1-Antitrypsin Gene and the Risk of
Chronic Obstructive Pulmonary Disease
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
Abstract |
|---|
|
|
|---|
Chronic obstructive pulmonary disease (COPD) has been associated with heterozygosity for the Z and S
alleles of the
1-antitrypsin gene in some studies, but these observations have not been confirmed by others. Cigarette smoking is the major risk factor for COPD and may have been a confounding factor in many
of the previous studies. We investigated whether the Z or S alleles were more prevalent in a group of heavy
smokers with COPD than in a group of nonobstructed smokers. Forced expiratory volume in 1 s and forced
vital capacity were derived for 266 patients undergoing lobar or lung resection. These lung-function measurements were used to divide the patients into a COPD group and a group of nonobstructed control subjects. The subjects were typed for the Z and S alleles of the
1-antitrypsin gene using a polymerase chain
reaction-based technique. In the COPD patients, 12 of 193 (6%) were heterozygous for the Z allele (MZ)
compared with 0 of 73 control subjects, which gave a P value of 0.04 after correction for age, gender, and
smoking history. There was no association of the S allele with COPD. The results indicate that the Z, but
not the S, allele is a risk factor for COPD in the heterozygous state.
| |
Introduction |
|---|
|
|
|---|
Chronic obstructive pulmonary disease (COPD) is characterized by decreased expiratory flow rates, increased pulmonary resistance, and hyperinflation. The processes that underlie these symptoms are thought to be proteolytic destruction of the lung parenchyma and inflammatory narrowing of the peripheral airways.
The association between very low serum concentrations
of
1-antitrypsin and pulmonary emphysema was originally described by Laurell and Eriksson (1).
1-Antitrypsin is a serine protease inhibitor (Pi) that primarily binds
neutrophil elastase and therefore prevents the breakdown
of elastic tissue, mainly in the lung. More than 70 different
biochemical variants, or Pi types, have been described (2).
The most common variant, M, consists of at least six subtypes, all characterized by normal serum
1-antitrypsin levels. The Z and S variants are associated with
1-antitrypsin deficiency. The population prevalences for the MM,
MS, and MZ genotypes among whites are 86, 9, and 3%,
respectively (3). MM individuals have normal levels of
1-antitrypsin, whereas MS and MZ individuals have mean
levels of 75% and 57% of normal, respectively. Individuals
with the ZZ genotype have severe
1-antitrypsin deficiency, with mean levels at ~ 15% of normal, and are at increased risk for COPD (4). Homozygosity for the S allele
results in a mean
1-antitrypsin level ~ 52% of normal and
occurs in ~ 0.1% of whites (5, 6). Individuals with the SS
genotype may have an increased risk for emphysema (7, 8).
SZ compound heterozygotes are also at risk for COPD (9).
The issue of whether the Z and S alleles are risk factors for COPD in the heterozygous state remains controversial. Several case-control studies have found a higher prevalence of MZ heterozygotes among COPD patients than in control populations (7, 8, 10). However, comparisons of MZ individuals with MM subjects from the general population have generally found no excess risk of COPD (or decline in respiratory function) associated with MZ heterozygosity (16).
We have investigated the prevalence of
1-antitrypsin
genotypes in a group of heavy cigarette smokers with and
without airway obstruction. The subjects for both groups
were selected on the basis of their development of bronchogenic cancer, which resulted in a study population with
a high level of exposure to cigarette smoke. Therefore,
the COPD patients could be compared with individuals who had maintained normal airway function despite being
chronic heavy smokers. Measurements of lung elastic recoil (maximal static recoil pressure [PLmax]) and emphysema were available for the majority of subjects. Therefore, we were able to investigate whether the Z allele was
associated with emphysema and loss of elastic recoil, as
suggested by previous studies (24). By employing a polymerase chain reaction (PCR) method to genotype the
samples, we were able to include individuals in the study
for whom only paraffin-embedded tissue samples were available.
| |
Materials and Methods |
|---|
|
|
|---|
Subjects
Subjects for the study were recruited from 532 patients undergoing lobar or lung resection. Before surgery, the patients completed an interviewer-administered questionnaire regarding smoking history, occupational exposure to dusts or fumes, and respiratory symptoms. Lung-function measurements made on each patient included subdivisions of lung volume measured in a pressure-compensated body plethysmograph, and maximal expiratory flow and volume. Values of forced expiratory volume in 1 s (FEV1), forced vital capacity (FVC), and the FEV1/FVC ratio were calculated. In 63% of the subjects a pressure volume curve of the lung was also obtained, from which the PLmax was derived as previously described (25). In 68% of the subjects, resected lung samples were graded for emphysema as previously described (26).
Any patients in whom the lung lesion was obstructing a segmental or larger bronchus, or in whom there was evidence of significant obstructive pneumonitis, were not included in the study because these conditions may influence lung function. There were 28 nonsmokers who were excluded from the study groups.
On the basis of the lung function tests, the remaining 504 patients were divided into those with and without significant airway obstruction. Obstructed patients were those who had an FEV1 < 80% predicted and an FEV1/ FVC < 70%. Nonobstructed patients were those who had an FEV1 > 85% predicted and an FEV1/FVC > 75%. There were 219 patients classified as obstructed, and 73 as nonobstructed. All of the patients were of white ancestry. We were able to extract and amplify DNA successfully from 266 of these subjects, including 193 obstructed and 73 nonobstructed patients. In this population the mean age was 63 ± 10 yr, and mean cigarette smoking was 55 ± 33 pack-yr. The 212 subjects with intermediate levels of lung function were not used in the study.
Genotyping
Genomic DNA was extracted from frozen lung-tissue samples, peripheral blood leukocytes (27), or paraffin-embedded tissue samples (28) by standard techniques.
Detection of the Pi Z allele was performed by a modification of the PCR method described by Dry (29). For PCR amplification of the region of exon V containing the Z mutation, the following oligonucleotide primers were used: 5'TAAGGCTGTGCTGACCATCGTC3' and 5'CAAAGGGTTTGTTGAACTTGACC3'.
PCR was carried out in a 20-µl volume containing 100 ng genomic DNA; 1 µM of each primer; 200 µM each of dGTP, dCTP, dTTP, and dATP; 1.5 mM MgCl2; and 0.5 U Taq DNA polymerase. Amplification conditions were 40 cycles of 94°C for 30 s, 59°C for 30 s, and 72°C for 10 s. Samples were then digested at 65°C with 10 U of TaqI restriction enzyme, and electrophoresed on 3% agarose gels stained with ethidium bromide. The amplification produced a 110-base pair (bp) product and introduced a TaqI restriction site into the wild-type M allele but not into the Z allele. Therefore, after TaqI digestion, the M allele was cut into 89- and 21-bp bands, whereas the Z allele remained as a 110-bp band (Figure 1).
|
Analysis of the S allele in exon III was performed by a similar method. Primers were designed so that the upstream primer introduced an artificial TaqI restriction site in the M allele but not in the S allele. Primers for this analysis were 5'GAGGGGAAACTACAGCACCTCG3' and 5'ACCCTCAGGTTGGGGAATCACC3'. The PCR was carried out using the same conditions as the Z mutation. The amplification produced a 98-bp product that was subsequently digested with 10 U of TaqI. The M allele sequence contained a TaqI restriction site and therefore was cut into 78- and 20-bp bands, but the S allele remained as a 98-bp band (Figure 1). Samples of these restriction enzyme analyses were confirmed using sequence-specific oligonucleotide (SSO) probes as described by Bruun-Petersen and colleagues (30).
Data Analysis
The associations of the Z and S mutations with obstruction were tested by the score test from logistic regression. Analyses were adjusted for the effects of age, sex, and smoking. Smoking was examined by cigarette years: the number of years smoked times the number of cigarettes smoked per day.
| |
Results |
|---|
|
|
|---|
The mean physiologic and morphologic data for the two groups are shown in Table 1. Because the obstructed and nonobstructed groups were significantly different for age, sex, and smoking, the results were corrected for these potentially confounding factors by logistic regression.
|
Pi S Typing
The prevalence of MS heterozygosity in all of the study subjects was 23 of 266 (9%). In addition, 2 of 266 (1%) subjects were found with the SS genotype. The distribution of genotypes was consistent with previous studies of white populations (3). The results are summarized according to phenotype in Table 2. The genotypes of all the MS and SS individuals were confirmed using the SSO method.
|
In the obstructed group, 16 of 193 subjects (8%) were MS, compared with 7 of 73 (10%) in the nonobstructed subjects. The two SS homozygotes were from the obstructed group. The FEV1 values for these subjects were 71% and 70% predicted, and the FEV1/FVC values were 64% and 61%. The odds ratio associated with the MS/SS genotypes was 0.80 (95% CI = 0.29, 2.18) after correction for age, sex, and smoking history, and was not significant (P = 0.65).
Pi Z Typing
Twelve of 266 (4%) of the subjects in the study were heterozygous for the Z allele, and no ZZ individuals were detected. These data were consistent with previous population studies of white individuals (3). The prevalence of the MZ genotype in the obstructed and nonobstructed groups is summarized in Table 2. All of the MZ genotypes were confirmed by SSO typing.
The Z allele was found in 12 of 193 (6%) of the obstructed group compared with 0 of 73 subjects in the nonobstructed control group. The MZ genotype was associated with airway obstruction after correction for age, sex, and smoking history (P = 0.04). It was not possible to calculate an odds ratio for this genotype because none of the control group had the mutation. There were no significant differences in mean PLmax % predicted (89% versus 80%, P = 0.62) or mean emphysema score (14 versus 16, P = 0.77) in obstructed subjects with the MZ genotype versus obstructed patients with the MM genotype.
| |
Discussion |
|---|
|
|
|---|
Previous studies of
1-antitrypsin deficiency alleles and
the risk of COPD have been of two designs. First, case-
control studies were used to compare the prevalence of
MZ and MS heterozygotes in groups of COPD patients
and in control subjects. The usual finding from these studies was that the presence of the MZ genotype was a significant risk factor for COPD (7, 8, 10). The major criticism of these studies has been that the cases and controls were ascertained separately with different recruitment
strategies. This may lead to a systematic difference between cases and controls (e.g., in ethnic background) that
may bias the results.
The second type of study designed to detect an effect of S and Z heterozygosity involved selecting samples of individuals with MZ or MS genotypes for comparison with MM individuals. For the most part these population studies have shown no increased risk of impaired lung function with heterozygosity for either allele (16). The major problem with these studies is that they have insufficient power to detect a factor that produces a modest increase in risk. In addition, many of the subjects in these studies were not old enough to have developed COPD or were nonsmokers. However, in some population studies MZ individuals were found to have significantly worse lung function (14, 31).
In the present study we used a novel design to improve the power of the case-control approach and decrease the chance of ascertainment bias. By selecting only those individuals who have smoked enough to develop lung cancer we attempted to ensure that both the cases and the controls had a high exposure to the most important risk factor for airway obstruction. However, the obstructed group was older, had smoked more, and had a higher percentage of males than the nonobstructed group. These differences may have accounted for the development of COPD in the obstructed group. Therefore, we adjusted the results of the analyses by logistic regression.
The genotype frequencies in our study subjects (9% MS, 4% MZ) were similar to those found in general white populations (9% MS, 3% MZ) (3). We did not identify any ZZ homozygotes in our study groups. Previous studies have found that 1 to 3% of COPD patients have the ZZ genotype (8, 11). We may have found fewer ZZ homozygotes than expected because our subjects were recruited from lung cancer patients. It is possible that ZZ individuals would have experienced fatal loss of lung function before they could have smoked enough to develop lung cancer. Alternatively, these individuals may have had early onset COPD with lung function sufficiently impaired to preclude lung resection.
There was no association of the MZ genotype with emphysema or loss of elastic recoil. However, we cannot rule out such associations because the number of MZ subjects for whom these data were available was small (emphysema score, n = 7; PLmax, n = 5). In addition, although patients who have COPD and are homozygous ZZ often have a pure form of emphysema, they may also present with primarily airway disease (36).
Because all subjects were ascertained in the same way, the risk for a systematic bias in the genotype distribution was minimized. However, we recognize the possibility that an association observed in patients with lung cancer may not be applicable to the general population.
We devised genotyping protocols that allowed detection of the Z and S alleles by PCR. The products of the amplification were designed to be short DNA fragments of approximately 100 bp. This enabled us to analyze DNA extracted from archival material in the form of blocks of paraffin-embedded tissue. DNA from such a source is frequently degraded, and it is often only possible to amplify small molecules. This approach permitted us to use the considerable patient resources available as pathologic specimens. By using a mismatched primer in the PCR reaction we were able to genotype the samples using TaqI restriction enzyme. This is a rapid, reliable, and inexpensive procedure that allowed efficient study of a large number of samples.
The results demonstrated no difference in the prevalence of MS heterozygotes in the obstructed group compared with the nonobstructed. This result may reflect the fact that the S allele is a mild deficiency variant and if an increased risk of COPD is associated with the allele, it would be expected to be small. In some case-control studies an increased prevalence of MS genotypes in COPD patients has been reported (7, 8), whereas in others no association was found (12, 13, 15). Population studies have failed to detect increased risk of impaired lung function associated with the MS genotype (16, 18, 20). However, it is possible that the S allele may contribute to the susceptibility to COPD in conjunction with other factors (either genetic or environmental). The two individuals with the SS genotype had COPD, consistent with previous observations that this genotype is more prevalent in subjects with airway obstruction (7, 8).
The Z allele causes a more severe deficiency of
1-antitrypsin, and the results of this study show that all of the
MZ individuals in our population had COPD. This association was significant even after correction for potentially
confounding factors such as age and smoking history.
These results support previous studies that have suggested
that the Z allele is a risk factor for COPD in the heterozygous state (7, 8, 10). The data indicate that intermediate deficiency of
1-antitrypsin enhances the decline in
lung function that accompanies chronic exposure to cigarette smoke.
In summary, we have used a novel study design to examine further the risk for COPD associated with S and Z heterozygosity. Although there was no increased risk for COPD associated with the presence of the S allele, we found that the prevalence of MZ individuals was increased in the COPD group compared with control subjects.
| |
Footnotes |
|---|
Address correspondence to: Andrew Sandford, UBC Pulmonary Research Laboratory, St. Paul's Hospital, 1081 Burrard St., Vancouver, BC, V6Z 1Y6 Canada.
(Received in original form September 12, 1997 and in revised form April 1, 1998).
Abbreviations: base pair, bp; chronic obstructive pulmonary disease, COPD; forced expiratory volume in 1 s, FEV1; forced vital capacity, FVC; protease inhibitor, Pi; polymerase chain reaction, PCR; maximal static recoil pressure, PLmax; sequence-specific oligonucleotide, SSO.Acknowledgments: This work was supported by a grant from the British Columbia Lung Association. One author (A.J.S.) is an MRC-CLA postdoctoral fellow.
| |
References |
|---|
|
|
|---|
1. Laurell, C. B., and S. Eriksson. 1963. The electrophoretic alpha1-globulin pattern of serum in alpha1-antitrypsin deficiency. Scand. J. Clin. Invest. 15: 132-140 .
2. Cox, D. W., A. M. Johnson, and M. K. Fagerhol. 1980. Report of nomenclature meeting for alpha1-antitrypsin. Hum. Genet. 53: 429-433 [Medline].
3. Hutchison, D. C. S. 1990. Epidemiology of alpha1-protease inhibitor deficiency. Eur. Respir. J. 3(Suppl. 9):29s-34s.
4. Brantley, M. L., L. D. Paul, B. H. Miller, R. T. Falk, M. Wu, and R. G. Crystal. 1988. Clinical features and history of the destructive lung disease associated with alpha1-antitrypsin deficiency of adults with pulmonary symptoms. Am. Rev. Respir. Dis. 138: 327-336 [Medline].
5. Lieberman, J.. 1969. Heterozygous and homozygous alpha1-antitrypsin deficiency in patients with pulmonary emphysema. N. Engl. J. Med. 281: 279-284 .
6. Lieberman, J., L. Gaidulis, and L. Roberts. 1976. Racial distribution of alpha1-antitrypsin variants among junior high school students. Am. Rev. Respir. Dis. 114: 1194-1198 [Medline].
7.
Lieberman, J.,
B. Winter, and
A. Sastre.
1986.
Alpha1-antitrypsin Pi-types
in 965 COPD patients.
Chest
89:
370-373
8. Mittman, C., J. Lieberman, and J. Rumsfeld. 1974. Prevalence of abnormal protease inhibitor phenotypes in patients with chronic obstructive lung disease. Am. Rev. Respir. Dis. 109: 295-296 [Medline].
9.
Turino, G. M.,
A. F. Barker,
M. L. Brantly,
A. B. Cohen,
R. P. Connelly,
R. G. Crystal,
E. Eden,
M. D. Schluchter, and
J. K. Stoller.
1996.
Clinical
features of individuals with PI*SZ phenotype of
1-antitrypsin deficiency.
Am. J. Respir. Crit. Care Med.
154:
1718-1725
[Abstract].
10. Shigeoka, J. W., W. J. Hall, R. W. Hyde, R. H. Schwartz, G. S. Mudholkar, D. M. Speers, and C. C. Lin. 1976. The prevalence of alpha1-antitrypsin heterozygotes (PiMZ) in patients with obstructive pulmonary disease. Am. Rev. Respir. Dis. 114: 1077-1084 [Medline].
11. Bartmann, K., M. Fooke-Achterrath, G. Koch, I. Nagy, I. Schütz, E. Weis, and M. Zierski. 1985. Heterozygosity in the Pi-system as a pathogenetic cofactor in chronic obstructive pulmonary disease (COPD). Eur. J. Respir. Dis. 66: 284-296 [Medline].
12. Cox, D. W., V. H. Hoeppner, and H. Levison. 1976. Protease inhibitors in patients with chronic obstructive pulmonary disease: the alpha1-antitrypsin heterozygote controversy. Am. Rev. Respir. Dis. 113: 601-606 [Medline].
13.
Janus, E. D..
1988.
Alpha1-antitrypsin Pi types in COPD patients.
Chest
94:
446-447
14. Tárjan, E., P. Magyar, Z. Váczi, Å. Lantos, and L. Vaszár. 1994. Longitudinal lung function study in heterozygous PiMZ phenotype subjects. Eur. Respir. J. 7: 2199-2204 [Abstract].
15. Kueppers, F., R. D. Miller, H. Gordon, N. G. Hepper, and K. Offord. 1977. Familial prevalence of chronic obstructive pulmonary disease in a matched pair study. Am. J. Med. 63: 336-342 [Medline].
16. Chan-Yeung, M., M. J. Ashley, P. Corey, and H. Maledy. 1978. Pi phenotypes and the prevalence of chest symptoms and lung function abnormalities in workers employed in dusty industries. Am. Rev. Respir. Dis. 117: 239-245 [Medline].
17. McDonagh, D. J., S. P. Nathan, R. J. Knudson, and M. D. Lebowitz. 1979. Assessment of alpha-1-antitrypsin deficiency heterozygosity as a risk factor in the etiology of emphysema. J. Clin. Invest. 63: 299-309 .
18. Morse, J. O., M. D. Lebowitz, R. J. Knudson, and B. Burrows. 1977. Relation of protease inhibitor phenotypes to obstructive lung diseases in a community. N. Engl. J. Med. 296: 1190-1194 [Abstract].
19. Bruce, R. M., B. H. Cohen, E. L. Diamond, R. J. Fallat, R. J. Knudson, M. D. Lebowitz, C. Mittman, C. D. Patterson, and M. S. Tockman. 1984. Collaborative study to assess risk of lung disease in Pi MZ phenotype subjects. Am. Rev. Respir. Dis. 130: 386-390 [Medline].
20. Buist, A. S., G. J. Sexton, A.-M. H. Azzam, and B. E. Adams. 1979. Pulmonary function in heterozygotes for alpha1-antitrypsin deficiency: a case-control study. Am. Rev. Respir. Dis. 120: 759-766 [Medline].
21.
Cole, R. B.,
N. C. Nevin,
G. Blundell,
J. D. Merrett,
J. R. McDonald, and
W. P. Johnston.
1976.
Relation of alpha-1-antitrypsin phenotype to the
performance of pulmonary function tests and to the prevalence of respiratory illness in a working population.
Thorax
31:
149-157
22. Lebowitz, M. D., R. J. Knudson, J. O. Morse, and D. Armet. 1978. Closing volume and flow volume abnormalities in alpha1-antitrypsin phenotype groups in a community population. Am. Rev. Respir. Dis. 117: 179-181 [Medline].
23.
Webb, D. R.,
R. W. Hyde,
R. H. Schwartz,
W. J. Hall,
J. J. Condemi, and
T. L. Townes.
1973.
Serum
1-antitrypsin variants.
Am. Rev. Respir. Dis.
108:
918-925
[Medline].
24. Larsson, C., S. Eriksson, and H. Dirksen. 1977. Smoking and intermediate alpha1-antitrypsin deficiency and lung function in middle-aged men. Br. Med. J 2: 922-925 .
25.
Hogg, J. C.,
J. L. Wright,
B. R. Wiggs,
H. O. Coxson,
A. Opazo,
Saez, and
P. D. Paré.
1994.
Lung structure and function in cigarette smokers.
Thorax
49:
473-478
26. Wright, J. L., B. Wiggs, P. D. Paré, and J. C. Hogg. 1986. Ranking the severity of emphysema on whole lung slices. Am. Rev. Respir. Dis. 133: 930-931 [Medline].
27. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
28. Cooper, C. S., and M. R. Stratton. 1991. Extraction and enzymatic amplification of DNA from paraffin-embedded specimens. In Methods in Molecular Biology, Vol. 9: Protocols in Human Molecular Genetics. C. Matthew, editor. The Humana Press, Inc., Clifton, NJ. 133-140.
29. Dry, P. J.. 1991. Rapid detection of alpha-1-antitrypsin deficiency by analysis of a PCR-induced TaqI restriction site. Hum. Genet. 87: 742-744 [Medline].
30. Bruun-Petersen, K., G. Bruun-Petersen, R. Dahl, B. Larsen, S. Kølvraa, J. Koch, L. Bolund, and N. Gregersen. 1992. Alpha1-antitrypsin alleles in patients with pulmonary emphysema, detected by DNA amplification (PCR) and oligonucleotide probes. Eur. Respir. J. 5: 531-537 [Abstract].
31. Klayton, R., R. Fallat, and A. B. Cohen. 1975. Determinants of chronic obstructive pulmonary disease in patients with intermediate levels of alpha1-antitrypsin. Am. Rev. Respir. Dis. 112: 71-75 [Medline].
32.
Tattersall, S. F.,
R. P. Pereira,
D. Hunter,
G. Blundell, and
N. B. Pride.
1979.
Lung distensibility and airway function in intermediate alpha1-antitrypsin deficiency.
Thorax
34:
637-646
33. Cooper, D. M., V. Hoeppner, D. Cox, N. Zamel, A. C. Bryan, and H. Levison. 1974. Lung function in alpha1-antitrypsin heterozygotes (Pi type MZ). Am. Rev. Respir. Dis. 110: 708-715 [Medline].
34. Hall, W. J., R. W. Hyde, R. H. Schwartz, S. Govind, G. S. Mudholkar, D. R. Webb, Y. P. Chaubey, and P. L. Townes. 1976. Pulmonary abnormalities in intermediate alpha-1-antitrypsin deficiency. J. Clin. Invest. 58: 1069-1077 .
35. Madison, R., R. Zelman, and C. Mittman. 1980. Inherited risk factors for chronic lung disease. Chest 77(Suppl. 2):255-257.
36.
Rodriguez-Cintron, W.,
K. Guntupalli, and
A. E. Fraire.
1996.
Bronchiectasis and homozygous (PI ZZ) alpha 1-antitrypsin deficiency in a young
man.
Thorax
50:
424-425
This article has been cited by other articles:
![]() |
S J Marciniak and D A Lomas What can naturally occurring mutations tell us about the pathogenesis of COPD? Thorax, April 1, 2009; 64(4): 359 - 364. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Schwartz and J. C. Ruckdeschel Familial Lung Cancer: Genetic Susceptibility and Relationship to Chronic Obstructive Pulmonary Disease Am. J. Respir. Crit. Care Med., January 1, 2006; 173(1): 16 - 22. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dahl, C. P. Hersh, N. P. Ly, C. S. Berkey, E. K. Silverman, and B. G. Nordestgaard The protease inhibitor PI*S allele and COPD: a meta-analysis Eur. Respir. J., July 1, 2005; 26(1): 67 - 76. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. J. Wadsworth, L. E. Vinall, A. L. Jones, R. J. Hardy, D. B. Whitehouse, S. L. Butterworth, W. S. Hilder, J. U. Lovegrove, and D. M. Swallow Alpha1-Antitrypsin as a Risk for Infant and Adult Respiratory Outcomes in a National Birth Cohort Am. J. Respir. Cell Mol. Biol., November 1, 2004; 31(5): 559 - 564. [Abstract] [Full Text] [PDF] |
||||
![]() |
C P Hersh, M Dahl, N P Ly, C S Berkey, B G Nordestgaard, and E K Silverman Chronic obstructive pulmonary disease in {alpha}1-antitrypsin PI MZ heterozygotes: a meta-analysis Thorax, October 1, 2004; 59(10): 843 - 849. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Molfino Genetics of COPD Chest, May 1, 2004; 125(5): 1929 - 1940. [Abstract] [Full Text] [PDF] |
||||
![]() |
American Thoracic Society/European Respiratory Society Statement: Standards for the Diagnosis and Management of Individuals with Alpha-1 Antitrypsin Deficiency Am. J. Respir. Crit. Care Med., October 1, 2003; 168(7): 818 - 900. [Full Text] [PDF] |
||||
![]() |
M. Wencker, A. Marx, N. Konietzko, B. Schaefer, and E.J. Campbell Screening for {alpha}1-Pi deficiency in patients with lung diseases Eur. Respir. J., August 1, 2002; 20(2): 319 - 324. [Abstract] [Full Text] [PDF] |
||||
![]() |
O.S. von Ehrenstein, E. von Mutius, E. Maier, T. Hirsch, D. Carr, W. Schaal, A.A. Roscher, B. Olgemoller, T. Nicolai, and S.K. Weiland Lung function of school children with low levels of {alpha}1-antitrypsin and tobacco smoke exposure Eur. Respir. J., June 1, 2002; 19(6): 1099 - 1106. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Guo, H-M. Lin, Z. Lin, M. Montano, R. Sansores, G. Wang, S. DiAngelo, A. Pardo, M. Selman, and J. Floros Surfactant protein gene A, B, and D marker alleles in chronic obstructive pulmonary disease of a Mexican population Eur. Respir. J., September 1, 2001; 18(3): 482 - 490. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. CAVARRA, B. BARTALESI, M. LUCATTELLI, S. FINESCHI, B. LUNGHI, F. GAMBELLI, L. A. ORTIZ, P. A. MARTORANA, and G. LUNGARELLA Effects of Cigarette Smoke in Mice with Different Levels of alpha 1-Proteinase Inhibitor and Sensitivity to Oxidants Am. J. Respir. Crit. Care Med., September 1, 2001; 164(5): 886 - 890. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Dhami, B. Gilks, C. Xie, K. Zay, J. L. Wright, and A. Churg Acute Cigarette Smoke-Induced Connective Tissue Breakdown Is Mediated by Neutrophils and Prevented by alpha 1-Antitrypsin Am. J. Respir. Cell Mol. Biol., February 1, 2000; 22(2): 244 - 252. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Crit. Care Med. |