The size of the SP-A2 mRNA primer extension product detected in the airway samples was the same as that detected in the cultured human fetal lung explants and in the adult human lung tissue (Figure 3).

View larger version (77K): [in this window] [in a new window]   View larger version (56K): [in this window] [in a new window]   Figure 3.   Primer extension analysis of SP-A1 and SP-A2 mRNA transcripts. (Left panel ) Five micrograms of total RNA isolated from a bronchus specimen (lane A), three different distal fetal lung tissues (lanes B, C, and D), and cultured human fetal lung explants (lane E) were used in a primer extension assay. The major SP-A1 and SP-A2 mRNA transcripts are indicated by arrows. Only SP-A2 mRNA was detected in the bronchus (lane A), while very low levels of SP-A1 mRNA were detected in two of three distal lung specimens (lanes C and D). RNA from cultured human fetal lung explants contained both SP-A1 and SP-A2 mRNA transcripts (lane E). (Right panel ) Five micrograms of total RNA isolated from human fetal lung explants cultured in vitro (lane A), human fetal trachea (lane B), and adult human lung tissue (lane C) were used in a primer extension assay. The major SP-A1 and SP-A2 mRNA transcripts are indicated by arrows. SP-A1 and SP-A2 mRNA transcripts were detected in the cultured human fetal distal lung explants and in adult distal lung tissue (lanes A and C, respectively). Only SP-A2 mRNA transcripts were detected in the human fetal trachea (lane B).

In situ hybridization was used to localize SP-A mRNA in human fetal trachea. In the most immature samples studied, SP-A mRNA was localized in scattered surface epithelial cells (Figures 4A and 4B). In fetal tracheas in which submucosal gland morphogenesis had begun, most of the SP-A mRNA was present in the invaginating glands (Figures 4C and 4D). At higher magnification, it was observed that a few scattered surface epithelial cells containing SP-A mRNA were still present and frequently flanked the regions where submucosal gland invagination was occurring (Figures 5A, 5B, and 5D). The majority of SP-A mRNA was present in clusters of epithelial cells in the submucosal glands (Figures 5C and 5D). Frequently, the most distal portion of the submucosal gland contained the cells that expressed SP-A mRNA (Figures 4C and 4D, and Figure 5). Only background autoradiographic grains were observed in control slides that were hybridized with sense cRNA probes (data not shown).

View larger version (153K): [in this window] [in a new window]   Figure 4.   In situ hybridization of SP-A mRNA in human fetal trachea. A (brightfield) and B (darkfield) show localization of SP-A mRNA in scattered epithelial cells of 19-wk gestational-age trachea (arrows). C (brightfield) and D (darkfield) show SP-A mRNA hybridization in fetal trachea from an 18-wk gestational-age fetus. Scattered surface epithelial cells contain SP-A mRNA (arrows). Submucosal gland progenitors contained abundant SP-A mRNA in distal epithelial cells (arrowheads). L indicates the tracheal lumen. The bar indicates 50 µm.

View larger version (123K): [in this window] [in a new window]   Figure 5.   In situ hybridization of SP-A mRNA in human fetal trachea. A (brightfield) and B (darkfield) show SP-A mRNA localization in tissue from a 20-wk gestational-age fetus. SP-A mRNA was detected in a few surface epithelial cells (arrows) and in submucosal gland epithelial cells (arrowheads). C and D are brightfield photomicrographs of SP-A mRNA hybridization in fetal trachea obtained from two different 18-wk gestational-age fetuses. SP-A mRNA was abundant in epithelial cells of submucosal glands (arrowheads, C). The tracheal lumen is indicated by an L and the lumen of the glandular duct is indicated by DL. In D, a few scattered surface epithelial cells contain SP-A mRNA (arrows) but the majority of hybridization is present in distal submucosal gland epithelial cells (arrowheads). Surface epithelial cells close to the origin of the submucosal glands frequently contained SP-A mRNA (arrows). The bar indicates 50 µm.

SP-A mRNA was not detected in the uncultured distal human fetal lung tissue (Figures 6A and 6B). In contrast, abundant SP-A mRNA was present in epithelial cells of cultured human fetal lung explants (Figures 6C and 6D). Most, but not all, of the epithelial cells in the explants contained SP-A mRNA. Clusters of cells that contained large amounts of SP-A mRNA were present at sites where several prealveolar ducts were in apposition. These sites were frequently close to connective tissue. In contrast, areas of flattened epithelium with little adjacent connective tissue contained much lower amounts of SP-A mRNA (Figures 6C and 6D).

View larger version (149K): [in this window] [in a new window]   Figure 6.   In situ hybridization of human SP-A mRNA in undifferentiated human fetal distal lung tissue and in human fetal distal lung explants cultured in vitro for 6 d. A (brightfield) and B (darkfield) show that little SP-A mRNA is present in the distal lung at this stage of development. L indicates the lumen of prealveolar ducts, CT indicates connective tissue, and the arrows indicate the epithelium of the prealveolar ducts. C (brightfield) and D (darkfield) are photomicrographs of SP-A mRNA localization in cultured human distal fetal lung explants. SP-A mRNA was present in the majority of epithelial cells in the explants. SP-A mRNA was particularly abundant (arrows) in clusters of epithelial cells located at sites where connective tissue was adjacent and where several prealveolar ducts were in apposition. The bar indicates 50 µm.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

The cDNA sequences for the two human SP-A mRNAs were first described by Floros and colleagues in 1986 (10). Although these investigators reported the existence of two similar but different cDNAs in their study, it was not fully appreciated that there were in fact two human SP-A genes until the report of Katyal and associates in 1992 (11). All of the investigations in which SP-A mRNA has been localized in human lung tissue have been performed using reagents that recognize both SP-A mRNAs. Phelps and Floros localized SP-A mRNA in adult human lung tissue in alveolar type II cells and reported that no SP-A mRNA was detectable in lung airways (13). Subsequently, Auten and coworkers showed that SP-A mRNA was present in bronchiolar epithelium of adult human lung tissue (14). Broers and colleagues also reported that SP-A mRNA is present in bronchial and bronchiolar epithelial cells of adult human lung tissue (29). None of these investigators reported the presence of SP-A mRNA in submucosal glands of adult human lung airways. However, we have detected SP-A mRNA in the distal serous portion of submucosal glands of bronchi in adult human lung tissue (J. M. Snyder and J. F. Engelhardt, unpublished observations).

In human fetal lung, in contrast to the adult lung, SP-A protein and mRNA have been detected in trachea, bronchi, and bronchiolar epithelium, and in submucosal glands (15, 16). Endo and Oka reported the presence of immunoreactive SP-A in the epithelium of main and segmental bronchi and in submucosal glands (15). They reported that the number of immunoreactive cells in the airways increased until about 32 wk of gestation and then decreased until term (15). Immunoreactive SP-A protein was detected in airways of one of three adult lung samples included in their study (15). Khoor and associates, in an extensive study of human fetal lung throughout gestation, found that SP-A mRNA and protein were present in tracheal epithelium and submucosal glands as well as in the same sites in bronchi of some infants (16). Toward term, the pattern of SP-A localization was not appreciably different from that earlier in gestation. Khoor and colleagues noted that SP-A-immunostained surface epithelial cells in the airways of human fetal lung tissue were frequently located in mucosal folds near the origin of submucosal gland ducts (16). We also frequently detected cells containing SP-A protein and mRNA at the junction between the surface epithelium and the origin of the developing submucosal glands. Thus, our finding with respect to immunostaining for SP-A protein and in situ hybridization for SP-A mRNA is in good agreement with the studies of Endo and Oka (15) and Khoor and coworkers (16). In our study, we noted that SP-A mRNA was particularly abundant in the distal portion of the developing submucosal gland, the portion that will differentiate into the serous portion of the gland (30). Interestingly, the cystic fibrosis transmembrane conductance regulator (CFTR) has been localized to the orifice region and the distal serous portion of submucosal glands in adult human lung tissue, a localization similar to the one we observed for SP-A in fetal lung in the present study (31). We have previously reported that CFTR mRNA can be detected in alveolar type II cells in human fetal lung explants, cells which also express SP-A mRNA (32). Thus, it is possible that cells which express the CFTR also express SP-A in the lung.

Using Northern blot analysis of RNA isolated from dissected trachea, primary bronchi, distal bronchi, and distal peripheral lung tissue from human fetal lung tissue, we detected a gradient of SP-A mRNA present in these structures, with the trachea containing the highest amounts of SP-A mRNA. This may reflect a proximal-to-distal gradient in the morphogenesis of submucosal glands in the human fetal lung and/or the relative number of submucosal glands present in these anatomically distinct sites. In addition, we observed that about half of the trachea or lower airway samples contained detectable SP-A, a proportion similar to the observations of Khoor and associates (16). SP-A mRNA was either not detected or was barely detectable in the distal lung by Northern blot analysis in the early mid-trimester tissues examined in our study.

In humans, SP-A is encoded by two genes (11). By use of Northern blot analysis, polymerase chain reaction, and primer extension analysis, both SP-A1 and SP-A2 mRNA appear to be present in fetal and adult human lung alveolar type II cells (11, 27, 33). McCormick and coworkers used several different primers in their primer extension analyses of human fetal lung RNA (27). Primer B, as described in their study, was used for detecting all of the SP-A1 and SP-A2 mRNA transcripts (27). Primer extension analysis using this primer in our studies detected all of the SP-A1 and SP-A2 transcripts in RNA from cultured human fetal lung explants and from adult human lung. We did not detect any SP-A mRNA transcripts in the undifferentiated distal human fetal lung tissue that were negative for SP-A mRNA by Northern blot analysis. Karinch and Floros also used a single primer to detect all of the SP-A1 and SP-A2 mRNA transcripts in human lung RNA (33). It has been reported that SP-A1 mRNA is present prior to SP-A2 mRNA in distal human fetal lung tissue (34). Our results are in agreement with this observation. In addition, it has been reported that the SP-A2 gene in human fetal distal lung explants is more responsive to the stimulatory effects of cyclic adenosine monophosphate and the inhibitory effects of dexamethasone than the SP-A1 gene (34). To date, neither SP-A mRNA species has been localized by in situ hybridization. In the present study, however, using primer extension analysis, we found that only SP-A2 mRNA was present in RNA isolated from human fetal lung trachea and bronchi. Thus, we conclude that the SP-A immunostaining and SP-A mRNA detected in human fetal trachea and airways in fact represented SP-A2 protein and mRNA, respectively.

The SP-A protein present in the distal lung is synthesized by alveolar type II cells and is the predominant form of SP-A present in the lung. The secreted form of the SP-A present in the alveolus is hypothesized to be a heterotrimer that consists of two SP-A1 molecules and one SP-A2 molecule that in turn aggregate in groups of six to form a flower-bouquet structure (12). Immunoreactive SP-A with a molecular weight of 80 kD has been detected in human middle-ear fluids (18). SP-A immunostaining was present in epithelial cells of the eustachian tube and on the surface of the epithelium lining the middle ear (18). The eustachian tube and middle-ear cavity are lined by respiratory epithelium with submucosal glands similar to that of the trachea and bronchi of the lung (35). SP-A has also been detected in the rat intestine (19). The molecular weights of the SP-A protein present in the intestine were variable and included higher molecular weight forms than present in the SP-A protein purified from secreted surfactant. Voss and colleagues have reported that purified SP-A2 tends to form aggregates of two trimers with a structure that is quite different from the much larger aggregates formed by purified SP-A1, and from the flower-bouquet structures formed by mixtures of SP-A1 and SP-A2 (12). The native form of the SP-A2 protein present in the airway epithelium and submucosal glands is presently unknown.