B Activation and IL-8 mRNA
Expression in Guinea Pigs In Vivo
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
Abstract |
|---|
|
|
|---|
We examined the hypothesis that superoxide mediates infiltration of neutrophils to the airways through
nuclear factor (NF)-
B and interleukin-8 (IL-8) after acute exposure to cigarette smoke (CS) in vivo. Male
Hartley strain guinea pigs were exposed to air or 20 puffs of CS and killed 5 h after the exposure. The differential cell count of bronchoalveolar lavage fluid and specific myeloperoxidase enzyme assay demonstrated that acute exposure to CS caused neutrophil accumulation to the airways and parenchyma, respectively. Acute exposure to CS increased DNA-binding activity of NF-
B in the lung. Acute exposure to CS
also increased IL-8 messenger RNA (mRNA) expression in the lung. Pretreatment of guinea pigs with recombinant human superoxide dismutase (rhSOD) aerosols reduced the CS-induced neutrophil accumulation to the airways. Both activation of NF-
B and increased IL-8 mRNA expression were also inhibited by
the pretreatment of rhSOD aerosols. Strong immunoreactivities for p65 and p50 were detected in the nuclei of alveolar macrophages after acute exposure to CS. The signal for IL-8 mRNA expression was demonstrated in the alveolar space after acute exposure to CS. Neither significant immunoreactivities for p65
and p50 nor IL-8 mRNA signals were observed in airway epithelium. These observations suggest that
acute exposure to CS initiates superoxide-dependent mechanism that, through NF-
B activation and IL-8
mRNA expression, produces infiltration of neutrophils to the airways in vivo. It was also suggested that the
alveolar macrophage is one potential source of NF-
B activation and IL-8 mRNA expression after acute exposure to CS.
| |
Introduction |
|---|
|
|
|---|
Cigarette smoke (CS) is implicated in many pulmonary disorders, including chronic bronchitis and chronic obstructive pulmonary diseases (1, 2). Several mechanisms may explain how CS can cause airway inflammation and subsequent diseases. CS exposure leads to an accumulation of neutrophils in alveolar walls (3). Increased numbers of neutrophils have been demonstrated in bronchoalveolar lavage fluid (BALF) of cigarette smokers (4). It has been proposed that the influx of the inflammatory cells occurs because of chemotactic factors generated in the lung in response to CS.
CS contains high concentrations of active oxygen species, such as superoxide anion radical, in the gas phase, and tar (1, 5). A puff of CS contains a concentration of more than 1015 oxidant radicals (5). Steady-state reactions in CS provide long half-lives for many radical species that are potent sources for ongoing generation of superoxide anion and other free radicals (5). The NO2 in CS can react with the hydrogen peroxide produced to release superoxide (5). Superoxide is the main reactive oxygen species generated in CS-exposed buffer solution, suggesting a key role of superoxide in mediating CS-induced airway toxicity in vivo (6, 7).
Oxidative stress increases nuclear factor (NF)-
B DNA-binding activity in vitro (8). The specific role of superoxide
in activating NF-
B after hemorrhage has been demonstrated in murine lung mononuclear cells in vivo (9). NF-
B is a critical transcription factor for maximal expression
of many cytokines, including interleukin (IL)-8, a potent
chemotactic factor and activator for neutrophils (10). NF-
B
binding sites are located at adjacent sites in the human IL-8
promoter region (11). A high concentration of IL-8 has
been observed in BALF of smokers compared with that of
nonsmokers (2). Intratracheal instillation of IL-8 causes
the migration of neutrophils to bronchial tissue and into
the luminal space in dogs in vivo (12). Because reactive oxygen species have been implicated in the IL-8 production
(13), we hypothesized that superoxide mediates the neutrophil accumulation to the airways through transcriptional factor NF-
B and IL-8 after acute exposure to CS in
vivo. To test this hypothesis, we examined the effect of recombinant human superoxide dismutase (rhSOD) pretreatment on infiltration of neutrophils into the airways,
NF-
B DNA-binding activity, and IL-8 messenger RNA
(mRNA) expression after acute exposure to CS in guinea
pigs. Furthermore, we analyzed the distribution of NF-
B
(p65 and p50) using the immunohistochemical staining technique, and compared it with that provided by using reverse transcription in situ polymerase chain reaction (RT
in situ PCR) to detect the sites of IL-8 mRNA expression.
| |
Materials and Methods |
|---|
|
|
|---|
Protocol
The procedures were approved by the Animal Care Committee of the Yokohama City University School of Medicine (Yokohama, Japan). Male Hartley strain guinea pigs (Japan SLC Inc., Shizuoka, Japan) weighing 800 to 950 g (about 12 mo old) were used. The CS group was pretreated with phosphate-buffered saline (PBS; pH 7.4) aerosols for 5 min and then exposed to 20 puffs of CS. The rhSOD + CS group was pretreated with rhSOD (14) (25,000 U/ml in PBS; a gift from Nippon Kayaku Co., Tokyo, Japan) aerosols for 5 min and exposed to 20 puffs of CS. The control group was pretreated with PBS or rhSOD aerosols for 5 min and exposed to filtered air.
Five hours after exposure, eight guinea pigs from each exposure group were killed and BAL was performed, followed by removal of lungs. Lavaged lungs were then used for total RNA extraction and electrophoretic mobility shift assay (EMSA). For quantitation of lung tissue neutrophils, four animals from each exposure group were sacrificed at 5 h after exposure.
For analysis of pathology, immunohistochemistry, immunofluorescence staining, and RT in situ PCR, six animals from each exposure group were given a lethal injection of pentobarbital at 5 h after exposure. To wash out blood from the intravascular space, the animal was perfused through the right ventricle with 50 ml PBS at a perfusion pressure of 50 cm H2O. The lung samples were inflated and fixed by immersion with S.T.F. (Streck Laboratory Inc., Omaha, NE) for 24 h. The right lung blocks were embedded in paraffin, and sections were stained with hematoxylin and eosin (H&E) for histologic analysis with light microscopy. The remaining left lung was unstained for immunohistochemistry, immunofluorescence staining, or RT in situ PCR as described below.
CS Exposure
Guinea pigs were exposed to CS in the conscious, restrained state and breathed spontaneously in the device, as described previously (15). A volume of 20 ml of CS was drawn from a commercially available filtered cigarette (Mild Seven; Nippon Tobacco Ind. Co., Tokyo, Japan) with a syringe and was then injected into the compartment in which the head of the animal was secured. The compartment had a volume of approximately 1 liter and a smoke inlet hole (1 cm) on the front panel, with four exhaust holes (1 cm) on the top panel. Smoke was delivered at a rate of 3 puffs/min.
BAL and Isolation of Bronchoalveolar Macrophages
Guinea pigs were administered an overdose of pentobarbital (100 mg/kg intraperitoneally) 5 h after exposure, and lungs were lavaged six consecutive times with 6 ml of sterilized saline through a polyethylene tube introduced through the tracheotomy. BALF was centrifuged and the cell pellet was resuspended in 1 ml of sterilized PBS. Total cell counts were made using Turk stain (dilution 1:10) in a Burker- Turk chamber under a light microscope. Differential cell counts were performed on cytospin preparations stained by Diff-Quik (International Reagents, Kobe, Japan). Cells were identified as macrophages, neutrophils, eosinophils, lymphocytes, basophils, and epithelial cells by standard morphology.
Bronchoalveolar macrophages (2 × 106 cells/well) were allowed to adhere to a sterile six-well culture plate (Sumitomo Bakelite Co., Tokyo, Japan) at 37°C for 60 min. Nonadherent cells were removed by washing the monolayers with 37°C culture medium (RPMI 1640; GIBCO BRL, Gaithersburg, MD) containing 50 U/ml penicillin and 50 µg/ ml streptomycin, supplemented with 10% defined fetal bovine serum (Cansera International Inc., Ontario, Canada), yielding monolayers that contained at least 95% macrophages by morphologic criteria.
Quantitation of Lung Tissue Neutrophils
Quantitation of lung tissue neutrophils was done as described previously (16). Briefly, after BAL, the lungs were
perfused, removed, separated into the individual lobes,
and weighed, after trimming away all extrapulmonary airway tissue. Samples of parenchyma from each lobe, approximating 20% of the total lung wet weight, were pooled,
stored at
70°C, and later freeze-dried. For enzyme extraction, samples were homogenized in 50 mM N-2-hydroxyethylpiperazine-N'-ethane sulfonic acid, pH 8.0, at 0.5%
(dry wt/vol) with a homogenizer; centrifuged at 10,000 × g
for 30 min at 4°C; and the supernatant was discarded. The
pellet was resuspended in 0.5% cetyltrimethylammonium chloride in distilled water, rehomogenized, and centrifuged
again as described previously. An aliquot of the supernatant was taken for analysis of myeloperoxidase (MPO) activity. Lung extracts were diluted 1:10 in 10 mM citrate
buffer, pH 5.0. Aliquots of 75 µl of each sample were pipetted into four wells of a 96-well culture plate (Sumitomo
Bakelite, Tokyo, Japan). Cold stop solution (4 N H2SO4;
150 µl/well) was added to two wells to stop the reaction as
background. The MPO substrate solution (3 mM 3',5,5'-tetramethylbenzidine dihydrochloride, 120 µM resorcinol, and 2.2 mM H2O2 in distilled water; 75 µl/well) was
added to each well, and the reaction was stopped after
2 min with 150 µl/well of cold stop solution. The optical
density (OD)450nm was determined. The enzyme activities of the lung samples were calculated by subtracting the
mean background and are expressed as change in OD per
minute. Standard curves for calculating the number of
neutrophils in the lungs, based on the enzyme activities,
were developed as previously described (17). Briefly, 20 × 106 neutrophils were injected into a piece of noninflamed
control lung, and then tissue was frozen and extracted.
EMSA
The consensus NF-
B binding site was used as a probe
(18) because the upstream promoter region of the guinea
pig IL-8 gene has not yet been determined. The NF-
B
consensus oligonucleotide (Promega Co., Madison, WI)
was 5'-end labeled with T4 polynucleotide kinase and
[
-32P]adenosine triphosphate (ATP) (> 5,000 Ci/mmol;
Amersham International, Tokyo, Japan). Nuclear protein
from guinea pig lung was isolated according to the method
described previously (19). Binding reaction between NF-
B consensus oligonucleotide and nuclear protein was performed in final volume of 10 µl in 4% glycerol, 1 mM
ethylenediaminetetraacetic acid (EDTA), 1 mM dithiothreitol, 100 mM NaCl, 10 mM Tris (pH 7.5), and 0.03 mg/
ml sonicated salmon-sperm DNA. Binding was allowed to
proceed for 20 min at room temperature. To resolve the
complexes, the reactions were applied to 6% nondenaturing polyacrylamide gels in 0.25 × Tris-buffered EDTA
(TBE) buffer containing 0.1% ammonium persulfate. The
gels were run in 0.25 × TBE buffer at 100 V/cm for 1 h at
room temperature with buffer recirculation, and dried.
The retarded band was detected by autoradiography and
quantified by densitometry linked to a computer analysis
system (BAS2000; Fuji Film Co., Tokyo, Japan). Specificity was determined by addition of 100-fold excess unlabeled double-stranded oligonucleotides and by using a nonspecific competitor consisting of the transcriptional factor
activator protein-1 (19, 20).
Supershift assays were performed with polyclonal antibodies to the NF-
B proteins (p65 and p50) purchased
from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).
These antibodies were added to the above reaction mixtures at a concentration of 1 µg/10 µl. The samples were
then incubated at room temperature for 1 h before gel loading.
Immunohistochemical Staining of NF-
B
For immunohistochemical staining of NF-
B, poly-L-lysine-
coated slides containing cryosections were fixed in 4%
paraformaldehyde for 15 min, washed in 0.01 M PBS, and
incubated with methanol containing 0.3% hydrogen peroxide for 20 min at room temperature. After washing and
incubating with 5% normal goat blocking serum, polyclonal rabbit anti-p65 or anti-p50 antibodies were added. The slides were incubated overnight at 4°C, rinsed, and
then incubated with a horseradish peroxidase-conjugated
goat antirabbit immunoglobulin G (IgG) for 2 h at room
temperature. The peroxidase reaction was developed with
0.05% 3,3-diaminobenzidine tetra hydrochloride (DAB;
Sigma, St. Louis, MO) in 50 mM Tris-HCl (pH 7.6) with
0.03% hydrogen peroxide for 1 to 2.5 min. The sections
were counterstained with hematoxylin, dehydrated, and
mounted. Oxidized DAB (a brown, highly insoluble indamine polymer) is visible under light microscopy. To allow a comparison of the NF-
B (p65 and p50) immunoreactivity in the lungs obtained from guinea pigs of three
groups, sections from animals of each group were stained
at the same time using the same procedure.
Immunofluorescence Staining of MPO and NF-
B
For immunofluorescence staining of MPO, p65 and p50, poly-L-lysine-coated slides contained cryosections, and cytospin preparations of BALF were fixed in 4% paraformaldehyde for 15 min and washed in 0.01 M PBS. After washing and incubating with 5% normal goat blocking serum, polyclonal rabbit anti-MPO antibody (DAKO Japan, Kyoto, Japan), anti-p65, or anti-p50 antibodies were added. The slides were incubated overnight at 4°C, rinsed, and then incubated with a 1:100 dilution of fluorescein isothiocyanate-conjugated goat antirabbit IgG for 30 min at room temperature. After rinsing, they were counterstained with 4,6-diamidine-2-phenylindole dihydrochloride (DAPI; Boehringer Mannheim Biochemicals, Indianapolis, IN), mounted with a p-phenylenediamine-glycerol mixture, and observed in an epifluorescent microscope and an ultraviolet-confocal laser scanning microscope (LSM GB200UV; Olympus, Tokyo, Japan).
RT-PCR
Total RNA from guinea pig lungs and bronchoalveolar
macrophages was isolated according to the method of
Chromczynski and Sacchi (21). The primers were designed
from the published sequences from guinea pig IL-8 (neutrophil attractant protein-1) complementary DNA (22) as
follows: sense, 5'TGGTCGTGACAAAGTTGGTC3'; antisense, 5'CCTGCACCCACTTCTTG3'. Primers for
-actin
were: sense, 5'CCAACTGGGACGACATGGAG3'; antisense, 5'CATACCCCTCGTAGATGGGC3'. The PCR
reagents were overlaid with mineral oil, and the amplification for IL-8 was carried out through 30 cycles of denaturation at 95°C for 1 min, annealing at 54°C for 1 min, and
extending at 72°C for 1 min. The annealing temperature
for
-actin was 56°C. The number of amplification cycles
within the exponential amplification phase for both primer sets was determined by terminating amplification reactions
at every other cycle. The PCR products were electrophoresed in 2% agarose gels to visualize the IL-8 and
-actin
bands. The sizes of the PCR products generated were 193 bp for IL-8 and 279 bp for
-actin. Data from ethidium
bromide-stained gel of PCR analysis were assessed using
the Gel Doc 1000 system with Molecular Analyst (Bio-Rad
Laboratories, Tsukuba, Japan).
RT In Situ PCR for IL-8 mRNA
RT in situ PCR was performed as previously described (23). Briefly, poly-L-lysine-coated slides containing cryosections were fixed in S.T.F. for 5 min. The specimens were washed twice with PBS, dehydrated with ethanol, and dried. The specimens were immersed in 20 µg/ml proteinase K in 50 mM Tris-HCl (pH 7.5) and 5 mM EDTA for 10 min at 37°C, then treated with ribonuclease-free deoxyribonuclease (DNase) I (GIBCO BRL) at 37°C overnight. The specimens were incubated directly on the glass slide at 42°C for 30 min with 60 µl of a solution that contained the downstream primer (1 µM) and Molony-murine leukemia virus RT (10 U/µl; GIBCO BRL). The solution for amplification of the IL-8 cDNA contained 4.5 mM MgCl2; 200 µM each of dATP, dCTP, dGTP, and dTTP; 1 µM of each primer; 100 µg/ml of bovine serum albumin; and 10 U of Taq polymerase (Takara Shuzo Co., Shiga, Japan) in 50 µl amplifying solution. The concentration of digoxigenin-11-dUTP (Boehringer Mannheim) in the amplifying solution was 10 µM. The digoxigenin-11-dUTP-labeled PCR product was detected after incubation with an alkaline phosphatase antidigoxigenin conjugate (1:500 dilution in 100 mM Tris-HCl, pH 7.5; 100 mM NaCl; and 50 mM MgCl2) at 37°C for 60 min and development in nitro blue tetrazolium/5-bromo-4-chloro-3-indole phosphate color reaction in a dark room. The positive control for RT in situ PCR was to eliminate DNase digestion. The negative control was RT in situ PCR in which tissue was treated with DNase and the RT step was eliminated.
Statistics
Data are represented as means ± SEM. Statistical analysis of results was performed by analysis of variance following the Newman-Keuls multiple-comparison test using a computer program (PRISM; GraphPad Software, Inc., San Diego, CA). P values less than 0.05 were considered to be significant.
| |
Results |
|---|
|
|
|---|
CS-Induced Neutrophil Accumulation and Its Inhibition by rhSOD
CS-exposed guinea pigs demonstrated a significant increase in the number of neutrophils in BALF (Figure 1A) and lung parenchyma (Figure 1B) at 5 h after acute exposure to CS. Pretreatment of guinea pigs with rhSOD aerosols prevented the increase in the number of neutrophils. There was no significant difference in total cell counts or the number of macrophages, eosinophils, or lymphocytes recovered in BALF in guinea pigs of three groups.
|
At 5 h after CS exposure, some MPO-positive cells were observed in the parenchyma (Figure 2B). In the control group and rhSOD + CS-treated group, there were few MPO-positive cells in the peripheral lungs (Figures 2A and 2C). Similar results were obtained by the histopathologic investigation of lung sections stained with H&E.
|
CS-Induced NF-
B-Binding Activity and
Its Inhibition by rhSOD
EMSAs on nuclear extracts showed a marked increase
in NF-
B DNA-binding activity 5 h after acute exposure
to CS. Pretreatment of guinea pigs with rhSOD aerosols
significantly reduced NF-
B DNA-binding activity in
CS-exposed guinea pigs toward control levels (Figures 3A
and 3B).
|
The supershift assays revealed that NF-
B heterodimers (p65/p50) are activated in lung tissue following
acute exposure to CS (Figure 4), consistent with previous
findings (13, 24).
|
We used immunohistochemistry to determine the cell
type(s) expressing NF-
B protein(s) in the guinea pig
lung. Strong immunoreactivities for p65 and p50 were observed in the nuclei of alveolar macrophages after acute
exposure to CS (Figures 5H and 5K, respectively), but not
in those of neutrophils. Weak immunostaining was obtained in the cytoplasm of alveolar macrophages in the
control and rhSOD + CS-treated guinea pigs (Figures 5G,
5I, 5J, and 5L). No significant immunoreactivities for p65
and p50 were detected in the nuclei of airway epithelial
cells after acute exposure to CS (Figures 5B and 5E), compared with those in the control and rhSOD + CS-treated guinea pigs (Figures 5A, 5C, 5D, and 5F).
|
Immunofluorescence staining provided further evidence of nuclear localization of NF-
B in bronchoalveolar
macrophages after acute exposure to CS. Immunofluorescence activities for p65 and p50 were observed in the nuclei of bronchoalveolar macrophages after acute exposure
to CS (Figures 6B and 6E, respectively). Immunofluorescence staining was obtained in the cytoplasm of alveolar macrophages in the control and rhSOD + CS-treated
guinea pigs (Figures 6A, 6C, 6D, and 6F).
|
CS-Induced IL-8 mRNA Expression and Its Inhibition by rhSOD
Acute exposure to CS resulted in a marked increase in the expression of IL-8 mRNA 5 h after exposure. IL-8 mRNA signal was barely detectable in RNA obtained from control guinea pigs. Pretreatment of rhSOD aerosols almost completely inhibited CS-induced IL-8 mRNA expression to control levels (Figures 7A and 7B). A similar profile of IL-8 mRNA expression was found in RT-PCR analysis of RNA extracted from bronchoalveolar macrophages (Figure 8).
|
|
We used the technique of RT in situ PCR to determined the cell type(s) expressing IL-8 mRNA in the guinea pig lung. IL-8 mRNA was detected in the alveolar space but not the airway epithelium 5 h after acute exposure to CS (Figures 9A and 9E). No signal for IL-8 mRNA was observed in the control or rhSOD + CS-treated guinea pigs (Figures 9B and 9F). In the positive control, which was to eliminate DNase digestion, an intense signal was generated from target-specific amplification, DNA repair, and mispriming (Figure 9C). This control demonstrated that the PCR reaction and the subsequent detection steps worked. In the negative control, in which the tissue was treated with DNase and the RT step was eliminated, the absence of a signal demonstrated that amplification of genomic DNA was not occurring (Figure 9D).
|
There was a significant correlation between the increase of neutrophils in BALF and the expression of IL-8
mRNA (n = 18, r = 0.818, P < 0.0001), and between NF-
B DNA-binding activity and the expression of IL-8
mRNA (n = 18, r = 0.824, P < 0.0001).
| |
Discussion |
|---|
|
|
|---|
We have shown that acute exposure to CS induced neutrophil accumulation to the airways in guinea pigs. The infiltration of neutrophils into the airways was associated with
increase in NF-
B DNA-binding activity and IL-8 mRNA
expression. The upregulation of NF-
B DNA-binding activity and IL-8 mRNA expression was prevented by prior
treatment with an antioxidant, rhSOD, which also inhibited CS-induced neutrophil accumulation to the airways.
These observations support the hypothesis that superoxide is critical for infiltration of neutrophils into the airways
through NF-
B activation and IL-8 mRNA expression after acute exposure of CS in vivo.
Our study showed infiltration of neutrophils into the airways 5 h after acute exposure to CS, comparable with the results of previous studies in guinea pigs, hamsters, and humans (25). It has been shown that exposure to CS for several days causes airway infiltration of neutrophils in guinea pigs (25). BALF from hamsters after 6 wk of smoking contains more neutrophils than does BALF from control animals (26). Similarly, BALF of healthy smokers contains approximately 20 times the normal number of neutrophils (27). In contrast to the present findings, we have previously shown that acute exposure of younger guinea pigs to CS induces airway hyperresponsiveness without detectable neutrophil influx in the airway (28). The difference between the two studies can be explained by the fact that the susceptibility to CS-induced neutrophil accumulation differs between ages (800-950 g versus 350- 450 g). Similarly, age-related alteration in cytokine profiles after specific antigen exposure has been reported in a rat eosinophil accumulation model (29).
Our data also show that the recruitment of neutrophils
into the airways was associated with increases in both NF-
B DNA-binding activity and IL-8 mRNA expression, and
that IL-8 mRNA expression is closely linked to NF-
B
DNA-binding activity following acute exposure to CS in
guinea pigs in vivo. NF-
B is a member of a novel family
of transcription-regulatory factors showing a common structural motif for DNA-binding and dimerization (9). It
regulates the transcription of many cytokine genes, including IL-8. IL-8 is the major neutrophil chemotactic and activating factor in the lung (30). NF-
B binding motifs have
been identified in the proximal promoter regions of human IL-8 gene and appeared to be important in regulating
its transcription (11). Recently, the role of NF-
B in the
production of inflammatory events has been evaluated in
several animal models. Endotoxin induces NF-
B activation, cytokine-induced neutrophil chemoattractant (CINC)
mRNA, and influx of neutrophils in rat lungs (31). Ozone
exposure induces NF-
B activation and CINC mRNA expression in rat lungs (20). NF-
B is activated in mouse
lung tissue by hypovolemic shock, which also leads to the
activation of cytokine production (9).
The present data demonstrate that rhSOD reduced the
increase in NF-
B DNA-binding activity, suggesting that
superoxide has an important role on NF-
B activation after acute exposure to CS in guinea pigs in vivo. In vitro experiments demonstrated activation of NF-
B by reactive
oxygen species, such as superoxide and H2O2 (8). Treatment of endothelial cells and other cell lines with H2O2 activates NF-
B and antioxidants such as N-acetyl cysteine and pyrorolidine dithiocarbamate block activation of NF-
B (8). The production of superoxide anion is followed by
the generation of H2O2 (32). The specific role of superoxide, rather than H2O2, in activating NF-
B has been demonstrated in lung mononuclear cells in vivo (9). Furthermore, upregulation of endogenous oxidant defenses has
been shown to suppress NF-
B activation. The peritoneal
macrophages from transgenic mice that overexpress human CuZnSOD have decreased NF-
B activation (33).
Taken together with the current study, the evidence certainly suggests that superoxide is an important intermediate in NF-
B activation in vivo.
The immunohistochemical and immunofluorescence
staining using antibodies to p65 and p50 showed that
strong NF-
B immunoreactivity was observed in the nuclei of alveolar macrophages after acute exposure to CS.
Furthermore, RT in situ PCR also demonstrated the
strong signal of IL-8 mRNA in the alveolar space after
acute exposure to CS. RT-PCR analysis of RNA extracted
from bronchoalveolar macrophages confirmed the expression of IL-8 mRNA by bronchoalveolar macrophages after acute exposure to CS. It has been reported that IL-8
production by alveolar macrophages is an important
mechanism by which neutrophils are attracted to the lungs
(30). In vitro studies have shown that IL-8 is regulated at
the transcriptional level in alveolar macrophages and that
induction of IL-8 expression is followed by synthesis and
release of the protein (34). Neutrophil accumulation in the
lungs after connective tissue injury is mediated, at least in
part, by factors released from alveolar macrophages (35).
It has also been shown that particulates present in CS can
stimulate alveolar macrophages in vitro and in vivo to exhibit a neutrophil chemotactic activity (36). However, IL-8
not only is a product of alveolar macrophages but also is
generated by lung tissue cells, such as fibroblasts, epithelial cells, neutrophils, and T lymphocytes (37). In the RT in
situ PCR studies, it is not possible to identify the exact cell
types of increased IL-8 mRNA expression, but bronchoalveolar macrophages were demonstrated to be a source of
IL-8 mRNA expression in this study by RT-PCR (Figure
8). Taken together with the present and previous findings, the alveolar macrophage is one potential source of NF-
B
activation and IL-8 mRNA expression after acute exposure to CS.
The present study demonstrates a significant correlation between neutrophil accumulation and IL-8 mRNA
expression after acute exposure to CS. However, this finding does not mean IL-8 is the sole chemotactic factor for
neutrophils in the lung. Although IL-8 is a potent chemotactic factor for neutrophils, many other factors, including bioactive lipids such as leukotriene B4 (LTB4), other chemokines, activated complements, and protein fragments, are
also chemotactic for neutrophils. The same stimuli that
augment IL-8 release often augment the release of other
chemotactic factors (37). The analysis of LTB4 in BALF
using Biotrack LTB4 enzymeimmunoassay system (Amersham International; lower detection limit: 0.31 pg/50 µl of
BALF) failed to detect LTB4 in the BALF after acute exposure to CS. This suggests that LTB4 plays a minor role
in neutrophil accumulation after acute exposure to CS.
The findings in the present study suggest that IL-8 and
NF-
B are increased in the lung after acute exposure to
CS and that the alveolar macrophage is one potential source
of this cytokine.
In conclusion, CS initiates a superoxide-dependent
mechanism that, through activating NF-
B and increasing
IL-8 mRNA expression, produces infiltration of neutrophils into the airways in vivo. Manipulation of NF-
B by
antioxidants in vivo may be useful for limiting biologic
processes such as proinflammatory cytokine production, which may lead to neutrophil accumulation in the lung.
| |
Footnotes |
|---|
Address correspondence to: Masanori Nishikawa, M.D., The First Department of Internal Medicine, Yokohama City University School of Medicine, 3-9 Fukuura, Kanazawa-ku, Yokohama, 236-0004, Japan.
(Received in original form January 12, 1998 and in revised form April 1, 1998).
Abbreviations: bronchoalveolar lavage fluid, BALF; cigarette smoke, CS; 4,6-diamidine-2-phenylindole dihydrochloride, DAPI; deoxyribonuclease, DNase; interleukin-8, IL-8; leukotriene B4, LTB4; myeloperoxidase, MPO; nuclear factor
B, NF-
B; phosphate-buffered saline, PBS; recombinant human superoxide dismutase, rhSOD; reverse transcription-polymerase chain reaction, RT-PCR.
Acknowledgments: The authors acknowledge Dr. Hiromasa Inoue, Research Institute for Diseases of the Chest, Kyushu University, for his valuable suggestion. This study was supported in part by grants from the Smoking Research Foundation of Japan and Grant-in-Aid for Scientific Research No. 07770426 from the Ministry of Education, Science and Culture, Japan.
| |
References |
|---|
|
|
|---|
1.
Repine, J. E.,
A. Bast,
I. Lankhorst, and
The Oxidative Stress Study Group.
1997.
Oxidative stress in chronic obstructive pulmonary disease.
Am. J. Respir. Crit. Care Med.
156:
341-357
2. Mio, T., D. J. Romberger, A. B. Thompson, R. A. Robbins, A. Heires, and S. I. Rennard. 1997. Cigarette smoke induces interleukin-8 release from human bronchial epithelial cells. Am. J. Respir. Crit. Care Med. 155: 1770-1776 [Abstract].
3. Ludwig, P. W., B. A. Schwartz, J. R. Hoidal, and D. E. Niewoehner. 1985. Cigarette smoking causes accumulation of polymorphonuclear leukocytes in alveolar septum. Am. Rev. Respir. Dis. 131: 828-830 [Medline].
4. Thompson, A. B., D. Daughton, R. A. Robbins, M. A. Ghafouri, M. Oehlerking, and S. I. Rennard. 1989. Intraluminal airway inflammation in chronic bronchitis: characterization and correlation with clinical parameters. Am. Rev. Respir. Dis. 140: 1527-1537 [Medline].
5. Pryor, W. A., M. Tamura, M. M. Dooley, P. Premovic, B. J. Hales, and D. F. Church. 1983. Reactive oxy-radicals from cigarette smoke and their physiological effects. In Oxy Radicals and Their Scavenger Systems: Cellular and Medical Aspects, Vol II. R. A. Greenwald and G. Cohen, editors. Elsevier, New York. 185-192.
6. Tsuchiya, M., D. F. T. Thompson, Y. J. Suzuki, C. E. Cross, and L. Packer. 1992. Superoxide formed from cigarette smoke impairs polymorphonuclear leukocyte active oxygen generation activity. Arch. Biochem. Biophys. 299: 30-37 [Medline].
7. Nishikawa, M., M. Kudo, N. Kakemizu, H. Ikeda, and T. Okubo. 1996. Role of superoxide anions in airway hyperresponsiveness induced by cigarette smoke in conscious guinea pig. Lung 174: 279-289 [Medline].
8.
Baldwin, A. S. Jr..
1996.
The NF-
B and I
B proteins: new discoveries and
insights.
Annu. Rev. Immunol.
14:
649-681
[Medline].
9. Shenkar, R., M. D. Schwartz, L. S. Terada, J. E. Repine, J. McCord, and E. Abraham. 1996. Hemorrhage activates NF-kappa-B in murine lung mononuclear cells in vivo. Am. J. Physiol. 14: L729-L735 .
10.
Blackwell, T. S., and
J. W. Christman.
1997.
The role of nuclear factor-
B in
cytokine regulation.
Am. J. Respir. Cell Mol. Biol.
17:
3-9
11.
Yasumoto, K.,
S. Okamoto,
N. Mukaida,
S. Murakami,
M. Mai, and
K. Matsushima.
1992.
Tumor necrosis factor
and interferon
synergistically induce interleukin 8 production in a human gastric cancer cell line through
acting concurrently on AP-1 and NF-
B-like binding sites of the interleukin 8 gene.
J. Biol. Chem.
267:
22506-22511
12.
Jorens, P. G.,
E. J. Richman,
B. P. Housset,
P. D. Graf,
I. F. Ueki,
J. Olesch, and
J. A. Nadel.
1992.
Interleukin-8 induces neutrophil accumulation but
not protease secretion in the canine trachea.
Am. J. Physiol.
263:
L708-L713
13. Simeonova, P. P., and M. I. Luster. 1996. Asbestos induction of nuclear transcription factors and interleukin 8 gene regulation. Am. J. Respir. Cell Mol. Biol. 15: 787-795 [Abstract].
14. Morino, T., M. Morita, K. Seya, Y. Sukenaga, K. Kato, and T. Nakamura. 1988. Construction of a runaway vector and its use for a high-level expression of a cloned human superoxide dismutase gene. Appl. Microbiol. Biotechnol. 28: 170-175 .
15. Nishikawa, M., H. Ikeda, H. Nishiyama, H. Yamakawa, S. Suzuki, and T. Okubo. 1992. Combined effects of ozone and cigarette smoke on airway responsiveness and vascular permeability in guinea pig. Lung 170: 311-322 [Medline].
16.
Schneider, T.,
D. van Velzen,
R. Moqbel, and
A. C. Issekutz.
1997.
Kinetics
and quantitation of eosinophil and neutrophil recruitment to allergic lung
inflammation in a brown Norway rat model.
Am. J. Respir. Cell Mol. Biol.
17:
702-712
17. Schneider, T., and A. C. Issekutz. 1996. Quantitation of eosinophil and neutrophil infiltration into rat lung by specific assays for eosinophil peroxidase and myeloperoxidase: application in a brown Norway rat model of allergic pulmonary inflammation. J. Immunol. Methods 198: 1-14 [Medline].
18.
Brennan, P., and
L. A. J. O'Neill.
1995.
Effects of oxidants and antioxidants
on nuclear factor
B activation in three different cell lines: evidence
against a universal hypothesis involving oxygen radicals.
Biochim. Biophys. Acta
1260:
167-175
[Medline].
19.
Nishikawa, M.,
J. C. W. Mak,
H. Shirasaki, and
P. J. Barnes.
1993.
Differential down-regulation of pulmonary
1- and
2-adrenoceptor messenger
RNA with prolonged in vivo infusion of isoprenaline.
Eur. J. Pharmacol.
247:
131-138
[Medline].
20. Haddad, E. B., M. Salmon, H. Koto, P. J. Barnes, I. Adcock, and K. F. Chung. 1996. Ozone induction of cytokine-induced neutrophil chemoattractant (CINC) and nuclear factor-kappa B in rat lung: inhibition by corticosteroids. FEBS Lett. 379: 265-268 [Medline].
21. Chromczynski, P., and N. Sacci. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159 [Medline].
22. Yoshimura, T., and D. G. Johnson. 1993. cDNA cloning and expression of guinea pig neutrophil attractant protein-1 (NAP-1). J. Immunol. 151: 6225-6236 [Abstract].
23. Hagimoto, N., K. Kuwano, Y. Nomoto, R. Kunitake, and N. Hara. 1997. Apoptosis and expression of Fas/Fas ligand mRNA in bleomycin-induced pulmonary fibrosis in mice. Am. J. Respir. Cell Mol. Biol. 16: 91-101 [Abstract].
24.
Blackwell, T. S.,
E. P. Holden,
T. R. Blackwell,
B. W. Christman, and
J. W. Christman.
1996.
Activation of NF-
B in rat lung by treatment with endotoxin: modulation by treatment with N-acetylcysteine.
J. Immunol.
157:
1630-1637
[Abstract].
25. Hulbert, W. C., D. C. Walker, A. Jackson, and J. C. Hogg. 1981. Airway permeability to horseradish peroxidase in guinea pigs: the repair phase after injury by cigarette smoke. Am. Rev. Respir. Dis. 123: 320-326 [Medline].
26. Hoidal, J. R., and D. E. Niewoehner. 1982. Lung phagocyte recruitment and metabolic alternations induced by cigarette smoke in humans and in hamsters. Am. Rev. Respir. Dis. 126: 548-552 [Medline].
27. McGowan, S. E., P. J. Stone, J. D. Calore, G. L. Snider, and C. Franzblau. 1983. The fate of neutrophil elastase incorporated by human alveolar macrophages. Am. Rev. Respir. Dis. 127: 449-455 [Medline].
28. Nishikawa, M., H. Ikeda, T. Fukuda, S. Suzuki, and T. Okubo. 1990. Acute exposure to cigarette smoke induces airway hyperresponsiveness without airway inflammation in guinea pigs: dose-response characteristics. Am. Rev. Respir. Dis. 142: 177-183 [Medline].
29. Yagi, T., A. Sato, H. Hayakawa, and K. Ito. 1997. Failure of aged rats to accumulate eosinophils in allergic inflammation of the airway. J. Allergy Clin. Immunol. 99: 38-43 [Medline].
30. Kunkel, S. L., T. Standiford, K. Kasahara, and R. M. Strieter. 1991. Interleukin-8: the major neutrophil chemotactic factor in the lung. Exp. Lung Res. 17: 17-23 [Medline].
31.
Blackwell, T. S.,
E. P. Holden,
T. R. Blackwell,
J. E. DeLarco, and
J. W. Christman.
1994.
Cytokine-induced neutrophil chemoattractant mediates
neutrophilic alveolitis in rats: association with nuclear factor
B activation.
Am. J. Respir. Cell Mol. Biol.
11:
464-472
[Abstract].
32. Cross, C. E., A. van der Vliet, C. A. O'Neil, and J. P. Eiserich. 1994. Reactive oxygen species and the lung. Lancet 344: 930-937 [Medline].
33. Mirochnitchenko, O., and M. Inouye. 1996. Effects of overexpression of human Cu, Zn superoxide dismutase in transgenic mice on macrophage functions. J. Immunol. 156: 1578-1586 [Abstract].
34.
Strieter, R. M.,
S. W. Chensue,
M. A. Basha,
T. J. Standiford,
J. P. Lynch III,
M. Baggiolini, and
S. L. Kunkel.
1990.
Human alveolar macrophage
gene expression of interleukin-8 by tumor necrosis factor-
, lipopolysaccharide, and interleukin-1
.
Am. J. Respir. Cell Mol. Biol.
2:
321-326
.
35. Laskin, D. L., R. A. Soltys, R. A. Berg, and D. J. Riley. 1990. Activation of neutrophils by factors released from alveolar macrophages stimulated with collagen-like polypeptides. Am. J. Respir. Cell Mol. Biol. 2: 463-470 .
36. Gadek, J. E., G. W. Hunninghake, R. L. Zimmerman, and R. G. Crystal. 1980. Regulation of the release of alveolar macrophage-derived neutrophil chemotactic factor. Am. Rev. Respir. Dis. 121: 723-733 [Medline].
37.
Baggiolini, M.,
B. Dewald, and
B. Moser.
1994.
Interleukin-8 and related
chemotactic cytokines
CXC and CC chemokines.
Adv. Immunol.
55:
97-179
[Medline].
This article has been cited by other articles:
![]() |
K. F. Chung and I. M. Adcock Multifaceted mechanisms in COPD: inflammation, immunity, and tissue repair and destruction Eur. Respir. J., June 1, 2008; 31(6): 1334 - 1356. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Churg, M. Cosio, and J. L. Wright Mechanisms of cigarette smoke-induced COPD: insights from animal models Am J Physiol Lung Cell Mol Physiol, April 1, 2008; 294(4): L612 - L631. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. Thatcher, S. B. Maggirwar, C. J. Baglole, H. F. Lakatos, T. A. Gasiewicz, R. P. Phipps, and P. J. Sime Aryl Hydrocarbon Receptor-Deficient Mice Develop Heightened Inflammatory Responses to Cigarette Smoke and Endotoxin Associated with Rapid Loss of the Nuclear Factor-{kappa}B Component RelB Am. J. Pathol., March 1, 2007; 170(3): 855 - 864. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Baginski, K. Dabbagh, C. Satjawatcharaphong, and D. C. Swinney Cigarette Smoke Synergistically Enhances Respiratory Mucin Induction by Proinflammatory Stimuli Am. J. Respir. Cell Mol. Biol., August 1, 2006; 35(2): 165 - 174. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Szulakowski, A. J. L. Crowther, L. A. Jimenez, K. Donaldson, R. Mayer, T. B. Leonard, W. MacNee, and E. M. Drost The Effect of Smoking on the Transcriptional Regulation of Lung Inflammation in Patients with Chronic Obstructive Pulmonary Disease Am. J. Respir. Crit. Care Med., July 1, 2006; 174(1): 41 - 50. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-R. Yang, A. S. Chida, M. R. Bauter, N. Shafiq, K. Seweryniak, S. B. Maggirwar, I. Kilty, and I. Rahman Cigarette smoke induces proinflammatory cytokine release by activation of NF-{kappa}B and posttranslational modifications of histone deacetylase in macrophages Am J Physiol Lung Cell Mol Physiol, July 1, 2006; 291(1): L46 - L57. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Regueiro, M. A. Campos, J. Pons, S. Alberti, and J. A. Bengoechea The uptake of a Klebsiella pneumoniae capsule polysaccharide mutant triggers an inflammatory response by human airway epithelial cells Microbiology, February 1, 2006; 152(2): 555 - 566. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kubo, M. Kobayashi, Y. Masunaga, H. Ishii, Y. Hirano, K. Takahashi, and Y. Shimizu Cytokine and chemokine expression in cigarette smoke-induced lung injury in guinea pigs Eur. Respir. J., December 1, 2005; 26(6): 993 - 1001. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. MacNee Treatment of stable COPD: antioxidants Eur. Respir. Rev., September 1, 2005; 14(94): 12 - 22. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. MacNee Pulmonary and Systemic Oxidant/Antioxidant Imbalance in Chronic Obstructive Pulmonary Disease Proceedings of the ATS, April 1, 2005; 2(1): 50 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
E M Drost, K M Skwarski, J Sauleda, N Soler, J Roca, A Agusti, and W MacNee Oxidative stress and airway inflammation in severe exacerbations of COPD Thorax, April 1, 2005; 60(4): 293 - 300. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Marwick, P. A. Kirkham, C. S. Stevenson, H. Danahay, J. Giddings, K. Butler, K. Donaldson, W. MacNee, and I. Rahman Cigarette Smoke Alters Chromatin Remodeling and Induces Proinflammatory Genes in Rat Lungs Am. J. Respir. Cell Mol. Biol., December 1, 2004; 31(6): 633 - 642. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Koch, M. Giembycz, R.G. Stirling, S. Lim, I. Adcock, K. Wassermann, E. Erdmann, and K.F. Chung Effect of smoking on MAP kinase-induced modulation of IL-8 in human alveolar macrophages Eur. Respir. J., June 1, 2004; 23(6): 805 - 812. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Wang, H. Tai, C. Xie, X. Wang, J. L. Wright, and A. Churg Cigarette Smoke Produces Airway Wall Remodeling in Rat Tracheal Explants Am. J. Respir. Crit. Care Med., November 15, 2003; 168(10): 1232 - 1236. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Iho, Y. Tanaka, R. Takauji, C. Kobayashi, I. Muramatsu, H. Iwasaki, K. Nakamura, Y. Sasaki, K. Nakao, and T. Takahashi Nicotine induces human neutrophils to produce IL-8 through the generation of peroxynitrite and subsequent activation of NF-{kappa}B J. Leukoc. Biol., November 1, 2003; 74(5): 942 - 951. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Di Stefano, G. Caramori, T. Oates, A. Capelli, M. Lusuardi, I. Gnemmi, F. Ioli, K.F. Chung, C.F. Donner, P.J. Barnes, et al. Increased expression of nuclear factor-{kappa}B in bronchial biopsies from smokers and patients with COPD Eur. Respir. J., September 1, 2002; 20(3): 556 - 563. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bosio, C. Knorr, U. Janssen, S. Gebel, H.-J. Haussmann, and T. Muller Kinetics of gene expression profiling in Swiss 3T3 cells exposed to aqueous extracts of cigarette smoke Carcinogenesis, May 1, 2002; 23(5): 741 - 748. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Stockley Neutrophils and the Pathogenesis of COPD* Chest, May 1, 2002; 121(5_suppl): 151S - 155S. [Full Text] [PDF] |
||||
![]() |
J. L. Wright and A. Churg A Model of Tobacco Smoke-Induced Airflow Obstruction in the Guinea Pig* Chest, May 1, 2002; 121(5_suppl): 188S - 191S. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Gilmour, I. Rahman, S. Hayashi, J. C. Hogg, K. Donaldson, and W. MacNee Adenoviral E1A primes alveolar epithelial cells to PM10-induced transcription of interleukin-8 Am J Physiol Lung Cell Mol Physiol, September 1, 2001; 281(3): L598 - L606. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.F. Chung Cytokines in chronic obstructive pulmonary disease Eur. Respir. J., July 2, 2001; 18(34_suppl): 50S - 59s. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. TAKIZAWA, M. TANAKA, K. TAKAMI, T. OHTOSHI, K. ITO, M. SATOH, Y. OKADA, F. YAMASAWA, K. NAKAHARA, and A. UMEDA Increased Expression of Transforming Growth Factor-{beta}1 in Small Airway Epithelium from Tobacco Smokers and Patients with Chronic Obstructive Pulmonary Disease (COPD) Am. J. Respir. Crit. Care Med., May 1, 2001; 163(6): 1476 - 1483. [Abstract] [Full Text] |
||||
![]() |
S. Gebel and T. Muller The Activity of NF-{{kappa}}B in Swiss 3T3 Cells Exposed to Aqueous Extracts of Cigarette Smoke Is Dependent on Thioredoxin Toxicol. Sci., January 1, 2001; 59(1): 75 - 81. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takeyama, B. Jung, J. J. Shim, P.-R. Burgel, T. Dao-Pick, I. F. Ueki, U. Protin, P. Kroschel, and J. A. Nadel Activation of epidermal growth factor receptors is responsible for mucin synthesis induced by cigarette smoke Am J Physiol Lung Cell Mol Physiol, January 1, 2001; 280(1): L165 - L172. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hill, S. Gompertz, and R. Stockley Factors influencing airway inflammation in chronic obstructive pulmonary disease Thorax, November 1, 2000; 55(11): 970 - 977. [Full Text] |
||||
![]() |
I. Rahman and W. MacNee Lung glutathione and oxidative stress: implications in cigarette smoke-induced airway disease Am J Physiol Lung Cell Mol Physiol, December 1, 1999; 277(6): L1067 - L1088. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Crit. Care Med. |