help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tuvim, M. J.
Right arrow Articles by Dickey, B. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tuvim, M. J.
Right arrow Articles by Dickey, B. F.
Am. J. Respir. Cell Mol. Biol., Volume 20, Number 1, January 1999 79-89

Rab3D, a Small GTPase, Is Localized on Mast Cell Secretory Granules and Translocates to the Plasma Membrane upon Exocytosis

Michael J. Tuvim, Roberto Adachi, Jose F. Chocano, Robert H. Moore, Robert M. Lampert, Evelyn Zera, Elkin Romero, Brian J. Knoll, and Burton F. Dickey

Departments of Medicine, Pediatrics, and Molecular Physiology and Biophysics, Baylor College of Medicine, Houston, Texas


    Abstract

Abstract
Introduction
Materials and Methods
Results
Discussion
References

Although mast cell secretion has been intensively studied because of its pivotal role in allergic reactions and its advantages as a physiologic model, the molecular composition of the secretory machine is virtually unknown. In view of the guanine-nucleotide dependency of mast cell exocytosis and the participation of Rab3 proteins in synaptic vesicle release, we hypothesized that a Rab3 isoform regulates mast cell secretion. Fragments of Rab3A, 3B, and 3D were cloned from RBL-2H3 mast cells by reverse transcription- polymerase chain reaction (RT-PCR). Northern blot analysis revealed Rab3D transcripts to be relatively abundant, Rab3B substantially less so, and Rab3A and 3C undetectable. By ribonuclease (RNase) protection assay, Rab3D transcripts were at least 10-fold more abundant than those of other isoforms, and by immunoblot analysis, Rab3D protein was at least 60-fold more abundant than that of Rab3B. Rab3D was more abundant in RBL cells than in brain, but the total mass of Rab3 proteins in RBL cells was 10-fold less than in brain. Rab3D only partly colocalized with secretory granules in RBL cells, but fully colocalized in mature peritoneal mast cells. There was a descending concentration gradient of Rab3D from peripheral to central granules, and no cytoplasmic pool was detectable in resting mast cells. Following exocytotic degranulation, Rab3D translocated to the plasma membrane and remained there for at least 15 min. These studies suggest that Rab3D is a component of the regulated exocytotic machine of mast cells, and identify differences between mast cells and neurons in Rab3 expression and trafficking.


    Introduction

Abstract
Introduction
Materials and Methods
Results
Discussion
References

Mast cell secretion has been intensively studied because of the central role it plays in allergic reactions and its advantages as a physiologic model of exocytosis. As a result of this focus, the role of guanosine triphosphatases (GTPases) in vesicular transport was first revealed when the hydrolysis-resistant guanosine triphosphate (GTP) analog GTPYS induced exocytosis when introduced into the mast cell interior (1). Subsequent work has shown that several GTPase families, including Rabs, adenosine diphosphate ribosylation factors (ARFs), dynamin, and trimeric G-proteins, regulate distinct aspects of intercompartmental transport (2). However, the molecular identity of the target of GTPYS in mast cell exocytosis remains unknown and its regulatory pathway unexplored. Rab3 proteins are candidate targets because of their implication in regulated exocytosis by several lines of evidence: They are physically associated with secretory organelles in a variety of cells (5), their GTPase cycle is temporally associated with synaptic vesicle release (5, 11), changes in Rab3 expression are associated with changes in exocytotic function in a variety of cells (6, 12- 18), and Rab3 "effector region" peptides induce mast cell exocytosis (19).

Despite this evidence for the regulation of exocytosis by Rab3, there has been reluctance to infer that Rab3 proteins can be activated by GTPYS, because other Rab-dependent vesicular transport processes are inhibited by GTPYS (20). By analogy with the inhibition of protein synthesis by GTPYS, Rab function in vesicle transport was postulated to be conditional on GTP hydrolysis (25). However, more recent experiments have resolved this paradox. Rab mutants defective in GTP hydrolysis (26), Rab proteins preloaded with GTPYS (29), and Rab mutants with switched nucleotide specificity that can be selectively targeted by xanthine nucleotides (30, 31) each stimulated vesicle transport. Thus, Rab proteins appear universally to be active when liganded with triphosphate nucleosides, and the inhibitory effect of GTPYS in some transport assays appears to be due to binding to other GTPases, such as ARF proteins (31). Rab3 proteins have therefore reemerged as plausible targets of GTPYS in mast cell exocytosis.

Four isoforms of Rab3 (A to D) have been identified in mammalian cells, and these are highly conserved across species (Figure 1). Comparing all known isoforms regardless of the species of origin, Rab3 isoforms are 72% to 83% identical to each other at the amino acid level, but less than 50% identical to other Rab proteins. Rab3A and Rab3C are primarily expressed in the nervous system (11), whereas Rab3B and Rab3D have been found in endocrine, exocrine, epithelial, and fat cells (7, 8, 32, 33). Although functional studies of Rab3 isoforms suggest that they participate in regulated exocytosis (see the preceding discussion), their molecular physiology remains poorly understood. The mast cell has unique advantages for the analysis of exocytosis that promise novel insight into the function of Rab3 proteins (34). As part of this analysis, we determined the expression and intercompartmental trafficking of Rab3 proteins in mast cells.


View larger version (74K):
[in this window]
[in a new window]
 
Figure 1.   Alignment of Rab3 isoforms. The inferred amino acid sequences of all known mammalian isoforms of Rab3 are aligned with H-Ras. Accession numbers are listed after each protein's name, conserved G-domains are shaded, the regions corresponding to the Rab3-specific PCR primers used herein are double- underlined, the peptide antigen used for the Rab3D-specific antiserum is shown in outline (8, 52), and the mapped epitope of pan-Rab3 monoclonal antibody 42.1 is underlined (45). The rat Rab3B sequence is a composite of a previously cloned fragment (47) and the PCR product reported in this article. The rat Rab3D sequence was originally reported as Rab16 (43), but is 98% identical to mouse Rab3D when corrected for two sequencing errors that resulted in a local frameshift encompassing 12 amino acids (a missed guanine in the first position of the codon for alanine 97, and extra cytosine in the codon for glutamine 110).

    Materials and Methods

Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cell Culture and Measurement of Secretion

RBL-2H3 cells (hereafter referred to as "RBL cells"), antidinitrophenol (anti-DNP) immunoglobulin E (IgE), and DNP-bovine serum albumin (DNP-BSA) were gifts from Dr. Fu-Tong Liu (La Jolla Institute for Allergy and Immunology, San Diego, CA). Cells were grown in RPMI 1640 medium with 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin (Life Technologies, Gaithersburg, MD), and were subcultured every 3 to 4 d when confluent. Their secretory phenotype was assessed by measurement of antigen-induced beta -glucuronidase release as follows: 48-well plates were coated with fibronectin (37), and ~ 400,000 RBL cells were aliquoted per well. Anti-DNP IgE was added to a final concentration of 1 µg/ml, and the cells were incubated overnight. Medium was then replaced with 1,4-piperazinediethanesulfonic acid (PIPES) buffer (25 mM PIPES, pH 7.0; 1 mM CaCl2; 100 mM NaCl; 5 mM KCl; 0.4 mM MgCl2; 5.6 mM glucose; 0.1% BSA), and secretion was triggered by 20 ng/ml DNP-BSA. After 30 min, beta -glucuronidase activity of cell supernatants and 5% Triton X-100 lysates was measured spectrophotometrically at 540 nm as the hydrolysis of phenolphthalein glucoronic acid (38).

Rat peritoneal mast cells were obtained from adult Sprague-Dawley rats anesthetized with ketamine (42.8 mg/ ml)/xylazine (8.6 mg/ml)/acepromazine (1.4 mg/ml; 3 ml/ kg), decapitated, and exsanguinated. The peritoneal cavity was then opened with a midline incision and lavaged with iced 4-(2-hydroxyethyl)-1-piperazine-N'-2-ethanesulfonic acid (HEPES)-Tyrode's buffer with heparin (HTH) (137 mM NaCl; 2.7 mM KCl; 0.4 mM NaH2PO4; 1 mM CaCl2; 10 mM HEPES, pH 7.4; 0.1% BSA; 5.6 mM glucose; 30 U/ ml heparin). Pooled cells from six to 10 rats were pelleted by centrifugation at 400 × g for 15 min, resuspended in 10 ml HTH, and layered over 30% (20 ml) and 80% (15 ml) Percoll (Pharmacia LKB, Piscataway, NJ) step gradients in HTH and centrifuged at 600 × g for 18 min at 15°C. The cell pellet was resuspended in HTH and the Percoll gradient centrifugation was repeated. The pellet from the second centrifugation was resuspended in 50 ml phosphate-buffered saline (PBS)-1.2% sucrose, centrifuged at 400 × g, and resuspended in PBS. Mast cell purity (typically > 95%) was assessed by phase-contrast microscopy, in which abundant large, refractile cytoplasmic granules served as a criterion, and by Alcian blue staining of the secretory granules.

RNA Purification

RNA was isolated from RBL cells detached with trypsin- ethylenediamine tetraacetic acid (EDTA) and collected by centrifugation at 400 × g for 5 min, and from brains and lungs rapidly excised from 150- to 200-g Sprague-Dawley rats killed by CO2 suffocation and exsanguination. Total cellular RNA was isolated on a guanidine thiocyanate/ CsCl gradient, extracted twice with phenol/chloroform, and ethanol precipitated. RNA was dissolved in 0.1% diethylpyrocarbonate (DEPC)-treated water, quantified by measuring absorbance at 260 nm, evaluated for degradation by agarose-formaldehyde gel electrophoresis, and frozen until used. Messenger RNA (mRNA) was isolated from total RNA by oligodeoxythymidine (oligo-dT) cellulose chromatography (poly[A]Pure; Ambion, Austin, TX).

Polymerase Chain Reaction Amplification of Rab3 Isoform Complementary DNA Fragments

Two micrograms of RBL cell poly(A)+ RNA was reverse transcribed with 125 U of Moloney murine leukemia virus (MMLV) reverse transcriptase (New England BioLabs, Beverly, MA) in a 50-µl reaction containing 2.5 µg each of (dT)18 and random octamers, 1 mM of each deoxynucleotide triphosphate (dNTP), and 40 U of ribonuclease inhibitor (RNAsin) (Promega, Madison, WI) at 37°C for 30 min, 42°C for 30 min, and 50°C for 15 min. The polymerase chain reaction (PCR) was performed with 1 µl of AmpliTaq (Perkin-Elmer Cetus, Norwalk, CT) in 100 µl of reaction buffer supplemented with 1.5 mM MgCl2, 10% (vol/ vol) dimethylsulfoxide (DMSO), 1 µM of each primer, 50 µM of each dNTP, and 1 µl of the reverse transcription (RT) reaction product as template. The 5' primer was GCACAGTGGGCATCGACTTCAAGGT, and the 3' primer was CAGACCTTTGAGCGCTTGGTGGAT. The PCR consisted of six cycles at 94°C for 1 min, ramping to 49°C in 3 min, 49°C for 1 min, and 72°C for 1 min, followed by 24 cycles at 94°C for 1 min, 65°C for 1 min, and 72°C for 1 min, with a final extension at 72°C for 6 min. The product was purified by agarose gel electrophoresis and ligated into the pCR-II vector (Invitrogen, San Diego, CA). DH5alpha cells were transformed with the ligation mixture and colonies were selected for sequencing. A cognate fragment of Rab3C was cloned from rat brain poly(A)+ RNA by RT-PCR, using the same primers and reaction conditions as previously described.

Northern Blot Analysis

32P-labeled riboprobes were generated by transcription of linearized pCR-II plasmid cDNAs for 2 to 3 h at 37°C in a 20-µl reaction mixture containing 10 µg DNA; 1 U/µl RNasin; 20 mM dithiothreitol (DTT); 0.1 mg/ml BSA; guanosine triphosphate (GTP), adenosine triphosphate (ATP), and uridine triphosphate (UTP) at 500 µM each; 12 µM cytosine triphosphate (CTP); 9 µM [alpha -32P]CTP (400 Ci/mmol; Amersham, Arlington Heights, IL); and 20 U T7 RNA polymerase (Promega) in the manufacturer's buffer. Four units of RNase-free deoxyribonuclease I (DNAse I) (Boehringer Mannheim, Indianapolis, IN) were then added for an additional 15 min, and the probe was purified on a Nick Spin column (Pharmacia LKB). cRNA hybridization controls were generated in a 50-µl reaction containing 4 µg DNA, 1 U/µl RNasin, 20 mM DTT, 0.1 mg/ml BSA, each NTP at 500 µM, 2.8 µM [3H]UTP (35 Ci/mmol; ICN, Irvine, CA), and either 10 U SP6 RNA polymerase (New England Biolabs) or 20 U T7 RNA polymerase in 1× RNA polymerase buffer. Reactions were incubated for 4 h at 40°C for SP6 or at 37°C for T7. Ten units of DNAse I were then added, and the cRNA was purified on a Nick Spin column. cRNA and mRNA were fractionated in 0.9% agarose/ formaldehyde gels, and blotted onto Nytran+ (Schleicher & Schuell, Keene, NH) or Zeta-Probe (Bio-Rad, Hercules, CA) membranes. RNA was cross-linked to the membranes by UV irradiation and hybridized with riboprobes (1 to 2 × 106 cpm/ml) at 42°C overnight in 50% formamide, 5× Denhardt's solution, 0.15 mg/ml sonicated salmon-sperm DNA, 5× saline-sodium phosphate-EDTA buffer (SSPE), and 7% sodium dodecyl sulfate (SDS). Blots were then washed at room temperature with several changes of 2× standard saline citrate (SSC)/0.05% SDS, and at 65°C for 40 min with two changes of 0.1× SSC/0.1% SDS. Bound riboprobes were detected by autoradiography.

RNase Protection Assay

Vectors containing the PCR-cloned Rab3 fragments were linearized with BamHI for T7-directed synthesis of riboprobes, or with XbaI for SP6-directed RNA synthesis. cRNA controls were generated as described above, using 6 µg DNA. Riboprobes were transcribed as previously described using 3 µg DNA and 12.5 µM [alpha -32P]CTP (800 Ci/ mmol; Amersham), and full-length transcripts were isolated by gel purification in 5% acrylamide/8 M urea gels. RNase protection assays were performed with the RPA II kit (Ambion). Cognate cRNA (0.1 pmol) and yeast RNA were used as positive and negative controls. Each experiment contained 1 pmol riboprobe, and was supplemented with yeast RNA to provide a total of 40 µg RNA. Hybridization was done overnight at 45°C. Protected probes were electrophoresed through 5% acrylamide/8 M urea gels and visualized with autoradiography.

Western Blot Analysis

Brains, lungs, and pancreas were excised from freshly killed rats and placed in a fivefold (wt/vol) excess of ice-cold lysis buffer (10 mM Tris-HCl, pH 7.4; 10 mM NaCl; 5 mM EDTA; and 0.2 mM phenylmethylsulfonyl fluoride [PMSF]). Tissue was finely ground with an Ultra-Turrax T25 rotor/stator homogenizer (IKA Works Inc., Wilmington, NC), using successive 3-s bursts at 13,500 rpm, 20,000 rpm, and 24,000 rpm, respectively, and were then quickly frozen in liquid nitrogen and stored at -80°C. RBL cells were lysed by sonication in three 15-s pulses in lysis buffer. The protein mass of cell and tissue homogenates was measured by Coomassie blue binding (39). Human Rab5A and Rab3A proteins were expressed in Escherichia coli and purified as described (26). Rat Rab3A (a gift of Dr. Ian Macara of the University of Vermont, Burlington, VT), human Rab3B (a gift of Dr. Kevin Kirk of the University of Alabama, Birmingham, AL), and mouse Rab3D (a gift of Dr. Giulia Baldini of Columbia University, New York, NY) cDNAs were subcloned into the pGEX-2T vector (Pharmacia LKB) and purified on glutathione-Sepharose 4B columns (Pharmacia LKB). The mass of glutathione-S-transferase (GST)-Rab3 fusion proteins was determined by laser densitometry of Coomassie blue-stained acrylamide gels, using BSA as a standard.

Recombinant proteins and homogenates were electrophoresed through 12% acrylamide gels, electrotransferred at 30 V overnight to Immobilon-P membranes (Millipore, Bedford, MA), and blocked with 5% BSA in TBST (0.05% Tween-20; 10 mM Tris-HCl, pH 8; 150 mM NaCl). Blots were incubated in blocking buffer for 1 h at room temperature with primary antibodies as follows: pan-Rab3 monoclonal antibody 42.1, raised against Rab3A (a gift of Dr. Reinhard Jahn of Yale University, New Haven, CT), used at 1:5,000 dilution (Figure 1); affinity-purified antipeptide antibody against Rab3D (a gift of Dr. Jack Valentine of Yale University, New Haven, CT), used at 1:2,000 (Figure 1); and pan-Rab3 polyclonal antiserum raised against Rab3B (a gift of Dr. Kirk), used at 1:500. This last antibody is 10-fold more reactive on Western blots against GST-Rab3B than against GST-Rab3A or GST-Rab3D. After preadsorption by diluting 30 µl of serum to 100 µl with PBS and incubating for 12 h at 4°C with 50 µl each of undiluted glutathione-sepharose 4B saturated with GST-Rab3A and glutathione-sepharose saturated with GST-Rab3D, the serum had no demonstrable reactivity against GST-Rab3A or GST-Rab3D. Blots with primary antibody bound were washed six times with TBST and developed with a chemiluminescence kit, using horseradish peroxidase-conjugated secondary antibodies at 1:10,000 (Amersham).

Immunocytochemistry

RBL cells were grown on glass coverslips for 8 d in the presence of 100 µM quercetin to increase granule expression (40). Peritoneal mast cells were air-dried on poly-L-lysine-coated coverslips. RBL cells and mast cells were then fixed, permeabilized, and incubated with primary antibodies as described (41). Monoclonal antibodies against AD1 antigen (a gift of Dr. Reuben Siraganian of the National Institutes of Health, Bethesda, MD) and rat mast-cell protease II (RMCP II) (157/94; Moredun, UK) were diluted 1:200; polyclonal anti-Rab3B and anti-Rab3D antibodies were diluted 1:50. After three washes in PBS, secondary antibodies (Molecular Probes) were diluted 1:200 in the same buffer as used with the primary antibodies and incubated with the specimens in darkness for 1 h. The coverslips were again washed and were then mounted with Mowiol containing 10% 1,4-diazobicyclo-[2.2.2]-octane, after which they were allowed to dry overnight in darkness. Fluorescein isothiocyanate (FITC)-avidin (Molecular Probes) was used at 10 µg/ml to stain secretory granules (42). Epifluorescent images were acquired with a Nikon Optiphot 2 microscope (Melville, NY) with a photographic camera or a Zeiss Axiophot (Thornwood, NY) with a Hamamatsu C5810 CCD camera (Bridgewater, NJ). To detect simultaneously the distribution of two different markers, stained cells were analyzed in a Molecular Dynamics Multiprobe 2001 CLS confocal imaging system (Sunnyvale, CA) attached to a Zeiss Axiovert 100 microscope.

    Results

Abstract
Introduction
Materials and Methods
Results
Discussion
References

Assessment of the Secretory Phenotype of RBL Cells

RBL cells are transformed rat mucosal mast cells that have been widely used in functional studies and for cDNA cloning of mast cell-specific proteins. However, we found that their secretory activity declined with time in culture. Antigen-stimulated beta -glucuronidase release was therefore periodically assessed to insure that Rab3 expression was evaluated in secretion-competent cells (Figure 2).


View larger version (48K):
[in this window]
[in a new window]
 
Figure 2.   beta -Glucuronidase release from antigen-stimulated RBL cells. A representative example of low-passage-number RBL cells stimulated to secrete beta -glucuronidase by cross-linking IgE receptors with antigen and antigen-specific IgE. Lane 1: Triton X-100 total cell lysate; lane 2: control culture supernatant of cells exposed to DNP-BSA alone; lane 3: control culture supernatant of cells exposed to DNP-specific IgE alone; lane 4: culture supernatant of cells exposed to both IgE and DNP-BSA.

PCR Amplification of Rab3 Isoforms

RT-PCR was performed to generate probes of known or novel mast cell Rab3 isoforms for use in mRNA expression studies. We designed PCR primers that had an average 87% identity with the four known rat Rab3 cDNAs (Rab3A, 92% and 87%; Rab3B, 88% and unknown; Rab3C, 84% and 83%; Rab3D, 96% and 79%), but only ~ 40% identity with other Rabs. The 5' primer corresponded to the "effector" domain, and the 3' primer corresponded to the Rab3-specific, but isoform-nonspecific, portion of the C-terminus (Figure 1). PCR amplification of RBL cell reverse transcripts yielded the predicted 385-bp product (not shown). A restriction digest of the product with the frequent cutter Hinf I produced multiple fragments that did not sum to 385 bp (not shown), suggesting that more than one molecular species was present. The PCR product was then subcloned, and the inserts of 27 colonies were sequenced; of these, 17 were identical to rat Rab3D, nine were identical to rat Rab3A, and one was 98% identical at the amino acid level to human Rab3B, and overlapped a recently cloned fragment of rat Rab3B (Figure 1). PCR amplification of rat brain reverse transcripts to obtain a Rab3C probe yielded 385-bp Rab3A and Rab3C fragments (not shown).

Northern Blot Analysis

To identify Rab3 transcripts in RBL cells and estimate their relative expression, Northern blotting was done with riboprobes transcribed from the PCR products. In preliminary experiments, the relative efficiency of probe hybridization to cognate and noncognate Rab3 isoforms was assessed with serial dilutions of blotted cRNAs for all four Rab3 isoforms. This varied from no apparent distinction between cognate and noncognate isoforms on some occasions to threefold more efficient hybridization to cognate cRNA on other occasions (not shown). A Northern blot done with the Rab3B probe revealed three Rab3 transcripts in RBL cells, of approximately 3.2, 2.0, and 1.1 kb in length, respectively (Figure 3). These corresponded to the following transcripts described in other rat tissues: 3.2 for Rab3D in pancreatic islet cells (6), 2.0 kb for Rab3D in brain (43), and 1.1 kb for Rab3B in pituitary (15). Lung mRNA was included as a control because it is enriched with Rab3D transcripts (33, 43); it hybridized strongly at 2.0 kb, and faintly at 2.6 and 4.0 kb. There was no hybridization to RBL cell mRNA at 1.4 kb, the size of rat brain Rab3A (15, 43), even though there was strong hybridization to control brain mRNA (Figure 3), and there was no hybridization at 9.5 kb, the size of rat Rab3C (44). Rab3A and Rab3C riboprobes similarly detected the 3.2-kb and 2.0-kb Rab3D transcripts in RBL cells, but not the 1.1-kb Rab3B transcript or their own cognate transcripts (not shown). Together, these results suggested that Rab3D transcripts of 3.2 and 2.0 kb are relatively abundant in RBL cells, that a Rab3B transcript of 1.1 kb is considerably less abundant, and that Rab3A and Rab3C transcripts are expressed at very low levels, if at all.


View larger version (73K):
[in this window]
[in a new window]
 
Figure 3.   Northern blot of Rab3 isoforms in RBL cells. A 385-nucleotide Rab3B coding region riboprobe was hybridized with 4 µg each of poly(A)+ RNA from rat brain, from rat lung, and from RBL cells. An autoradiogram is shown, with size markers on the left side and the reported sizes of Rab3 transcripts on the right side.

RNase Protection Assay

To assess quantitatively Rab3 mRNA isoform expression, we performed RNase protection assays. In preliminary studies, it was found that the cRNA of each Rab3 isoform protected its cognate probe in a concentration-dependent manner, but failed to protect noncognate probes (not shown). With 40 µg of total RNA from RBL cells, only the Rab3D probe was protected, but its autoradiographic band was faint (not shown); poly(A)+ RNA was then used to increase the sensitivity of the assay. A signal was evident for the Rab3D probe with only 1.6 mg of poly(A)+ RNA when no signal was apparent for the other probes with 8 µg of poly(A)+ RNA (Figure 4), and in overexposed autoradiograms, the Rab3D probe was seen with as little as 0.8 µg of poly(A)+ RNA (not shown). This indicated that Rab3D transcripts are at least 10-fold more abundant in RBL cells than transcripts of other Rab3 isoforms.


View larger version (59K):
[in this window]
[in a new window]
 
Figure 4.   RNase protection assay of RBL cell transcripts. Autoradiogram of the products of an RNase protection assay following polyacrylamide gel electrophoresis. Lanes 1 to 4: 8 µg each of poly(A)+ RNA; lane 5: 4 µg; lane 6: 1.6 µg. The radiolabeled riboprobes used for hybridization in each lane are listed in the top row. Shown is a representative example of an assay performed four times.

Western Blot Analysis

A pan-Rab3 monoclonal antibody was used to compare total Rab3 expression in RBL cells with that in other tissues. Monoclonal antibody 42.1 was raised against Rab3A, but is known also to recognize Rab3B and Rab3C (45), and in preliminary experiments we demonstrated that it recognizes recombinant Rab3D as well (not shown). It was more immunoreactive at 24 kD (the predicted mass of Rab3 proteins) against 3 µg of rat brain than against 100 µg of RBL cell lysate or 30 µg of pancreas, a tissue known to express Rab3D (7, 8) (Figure 5). To determine whether the ~ 100-fold greater Rab3 immunoreactivity in brain than in RBL cells accurately reflected total relative Rab3 protein concentration, we assessed the relative immunoreactivity of antibody 42.1 toward Rab3 GST-fusion proteins, and found this antibody to be ~ 10-fold more reactive toward Rab3A than toward Rab3B or Rab3D (not shown). Since Rab3D is the major Rab3 isoform in RBL cells, whereas Rab3A is the major isoform in brain, this result suggested that total Rab3 proteins are ~ 10-fold more concentrated in brain than in RBL or mast cells. This difference is not due to the immaturity of RBL cells, because immunoreactivity to rat peritoneal mast cells was similar to RBL cells (not shown).


View larger version (41K):
[in this window]
[in a new window]
 
Figure 5.   Immunoblot of RBL proteins made with a pan-Rab3 antibody. Monoclonal antibody 42.1 was used to probe Western-blotted proteins. Lane 1: 2.5 ng purified Rab3A; lane 2: 30 µg pancreatic homogenate; lane 3: 5 ng purified Rab5A; lane 4: 3 µg brain homogenate; lane 5: 100 µg RBL cell lysate; lane 6: 3 µg Rab3D-expressing E. coli lysate. The migration of molecular weight standards, listed in kD, is plotted on the left.

The expression of different Rab3 isoforms in RBL cells was measured with isoform-specific antibodies. Despite the relatively low concentration of total Rab3 proteins in RBL cells (Figure 5), Rab3D-specific antibodies had greater reactivity at 24 kD to RBL cells than to brain (arrow in Figure 6). The major 24-kD bands in brain and RBL cells coincided with major bands identified when the same blot was reprobed with monoclonal antibody 42.1 (not shown). Multiple breakdown products of recombinant Rab3D, visible in the bacterial lysate (last lane), were presumed to have come from C-terminal degradation, since the antibody used for detection was directed against the N-terminus. The mobility of intact recombinant Rab3D is less than that of Rab3D in eukaryotic tissues, owing to the lack of prenylation in the bacterial system (26). The slightly lower mobility of the major band in pancreas than in brain and RBL cells has been previously described (8).


View larger version (51K):
[in this window]
[in a new window]
 
Figure 6.   Immunoblot of RBL proteins made with a Rab3D- specific antiserum. Affinity-purified Rab3D antiserum was used to probe Western-blotted proteins. Lane 1: 5 ng purified Rab3A; lane 2: 15 µg pancreatic homogenate; lane 3: 5 ng purified Rab5A; lane 4: 100 µg brain homogenate; lane 5: 100 µg RBL cell lysate; lane 6: 15 µg Rab3D-expressing E. coli lysate. The migration of molecular weight standards, listed in kD, is plotted on the left. The migration of Rab3D from RBL cells determined with monoclonal antibody 42.1 is indicated by the arrow on the right.

Titration of Rab3D immunoreactivity against GST- Rab3D standards (Figure 7) yielded a concentration of 30 pg Rab3D per µg of RBL cell lysate (28 and 32 pg/µg in two separate experiments). The specificity of the Rab3D antibodies was confirmed because they failed to react with 100-fold more GST-Rab3A or GST-Rab3B than GST- Rab3D (not shown). Similarly, a polyclonal antiserum raised against Rab3B and preadsorbed with GST-Rab3D and GST-Rab3A failed to react with 300-fold more GST- Rab3A or GST-Rab3D than GST-Rab3B (not shown). These Rab3B antibodies failed to detect more than 0.5 pg Rab3B per µg of lysate (not shown), and at this level it was not possible to determine whether the weak reactivity was due to Rab3B, cross-reactivity with Rab3D, or nonspecific interaction with an unrelated protein. Quantitative immunoblot analyses of Rab3A and Rab3C expression were not performed because no transcripts of these isoforms were detected by Northern blot analysis or RNase protection assay (see the previous discussion). These studies indicated that Rab3B protein is present in RBL cells at a concentration no higher than 1/60 that of Rab3D.


View larger version (44K):
[in this window]
[in a new window]
 
Figure 7.   Quantification of Rab3D protein expression in RBL cells. (Top panel ) The immunoreactivity of 25 µg of RBL cell lysate (open circle) and increasing amounts of GST-Rab3D (filled circles) were compared through Western blot analysis using Rab3D-specific antiserum. The mass of GST-Rab3D is expressed as ng of Rab3D protein. The 50-kD marker on the right corresponds to GST-Rab3D and the 24-kD marker to Rab3D form RBL cells. (Bottom panel ) Plot of the results of densitometric scanning of the immunoblot in the top panel.

To assess the membrane/cytoplasmic distribution of Rab3D in resting peritoneal mast cells, cells were lysed by freeze-thawing, fractionated by centrifugation in a Beckman Airfuge for 4 min at 30 psi (~ 180,000 × g), and Western blotted. All of the Rab3D immunoreactivity of total lysate was found in the pellet (not shown).

Granular Localization and Translocation of Rab3D

RBL-cell secretory granules were visualized by immunofluorescence microscopy, using monoclonal antibodies specific for the granule membrane protein AD1 (Figure 8A) and the secretory protease RMCP-II (Figure 8B). These antibodies demonstrated punctate structures in the perinuclear region and in elongated cytoplasmic processes. The largest RBL cell granules were approximately 1 µm in diameter, which is typical of the size of mature mast cell granules, but most were substantially smaller. Control antibodies, including nonimmune primary sera, irrelevant primary antibodies, or secondary antibodies alone, all failed to generate punctate immunofluorescence (not shown). The morphology of the RBL cells, ranging from polygonal or rounded to elongate with lengthy dendritic processes, varied with cell density and time in culture. Inclusion of quercetin in the culture medium substantially increased the number of cells containing immunocytochemically apparent granules and the number of granules per cell. Both the pan-Rab3 polyclonal antiserum when added prior to preadsorption against GST-Rab3D (Figure 8C), but not after preadsorption (not shown), and antibody specific for Rab3D (Figure 8D), yielded punctate immunofluorescence similar to that seen with the granule markers.


View larger version (58K):
[in this window]
[in a new window]
 
Figure 8.   Immunocytochemical localization of Rab3D and RBL cell granule markers. Cells were imaged by indirect immunofluorescence, using primary antibodies specific for the proteins indicated and FITC-conjugated secondary antibodies. (A) AD1, (B) RMCP-II, (C) pan-Rab3 (polyclonal antiserum), (D) Rab3D.

Scanning laser confocal microscopy of RBL cells, done to examine the colocalization of Rab3D and the secretory granule marker RMCP-II, showed both proteins in structures of similar size and distribution (Figures 9A to 9C). However, most granules stained with only one antibody. Since partial colocalization of the two proteins might have been due to the immaturity of RBL cells, we next examined mature peritoneal mast cells. This revealed essentially complete colocalization of punctate Rab3D staining with the refractile ctyoplasmic granules seen by phase-contrast microscopy (Figure 10A) or the FITC-avidin fluorescence by laser confocal microscopy (Figures 9D to 9F). Virtually all granules in all cells examined showed staining by both Rab3D antibodies and FITC-avidin. A similar result was obtained with the pan-Rab3 polyclonal antiserum (not shown). A decreasing gradient of Rab3D from the cell periphery to the center was observed with confocal microscopy in all mast cells examined (Figure 9D), but no such gradient of FITC-avidin was seen (Figure 9E). This difference was reflected in the green color seen at the center of the cell in the merged image, the predominantly yellow color at an intermediate distance from the cell center, and the red color at the cell periphery (Figure 9F).


View larger version (35K):
[in this window]
[in a new window]
 
Figure 9.   Colocalization of Rab3D and secretory-granule markers in RBL cells and mast cells. RBL cells were labeled with antibodies to RMCP-II (B); mast cells were labeled with FITC-avidin (E); and both cell types were labeled with antibodies to Rab3D (A, D). Antibodies were then imaged by indirect immunofluorescence laser confocal microscopy, using secondary antibodies labeled with Texas red (A, D) or FITC (B). FITC-avidin (E) was imaged directly. In the computer-merged images (C, F ), yellow color indicates coincident red and green fluorescence.


View larger version (22K):
[in this window]
[in a new window]
 
Figure 10.   Localization of Rab3D in peritoneal mast cells and in activated RBL cells. Rat peritoneal mast cells were allowed to air dry on glass slides, labeled with antibodies to Rab3D, and imaged with phase-contrast microscopy (A) or with indirect immunofluorescent microscopy using Texas red-conjugated secondary antibodies (B). RBL cells cultured on coverslips were activated for secretion by cross-linking bound IgE with specific antigen (C), as in Figure 2. After 15 min the cells were fixed, labeled with antibodies to Rab3D, and imaged using Texas red-conjugated secondary antibodies.

Approximately one-third of fixed mast cells showed Rab3D immunoreactivity in a linear distribution at the cell periphery, and were smaller than the fully granulated cells (Figures 10A and 10B). We surmised that these were mast cells that degranulated in response to physical forces during fixation, resulting in a reduction in cell volume and translocation of Rab3D to the plasma membrane. To confirm that Rab3D translocates upon exocytosis, peritoneal mast cells (not shown) and RBL cells (Figure 10C) were allowed to bind IgE overnight and then triggered with specific antigen. Fifteen minutes after the addition of antigen, virtually all of the cells displayed linear peripheral Rab3D staining. RBL cells rather than mast cells are shown because of the striking difference from unstimulated cells, in which peripheral, linear Rab3D immunofluorescence was never observed (Figure 8D).

    Discussion

Abstract
Introduction
Materials and Methods
Results
Discussion
References

Rab3 Expression in RBL Cells and Mast Cells

Our Northern blot and RNase protection studies indicate that Rab3D is the major Rab3 isoform in RBL cells, and that Rab3B is also expressed, but at very low levels. These relative expression levels were reflected in our RT-PCR cloning of 17 colonies of Rab3D-containing cells for a single colony of Rab3B; however, the nine colonies of Rab3A-containing cells were not reflected in either of our mRNA expression studies. The reason for this discrepancy is not apparent, because there was no difference in PCR primer match with the four isoforms of Rab3, but RT- PCR is well-recognized for not yielding quantitative results unless specifically controlled for this purpose (46). Rab3B and Rab3D, but not Rab3A, were similarly cloned by RT-PCR from rat peritoneal mast cells by another group (47), although transcript or protein levels were not quantified. During preparation of our manuscript, a third group cloned Rab3A and Rab3D, but not Rab3B, by RT- PCR from RBL cells (18). This last group also detected Rab3A transcripts by RNase protection assay at a level 1/ 10 those of Rab3D, which is consistent with our results, and identified but did not quantify Rab3A protein expression by immunoblotting.

The concentration of total Rab3 proteins in brain is approximately 10-fold higher than RBL cells (Figure 5). This difference is not due to the immaturity of RBL cells, because the level of Rab3 proteins in peritoneal mast cells is similar. Rather, the difference might be explained if a fixed number of Rab3 molecules is required for each secretory vesicle, because synaptic vesicles are considerably smaller and more numerous than mast cell secretory granules. Alternatively, the more frequent secretory activity of neurons than of mast cells may require a larger pool of Rab3 proteins.

Rab3D Trafficking in RBL Cells and Mast Cells

In resting RBL and mast cells, we found Rab3D localized to secretory granules, as is consistent with the localization of Rab3 proteins to secretory organelles of other cell types (5). Regulated secretory vesicles can be viewed as "transport vesicles" between the trans-Golgi network and the plasma membrane. The predominant association of Rab3 proteins with transport vesicles in the resting state differs from the predominant steady-state association of Rab5 with its target organelle, the early endosome (27, 41), or of the constitutive yeast exocytotic protein Sec4 with plasma membrane (48). This distinct partitioning of different Rab proteins likely reflects differences in the transit times of the individual steps of a conditional transport process (viz., regulated exocytosis) from those of constitutive transport processes (viz., endocytosis or constitutive exocytosis).

In RBL cells, Rab3D only partly colocalizes with the secretory protease RMCP-II, even though the size and spatial distribution of granules containing each protein are similar (Figures 8 and 9). It is possible that Rab3D and RMCP-II are predominantly associated with different maturational stages of secretory granules, since the accumulation of proteases within mast cell granules can be highly variable and is dependent on external signals (49). In peritoneal mast cells, Rab3D is closely associated with the large, mature secretory granules (Figures 9 and 10). Of interest is that a decreasing gradient of Rab3D from peripheral to central granules was clearly visible (Figures 9D to 9F). This may correlate with previous morphologic and physiologic observations of mast cell secretion by cumulative exocytosis, whereby peripheral granules first fuse with the plasma membrane and central granules then fuse with peripheral granules (34, 50). It is thus possible that Rab3D functions predominantly in heterotypic granule-plasma-membrane fusion rather than in homotypic granule-granule fusion.

Rab3D translocates to the plasma membrane of mast cells and RBL cells following exocytotic degranulation (Figure 10). Translocation of a Rab3 protein in response to a physiologic stimulus has not previously been observed, although translocation of Rab3A in neurons was induced by venom of the black widow spider (5). Spider venom was used because it also blocks endocytosis, thereby trapping Rab3A in the plasma membrane to overcome the rapid membrane recycling of neurons. After translocation in mast cells, Rab3D presumably is extracted by guanine nucleotide dissociation inhibitor (GDI) for recycling through the cytoplasm, as are other Rab proteins (2, 4, 51). However, the stable morphologic association of Rab3D with plasma membrane at 15 min after stimulated exocytosis (Figure 10C) suggests that this is a slow process if it occurs at all. We found no cytoplasmic pool of Rab3D in resting mast cells, nor did another group find any within 30 min of activation (18). This contrasts with cytoplasmic pools of approximately 20% of Rab3A in neurons (10) and 15% of Sec4 in yeast (48). The last two types of cells have continuous high levels of secretory activity that are likely to require continuous recycling of secretory Rab proteins, whereas mast cells can remain quiescent for long periods and slowly regranulate after activation. The different kinetic requirements of mast cells may favor a distinct Rab3 retrieval system.

Rab3D Function in Mast Cells

All Rab3 isoforms examined so far modulate regulated exocytotic events, but their precise role(s) remain unclear. Overexpression of Rab3A (6, 12, 17, 18) or Rab3D (18) was found to inhibit regulated exocytotic events, whereas overexpression of Rab3B promoted (14) and supression of Rab3B expression inhibited them (15). It is possible that these apparently opposing activities are isoform-specific, but it is also possible that they reflect differences in experimental design. For example, the observed increase in quantal neurotransmitter release from individual synapses of Rab3A knockout mice was interpreted as paradoxically resulting from a reduction in synaptic vesicle fusion efficiency (16). However, the postsynaptic assay used in this latter study cannot prove this interpretation. The mast cell is an ideal experimental model for the direct measurement of exocytosis through a patch pipette by changes in membrane capacitance (34). This is because the large size of mast cell secretory granules permits kinetic analysis of individual fusion events, and because mast cells undergo nearly complete degranution upon stimulation. Knowledge of the expression and subcellular trafficking of Rab3D reported herein will allow its rational manipulation in mast cells to assess its role in exocytic fusion.

    Footnotes

Address correspondence to: Burton F. Dickey, Pulmonary and Critical Care Medicine, 3C-383, Houston VA Medical Center, 2002 Holcombe Blvd., Houston, TX 77030. E-mail: bdickey{at}bcm.tmc.edu

(Received in original form December 23, 1997 and in revised form April 28, 1998).

Note added in proof:
On the basis of the immunodetection of Rab3A in RBL cells by another group (18) while our manuscript was in preparation, we performed quantitative immunoblotting of Rab3A using GST-Rab3A and the isoform-specific monoclonal antibody 42.2 (45). We found Rab3A protein to be present at a concentration approximately twofold greater than Rab3D, which is surprising in view of the approximately 10-fold greater abundance of Rab3D than Rab3A mRNA.
Abbreviations: dinitrophenol, DNP; fluorescein isothiocyanate, FITC; glutathione-S-transferase, GST; guanosine triphosphatase, GTPase; 1,4-piperazinediethanesulfonic acid, PIPES; reverse transcription-polymerase chain reaction, RT-PCR; ribonuclease inhibitor, RNAsin; rat mast cell protease II, RMCP II.

Acknowledgments: The authors thank Dr. F. Richard Sullivan for helpful discussions, and Pamela Woodford for assistance in culturing cells. This work was supported by National Institutes of Health grant HL43161 (B.F.D.)
    References

Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Fernandez, J. M., E. Neher, and B. D. Gomperts. 1984. Capacitance measurement reveals stepwise fusion events in degranulating mast cells. Nature 312: 453-455 [Medline].

2. Nuoffer, C., and W. E. Balch. 1994. GTPases: multifunctional molecular switches regulating vesicular traffic. Annu. Rev. Biochem 63: 949-990 [Medline].

3. Dickey, B. F., and L. Birnbaumer, editors. 1993. GTPases in Biology. Springer-Verlag, Berlin.

4. Pfeffer, S. R.. 1994. Rab GTPases: master regulators of membrane trafficking. Curr. Opin. Cell Biol 6: 522-526 [Medline].

5. Matteoli, M., K. Takei, R. Cameron, P. Hurlbut, P. A. Johnston, T. C. Sudhof, R. Jahn, and P. De Camilli. 1991. Association of rab3A with synaptic vesicles at late stages of the secretory pathway. J. Cell Biol 115: 625-633 [Abstract/Free Full Text].

6. Regazzi, R., M. Ravazzola, M. Lezzi, J. C. Lang, A. Zahraoui, E. Andereggen, P. Morel, Y. Takai, and C. B. Wollheim. 1996. Expression, localization and functional role of small GTPases of the Rab3 family in insulin-secreting cells. J. Cell Sci 109: 2265-2273 [Abstract].

7. Ohnishi, H., S. A. Ernst, N. Wys, M. McNiven, and J. A. Williams. 1996. Rab3D localizes to zymogen granules in rat pancreatic acini and other exocrine glands. Am. J. Physiol. Gastrointest. Liver Physiol 271: G531-G538 [Abstract/Free Full Text].

8. Valentijn, J. A., D. Sengupta, F. D. Gumkowski, L. H. Tang, E. M. Konieczko, and J. D. Jamieson. 1996. Rab3D localizes to secretory granules in rat pancreatic acinar cells. Eur. J. Cell Biol 70: 33-41 [Medline].

9. Fischer von Mollard, G., B. Stahl, A. Khokhlatchev, T. C. Südhof, and R. Jahn. 1994. Rab3C is a synaptic vesicle protein that dissociates from synaptic vesicles after stimulation of exocytosis. J. Biol. Chem. 269: 10971-10974 [Abstract/Free Full Text].

10. Mizoguchi, A., S. Kim, T. Ueda, A. Kikuchi, H. Yorifuji, N. Hirokawa, and Y. Takai. 1990. Localization and subcellular distribution of smg25A, a ras p21-like GTP-binding protein, in rat brain. J. Biol. Chem 265: 11872-11879 [Abstract/Free Full Text].

11. Südhof, T. C.. 1995. The synaptic vesicle cycle: a cascade of protein-protein interactions. Nature 375: 645-653 [Medline].

12. Johannes, L., P.-M. Lledo, M. Roa, J.-D. Vincent, J.-P. Henry, and F. Darchen. 1994. The GTPase Rab3a negatively controls calcium-dependent exocytosis in neuroendocrine cells. EMBO J. 13: 2029-2037 [Medline].

13. Holz, R. W., W. H. Brondyk, R. A. Senter, L. Kuizon, and I. G. Macara. 1994. Evidence for the involvement of Rab3A in Ca2+-dependent exocytosis from adrenal chromaffin cells. J. Biol. Chem 269: 10229-10234 [Abstract/Free Full Text].

14. Weber, E., T. Jilling, and K. L. Kirk. 1996. Distinct functional properties of Rab3A and Rab3B in PC12 neuroendocrine cells. J. Biol. Chem 271: 6963-6971 [Abstract/Free Full Text].

15. Lledo, P.-M., P. Vernier, J.-D. Vincent, W. T. Mason, and R. Zorec. 1993. Inhibition of Rab3B expression attenuates Ca2+-dependent exocytosis in rat anterior pituitary cells. Nature 364: 540-544 [Medline].

16. Geppert, M., Y. Goda, C. F. Stevens, and T. C. Südhof. 1997. The small GTP-binding protein Rab3A regulates a late step in synaptic vesicle fusion. Nature 387: 810-814 [Medline].

17. Smith, J., J. Thompson, J. Armstrong, B. Hayes, A. Crofts, J. Squire, C. Teahan, L. Upton, and R. Solari. 1997. Rat basophilic leukaemia (RBL) cells overexpressing Rab3a have a reversible block in antigen-stimulated exocytosis. Biochem. J. 323: 321-328 .

18. Roa, M., F. Paumet, J. Le Mao, B. David, and U. Blank. 1997. Involvement of the ras-like GTPase rab3d in RBL-2H3 mast cell exocytosis following stimulation via high affinity IgE receptors (Fcvarepsilon RI). J. Immunol. 159: 2815-2823 [Abstract].

19. Oberhauser, A. F., J. Monck, W. E. Balch, and J. M. Fernandez. 1992. Exocytic fusion is activated by rab3a peptides. Nature 360: 270-273 [Medline].

20. Melancon, P., B. S. Glick, V. Malhotra, P. J. Weidman, T. Serafini, M. L. Gleason, L. Orci, and J. E. Rothman. 1987. Involvement of GTP-binding "G" proteins in transport through the Golgi stack. Cell 51: 1053-1062 [Medline].

21. Beckers, C. J. M., and W. E. Balch. 1989. Calcium and GTP: essential components in vesicular trafficking between the endoplasmic reticulum and golgi apparatus. J. Cell Biol 108: 1245-1256 [Abstract/Free Full Text].

22. Goda, Y., and S. R. Pfeffer. 1991. Identification of a novel, N-ethylmaleimide sensitive cytosolic factor required for vesicular transport from endosomes to the trans Golgi network in vitro. J. Cell Biol. 112: 823-831 [Abstract/Free Full Text].

23. Mayorga, L. S., R. Diaz, and P. D. Stahl. 1989. Regulatory role for GTP-binding proteins in endocytosis. Science 244: 1475-1477 [Abstract/Free Full Text].

24. Wessling-Resnick, M., and W. A. Braell. 1990. Characterization of the mechanism of vesicle fusion in vitro. J. Biol. Chem. 265: 16751-16759 [Abstract/Free Full Text].

25. Bourne, H. R.. 1988. Do GTPases direct membrane traffic in secretion? Cell 53: 669-671 [Medline].

26. Hoffenberg, S., J. C. Sanford, S. Liu, D. S. Daniel, M. Tuvin, B. J. Knoll, M. Wessling-Resnick, and B. F. Dickey. 1995. Biochemical and functional characterization of a recombinant GTP-binding protein, rab5, and two of its mutants. J. Biol. Chem. 270: 5048-5056 [Abstract/Free Full Text].

27. Stenmark, H., R. G. Parton, O. Steele-Mortimer, A. Lütcke, J. Gruenberg, and M. Zerial. 1994. Inhibition of rab5 GTPase activity stimulates membrane fusion in endocytosis. EMBO J. 13: 1287-1296 [Medline].

28. Barbieri, M. A., G. P. Li, L. S. Mayorga, and P. D. Stahl. 1996. Characterization of Rab5:Q79L-stimulated endosome fusion. Arch. Biochem. Biophys. 326: 64-72 [Medline].

29. Barbieri, M. A., G. Li, M. I. Colombo, and P. D. Stahl. 1994. Rab5, an early acting endosomal GTPase, supports in vitro endosome fusion without GTP hydrolysis. J. Biol. Chem. 269: 18720-18722 [Abstract/Free Full Text].

30. Hoffenberg, S., L. Nikolova, J. Y. Pan, D. S. Daniel, M. Wessling-Resnick, B. J. Knoll, and B. F. Dickey. 1995. Functional and structural interactions of the rab5 D136N mutant with xanthine nucleotides. Biochem. Biophys. Res. Commun. 215: 241-249 [Medline].

31. Rybin, V., O. Ullrich, M. Rubino, K. Alexandrov, I. Simon, M. C. Seabra, R. Goody, and M. Zerial. 1996. GTPase activity of Rab5 acts as a timer for endocytic membrane fusion. Nature 383: 266-269 [Medline].

32. Weber, E., G. Berta, A. Tousson, P. St-John, M. W. Green, U. Gopalokrishnan, T. Jilling, E. J. Sorscher, T. S. Elton, D. R. Abrahamson, and K. L. Kirk. 1994. Expression and polarized targeting of a rab3 isoform in epithelial cells. J. Cell Biol 125: 583-594 [Abstract/Free Full Text].

33. Baldini, G., T. Hohl, H. Y. Lin, and H. F. Lodish. 1992. Cloning of a Rab3 isotype predominantly expressed in adipocytes. Proc. Natl. Acad. Sci. USA 89: 5049-5052 [Abstract/Free Full Text].

34. Lindau, M., and B. D. Gomperts. 1991. Techniques and concepts in exocytosis---focus on mast cells. Biochim. Biophys. Acta 1071: 429-471 [Medline].

35. Monck, J. R., and J. M. Fernandez. 1992. The exocytotic fusion pore. J. Cell Biol. 119: 1395-1404 [Free Full Text].

36. Lindau, M., and W. Almers. 1995. Structure and function of fusion pores in exocytosis and ectoplasmic membrane fusion. Curr. Opin. Cell Biol. 7: 509-517 [Medline].

37. Hamaway, M. M., C. Oliver, S. E. Mergenhagen, and R. P. Siraganian. 1992. Adherence of rat basophilic leukemia (RBL-2H3) cells to fibronectin-coated surfaces enhances secretion. J. Immunol. 149: 615-621 [Abstract].

38. Talalay, P., W. H. Fishman, and C. Huggins. 1946. Chromogenic substrates. II. Phenolphtalein glucuronic acid as substrate for the assay of glucuronidase. J. Biol. Chem. 166: 757-772 [Free Full Text].

39. Bradford, M. M.. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-254 [Medline].

40. Trnovsky, J., R. Letourneau, E. Haggag, W. Boucher, and T. C. Theoharides. 1993. Quercetin-induced expression of rat mast cell protease II and accumulation of secretory granules in rat basophilic leukemia cells. Biochem. Pharmacol 46: 2315-2326 [Medline].

41. Moore, R. H., N. Sadovnikoff, S. Hoffenberg, S. Liu, P. Woodford, K. Angelides, J. Trial, N. D. V. Carsrud, B. F. Dickey, and B. J. Knoll. 1995. Ligand-stimulated beta 2-adrenergic receptor internalization via the constitutive endocytic pathway into rab5-containing endosomes. J. Cell Sci. 108: 2983-2991 [Abstract].

42. Bergstresser, P. R., R. E. Tigelaar, and M. D. Tharp. 1984. Conjugated avidin identifies cutaneous rodent and human mast cells. J. Invest. Dermatol. 83: 214-218 [Medline].

43. Elferink, L. A., K. Anzai, and R. H. Scheller. 1992. rab15, a novel low molecular weight GTP-binding protein specifically expressed in rat brain. J. Biol. Chem 267: 5786-5775 .

44. Viggeswarapu, M., and G. M. Wildey. 1996. Cloning and tissue expression of the rat RAB 3C GTP-binding protein. Biochem. Biophys. Res. Commun 227: 645-650 [Medline].

45. Baumert, M., G. Fischer von Mollard, R. Jahn, and T. C. Südhof. 1993. Structure of the murine rab3A gene: correlation of genomic organization with antibody epitopes. Biochem. J. 293: 157-163 .

46. Sarkar, B., and S. Sommer. 1989. Access to a messenger RNA sequence or its protein product is not limited by tissue or species specificity. Science 244: 331-334 [Abstract/Free Full Text].

47. Oberhauser, A. F., V. Balan, C. L. Fernandez-Badilla, and J. M. Fernandez. 1994. RT-PCR cloning of Rab3 isoforms expressed in peritoneal mast cells. FEBS Lett. 339: 171-174 [Medline].

48. Goud, B., A. Salminen, N. C. Walworth, and P. J. Novick. 1988. A GTP-binding protein required for secretion rapidly associates with secretory vesicles and the plasma membrane in yeast. Cell 53: 753-768 [Medline].

49. Friend, D. S., N. Ghildyal, K. F. Austen, M. F. Gurish, R. Matsumoto, and R. L. Stevens. 1996. Mast cells that reside at different locations in the jejunum of mice infected with Trichinella spiralis exhibit sequential changes in their granule ultrastructure and chymase phenotype. J. Cell Biol. 135: 279-290 [Abstract/Free Full Text].

50. Alvarez de Toledo, G., and J. M. Fernandez. 1990. Compound versus multigranular exocytosis in peritoneal mast cells. J. Gen. Physiol 95: 397-409 [Abstract/Free Full Text].

51. Fischer von Mollard, G., T. C. Südhof, and R. Jahn. 1991. A small GTP-binding protein dissociates from synaptic vesicles during exocytosis. Nature 349: 79-81 [Medline].

52. Baldini, G., P. E. Scherer, and H. F. Lodish. 1995. Nonneuronal expression of rab3A: induction during adipogenesis and association with different intracellular membranes than rab3D. Proc. Natl. Acad. Sci. USA 92: 4284-4288 [Abstract/Free Full Text].





This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
E. Evans, W. Zhang, G. Jerdeva, C.-Y. Chen, X. Chen, S. F. Hamm-Alvarez, and C. T. Okamoto
Direct interaction between Rab3D and the polymeric immunoglobulin receptor and trafficking through regulated secretory vesicles in lacrimal gland acinar cells
Am J Physiol Cell Physiol, March 1, 2008; 294(3): C662 - C674.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
N. J. Pavlos, J. Xu, D. Riedel, J. S. G. Yeoh, S. L. Teitelbaum, J. M. Papadimitriou, R. Jahn, F. P. Ross, and M. H. Zheng
Rab3D Regulates a Novel Vesicular Trafficking Pathway That Is Required for Osteoclastic Bone Resorption
Mol. Cell. Biol., June 15, 2005; 25(12): 5253 - 5269.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
C. M. Evans, O. W. Williams, M. J. Tuvim, R. Nigam, G. P. Mixides, M. R. Blackburn, F. J. DeMayo, A. R. Burns, C. Smith, S. D. Reynolds, et al.
Mucin Is Produced by Clara Cells in the Proximal Airways of Antigen-Challenged Mice
Am. J. Respir. Cell Mol. Biol., October 1, 2004; 31(4): 382 - 394.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
L. van Weeren, A. M. de Graaff, J. D. Jamieson, J. J. Batenburg, and J. A. Valentijn
Rab3D and Actin Reveal Distinct Lamellar Body Subpopulations in Alveolar Epithelial Type II Cells
Am. J. Respir. Cell Mol. Biol., March 1, 2004; 30(3): 288 - 295.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Puri, M. J. Kruhlak, S. W. Whiteheart, and P. A. Roche
Mast Cell Degranulation Requires N-Ethylmaleimide-Sensitive Factor-Mediated SNARE Disassembly
J. Immunol., November 15, 2003; 171(10): 5345 - 5352.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
R. D. Burgoyne and A. Morgan
Secretory Granule Exocytosis
Physiol Rev, April 1, 2003; 83(2): 581 - 632.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. M. Schluter, M. Khvotchev, R. Jahn, and T. C. Sudhof
Localization Versus Function of Rab3 Proteins. EVIDENCE FOR A COMMON REGULATORY ROLE IN CONTROLLING FUSION
J. Biol. Chem., October 18, 2002; 277(43): 40919 - 40929.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Yang, L. Li, G. W. Wong, S. A. Krilis, M. S. Madhusudhan, A. Sali, and R. L. Stevens
RasGRP4, a New Mast Cell-restricted Ras Guanine Nucleotide-releasing Protein with Calcium- and Diacylglycerol-binding Motifs. IDENTIFICATION OF DEFECTIVE VARIANTS OF THIS SIGNALING PROTEIN IN ASTHMA, MASTOCYTOSIS, AND MAST CELL LEUKEMIA PATIENTS AND DEMONSTRATION OF THE IMPORTANCE OF RasGRP4 IN MAST CELL DEVELOPMENT AND FUNCTION
J. Biol. Chem., July 5, 2002; 277(28): 25756 - 25774.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Pombo, S. Martin-Verdeaux, B. Iannascoli, J. Le Mao, L. Deriano, J. Rivera, and U. Blank
IgE Receptor Type I-dependent Regulation of a Rab3D-associated Kinase. A POSSIBLE LINK IN THE CALCIUM-DEPENDENT ASSEMBLY OF SNARE COMPLEXES
J. Biol. Chem., November 9, 2001; 276(46): 42893 - 42900.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. Tanaka, J. Miyoshi, H. Ishizaki, A. Togawa, K. Ohnishi, K. Endo, K. Matsubara, A. Mizoguchi, T. Nagano, M. Sato, et al.
Role of Rab3 GDP/GTP Exchange Protein in Synaptic Vesicle Trafficking at the Mouse Neuromuscular Junction
Mol. Biol. Cell, May 1, 2001; 12(5): 1421 - 1430.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
F. Paumet, J. Le Mao, S. Martin, T. Galli, B. David, U. Blank, and M. Roa
Soluble NSF Attachment Protein Receptors (SNAREs) in RBL-2H3 Mast Cells: Functional Role of Syntaxin 4 in Exocytosis and Identification of a Ve