Introduction

Abstract Introduction References

Subclass C, serotypes 2 and 5 adenovirus (Ad) gene transfer vectors are remarkably efficient in transferring genes to target cells. Ad-mediated gene transduction involves trafficking of the Ad from the cell surface to the nucleus, and transfer of the recombinant Ad genome into the nucleus, where it functions in an epichromosomal position to express the desired exogenous gene (1). The efficiency of Ad-mediated gene transfer results, in part, from the initial binding of the Ad to a high-affinity receptor on the cell surface, an interaction mediated by elongated fibers projecting from the Ad capsid (3). Recent studies by Bergelson and colleagues (6) and Tomko and associates (7) have shown that a single-chain, 46-kD cell-surface protein functions as a high-affinity fiber receptor for Ad2 and Ad5 and for coxsackie B viruses as well. Consistent with this concept, cell lines deficient in coxsackie/adenovirus receptor (CAR) are poor targets for Ad-mediated gene transfer, but the efficiency of gene transfer improves significantly when the cell lines have been genetically modified to express the CAR protein (6, 7).

If efficient gene transfer by subclass C Ad vectors to transfer genes requires the target cell to express a high- affinity receptor such as CAR, then it follows that cells that have a deficiency in CAR will require a higher multiplicity of infection (moi) to be genetically modified with Ad vectors, and that upregulation of CAR expression will be associated with a reduction in the dose of Ad vectors required for gene delivery to target cells. This issue is critically important for using Ad vectors in humans, because the correction of a CAR deficiency should permit a reduction in the dose required to achieve the desired expression, with a concomitant reduction in Ad-induced inflammation associated with vector administration.

In the context of these considerations, the present study is directed toward evaluating Ad vector-mediated gene transfer and expression in alveolar macrophages (AMs), the pulmonary representatives of the mononuclear phagocyte system (8, 9). We chose the AM for this study as a representative human cell that might be CAR-deficient on the basis of the knowledge that human blood monocytes/macrophages are very difficult targets for Ad vector-mediated gene transfer (10). Furthermore, AMs can be evaluated fresh and proliferate at very low rates, thus obviating the possibility of modification of receptor expression in association with proliferation in cell culture (16). The data demonstrate that human AMs: (1) are CAR-deficient; (2) can be genetically modified by Ad vectors, but only at a high moi; and (3) can be genetically modified to express CAR, with a concomitant increase in Ad-mediated gene transfer.

	Materials and Methods

Cells

Human AMs were obtained by bronchoalveolar lavage (BAL) from normal volunteers as previously described (19). For analysis of interferon- (IFN-) production in vitro, cells were obtained from an HIV+ patient undergoing bronchoscopy for clinical indications. For most experiments, AMs were purified by adherence to plastic (1 h, 37°C). For flow cytometry studies, the cells were placed in Teflon-coated culture vials (Savillex Corp, Minnetonka, MN) until evaluation. The A549 human alveolar carcinoma cell line (CCL-185; American Type Culture Collection, Rockville, MD) was maintained in Dulbecco's modified Eagle's medium (DMEM; GIBCO BRL, Grand Island, NY) supplemented with 10% fetal calf serum (FCS).

Ad Vectors

All Ad vectors were E1a, partial E1b, partial E3 based on the Ad5 backbone, containing a transgene (Ad -galactosidase [Adgal], AdIFN, Ad green fluorescent protein [AdGFP], AdCAR) or no transgene (AdNull) under control of the cytomegalovirus immediate-early promoter/enhancer in the E1a position (20, 21). Adgal expresses the Escherichia coli -gal gene, AdIFN expresses the human IFN- complementary DNA (cDNA) (22), AdGFP (23, 24) expresses the jellyfish GFP, and AdCAR expresses the human CAR cDNA (6, 25).

Expression of CAR Messenger RNA (mRNA) by AMs

To assess the expression of CAR in AMs at the mRNA level, two methods were used: reverse transcription-polymerase chain reaction (RT-PCR) and Northern analysis. For RT-PCR, total RNA was extracted (Clontech, Palo Alto, CA) from AMs and A549 cells, and was reverse-transcribed with avian myeloblastosis virus reverse transcriptase (Promega, Madison, WI) (45 min, 68°C; 2 min, 94°C). The resulting DNA was amplified by 35 cycles of PCR (9600 Gene Amp; Perkin Elmer, Norwalk, CT): 94°C for 30 s, 52°C for 1 min, 48°C for 2 min, using synthetic 24-mer oligonucleotide primers, beginning at position 419 at the 5' end (AGCCTTCAGGTGCGAGATGTTACG) and 761 at the 3' end (TACGACAGCAAAAGATGATAAGAC) of the human CAR cDNA (6). The PCR products were resolved on a 1.5% agarose gel, with the expected size of 366 base pairs for the resulting PCR product. DNA contamination was ruled out by pretreatment of the samples with ribonuclease (RNase). For Northern analysis, total cellular RNA (10 µg/lane) was transferred to nylon membranes after electrophoretic separation through a 1.0% agarose gel. Both human CAR cDNA (6) and the control human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA (26) were gel-purified and labeled with ³²P-deoxycytidine triphosphate using a random-primer labeling kit (Stratagene, La Jolla, CA). Hybridizations were performed in QUICKHYB (Stratagene) for 2 h at 65°C using standard methods.

Expression of CAR Protein by AMs

Immunofluorescence microscopy was carried out as previously described (27), with a CAR-specific monoclonal antibody to evaluate AMs and A549 cells for surface expression of CAR (RmcB [6, 28]). Primary antibodies included RmcB (mouse anti-CAR ascites fluid, immunoglobulin G₁ [IgG₁], 1:1,000 dilution [28]) and isotype-matched control (anti-Factor VIII mouse IgG₁, 1:500 dilution [Dakopatts, Glastrup, Denmark]).

To assess AMs for expression of CAR by flow cytometry, cells recovered by lavage were maintained in suspension in RPMI-1640 media containing 10% FCS 2 mM glutamine, 100 U/ml penicillin, and 10 µg/ml streptomycin in Teflon chambers, and A549 cells were cultured in 12-well plates and scraped with a rubber cell scraper. The cells were incubated with phosphate-buffered saline (PBS) containing 2% goat serum and 2% human serum on ice followed by the anti-CAR antibody for 30 min on ice. The cells were then washed and incubated with fluorescein isothiocyanate-conjugated goat antimouse IgG [F(ab)₂] fragments (Boehringer Mannheim, Indianapolis, IN) for 30 min, washed in PBS, and analyzed by flow cytometry. An isotype-matched control antibody (antikinesin, clone H3 ascites fluid, 1:1,000 dilution; gift of Scott T. Brady, University of Texas Southwestern Medical Center, Dallas, TX [29]) was used as a negative control.

Gene Transfer and Expression in Freshly Isolated AMs

To evaluate Ad vector-mediated gene expression in AM, freshly isolated AMs were plated in 48-well plates (10⁵ cells/well) in RPMI 1640 media containing 10% FCS, 2 mM glutamine, 100 U/ml penicillin, and 10 µg/ml streptomycin. Assessment in A549 cells was carried out in DMEM with 2 mM glutamine, 100 U/ml penicillin, and 10 µg/ml streptomycin supplemented with 10% FCS. After 5 h adherence, the cells were infected with Adgal at various moi for 60 min at 37°C. After washing, the cells were cultured for an additional 40 h. Cells were washed and lysed, and -gal expression in the cell lysate was quantified by chemiluminescence assay (Galactolyte kit; Tropix, Bedford, MA) and expressed as relative light units per cell.

As another approach to evaluating transgene expression in AM, freshly isolated AMs were infected with AdGFP, an Ad expressing the jellyfish GFP, capitalizing on the ability to evaluate expression of the GFP transgene by both immunofluorescence microscopy and flow cytometry. To accomplish this, cells recovered from BAL were maintained in suspension in Teflon chambers or plated on coverslip dishes coated with poly-D-lysine, infected with AdGFP for 90 min at 500 moi, and then incubated for 48 h. A549 cells, exposed to 20 moi AdGFP for 90 min, were used as a control. The plated cells were evaluated for GFP expression with fluorescence microscopy. To measure the major histocompatibility complex (MHC) class II expression, the cells in suspension were incubated with 2% human serum in PBS for 10 min on ice followed by phycoerythrin (PE)-labeled DR antibody at 1:100 dilution (Pharmingen, San Diego, CA) on ice for 30 min. Isotype-matched PE- labeled antibody directed against the hapten trinitrophenol (Pharmingen) 1:100 dilution served as a control. Cells were then analyzed by flow cytometry.

Finally, to demonstrate that an Ad vector could be used to genetically modify freshly isolated human AM to secrete a protein relevant to AM, AMs freshly isolated from an HIV-1+ individual were incubated in 24 dishes with AdIFN (moi 200) for 60 min and washed, and the incubation was continued for 16 d. At intervals, the media were sampled for human IFN- quantified by enzyme-linked immunoassay (ELISA; R&D Systems, Minneapolis, MN).

Ad Vector Use of CAR to Enter AMs

To demonstrate that Ad vectors utilize the high-affinity CAR receptor to transfer and express genes in AM, two approaches were used: (1) demonstration that purified soluble Ad5 fiber will block, in a dose-dependent fashion, the expression of -gal when AMs were exposed to Adgal; and (2) demonstration that upregulation of CAR on the AM surface (by prior infection of the AMs with high concentrations of AdCAR) resulted in upregulation of the ability of low levels of Adgal to transfer and express -gal in AMs.

To show that soluble Ad5 fiber will block expression of gal mediated by Adgal, cells were pretreated with varying concentrations of purified recombinant soluble fiber protein for 30 min at 37°C. Adgal (moi 100) was added without removing the soluble Ad5 fiber. Recombinant soluble Ad5 fiber protein was a gift of Thomas Wickham (GenVec, Rockville, MD). After 1 h, the remaining virus and fiber were washed off and the cells were cultured for an additional 72 h. Transgene expression was quantified by chemiluminescence assay (Galactolyte) and expressed as relative light units per cell.

To demonstrate that AdCAR can increase levels of CAR on the AM, fresh AMs were plated on coverslips coated with poly-D-lysine. AMs were left uninfected or infected with AdCAR (moi 200) for 90 min at 37°C. After an additional 72 h of culture, cells were fixed with 2% paraformaldehyde in PBS. Immunofluorescence microscopy with the Rcmb mouse anti-CAR ascites fluid was performed as described above.

To demonstrate that increased CAR expression by AM results in increased susceptibility to Ad-mediated gene transfer, AMs (10⁵ cells/well) were plated in 48-well plates. The cells were infected with AdCAR (moi 200) or AdNull (moi 200) for 90 min at 37°C or were uninfected. Excess virus was removed by washing and the AMs were cultured for 72 h. All cells were then exposed to Adgal (moi 20) for 90 min at 37°C. After an additional 72 h of culture, transgene expression was quantified by chemiluminescence assay.

Statistical Analysis

Except for the curve fitting (see below), all data are presented as means ± standard error, and comparisons are made using the unweighted means analysis of variance (ANOVA) with Duncan's post hoc test computed with the Number Cruncher Statistical System software program (NCSS, Kaysville, UT). Best-fit lines were computed with the FigP for Windows software package (Biosoft, Cambridge, UK) for the -gal dose response using a statistical sigmoid model equation.

	Results

AM CAR Expression

To test the hypothesis that AMs express CAR but at low levels, AMs were evaluated for CAR mRNA and protein expression. CAR mRNA was detectable by RT-PCR in AM and in the positive control A549 lung epithelial cell line (not shown). The AM band was much less intense than the A549, despite starting from equal amounts of RNA. False-positive expression by contaminating DNA was ruled out by pretreating the samples with RNase, which abolished the signal (not shown).

Northern analysis of total RNA from AM showed detectable levels of expression of CAR mRNA; multiple bands were seen, as have previously been observed (7, 30) (Figure 1). Expression of CAR mRNA was lower in AM than in A549 cells; in addition, relatively less of the 6.0-kb transcript and more of the 2.3-kb transcript was seen in AM cells. Comparing CAR mRNA from A549 with AM, the relative intensities of the 6.0-, 5.1-, and 2.3-kb bands after normalization to GAPDH were 5.9, 2.1, and 1.3, respectively, as quantified by densitometry.

View larger version (38K): [in this window] [in a new window]   Figure 1.   Expression of CAR mRNA by AMs. Northern analysis of CAR mRNA expression. Total RNA (10 µg/ lane) from A549 and AMs was hybridized with a 32P-labeled human CAR cDNA probe. Top, lanes 1 and 2: three CAR mRNA bands (6.0, 5.1, and 2.3 kb) were detected in each sample, with the 6.0-kb band dominating in A459 (lane 1) and the 5.1-kb band dominating in AM (lane 2). Below: control hybridization with a 32P-labeled GAPDH probe.

Using fluorescence microscopy, cell-surface CAR was easily detected in A549 cells in a pattern of cell-surface punctae (Figure 2). Whereas AMs exhibited significant autofluorescence, a CAR+ peripheral staining pattern was observed. Specific CAR staining was differentiated from autofluorescence by combining images from the red channel (specific signal and autofluorescence) and the green channel (autofluorescence). In the resulting image, autofluorescence appeared yellow (red and green), whereas specific CAR staining remained red. Specificity of the CAR+ staining was demonstrated with an isotype-matched control antibody. Only a minority of cells exhibited positive immunofluorescence. Randomly selected fields yielded 30% CAR+ cells. Attempts to quantify the CAR+ staining using flow cytometry with the RcmB monoclonal antibody demonstrated that A549 cells were strongly positive for CAR, but labeling of AM could not be detected over the background fluorescence (not shown). For AM, the sensitivity of flow cytometry for detecting antigens expressed at low levels is known to be limited by autofluorescence where spatially restricted patterns cannot be resolved (31). In fluorescence microscopy, information about subcellular distribution aided in the analysis.

View larger version (37K): [in this window] [in a new window]   Figure 2.   Surface expression of CAR on AMs assessed by indirect immunofluorescence. Surface expression of CAR was detected on fixed, unpermeabilized A549 human lung epithelial cells and human AMs using RcmB, a mouse monoclonal antibody to CAR. (A) CAR distribution at the surface of A549 cells showed a red punctate pattern with uniform distribution. (B) A549 cells labeled with an isotype-matched control antibody did not yield surface staining. (C ) AMs demonstrate a positive red surface stain (arrows) of lower intensity than A549 cells. The red fluorescence represents CAR; the yellow fluorescent response is from autofluorescent intracellular organelles. (D) AMs stained with an isotype-matched control antibody exhibit only yellow autofluorescence (arrowheads). Bar: A and B, 20 µm; C and D, 10 µm.

Gene Transfer to AMs

To quantify the efficiency of transgene expression by AM, AMs and A549 cells were infected with Adgal, an Ad vector containing the E. coli -gal gene. After 40 h, expression of the functional intracellular transgene was determined by a quantitative chemiluminescence assay for activity of the enzyme -gal (Figure 3). Both AMs and A549 cells expressed the transgene in a dose-dependent fashion with the level of expression in AM 2 to 3 logs lower at each dose compared with A549 cells.

View larger version (14K): [in this window] [in a new window]   Figure 3.   Ad vector-mediated gene transfer and expression of the -gal gene to normal human AMs compared with A549 cells in vitro. -gal activity was quantified with a chemiluminescence assay 40 h after infection.

To confirm that human AM and not contaminating cells were expressing the transgene, AMs were infected with AdGFP, an Ad vector containing the jellyfish GFP cDNA. Fluorescence microscopy revealed that transgene was expressed both in control A549 cells (Figures 4A and 4B), and in AMs (Figures 4C and 4D). The overall expression in AMs was significantly less efficient, with higher moi necessary to achieve positive expression in the AMs. Flow cytometry confirmed that the GFP-expressing cells were AMs, because they also stained positively with human leukocyte-associated antigen-DR, an AM marker (Figures 4E and 4F).

View larger version (47K): [in this window] [in a new window]   View larger version (28K): [in this window] [in a new window]   Figure 4.   Ad vector-mediated transfer and expression of the GFP gene in human AMs compared with A549 cells. (A-D) Fluorescent microscopy evaluation. (E, F ) Flow cytometry evaluation. AMs or A549 cells were infected with the AdNull or AdGFP vectors on slides for fluorescence microscopy or in suspension for flow cytometry and evaluated after 48 h. Nuclear staining (DAPI) shown in left panel; transgene expression (GFP) shown in right panel. (A) A549 cells, AdNull, moi 10. (B) A549 cells, AdGFP, moi 10. (C ) AMs, AdNull, moi 100. (D) AMs, AdGFP, moi 100. For panels A-D, bar = 10 µm. (E) AMs, macrophages, AdNull, moi 500, dual label with ordinate log fluorescence PE-labeled anti-DR antibody, abscissa log fluorescence GFP. (F ) AMs, AdGFP, moi 500.

To determine whether AMs could express a secreted protein encoded by a transgene transferred by an Ad, cells from an HIV+ individual were infected in vitro with an Ad vector containing the human IFN- cDNA (AdIFN). Immunoreactive IFN- was secreted into the media, with significant synthesis of the protein detected for at least 16 d after infection (Figure 5).

View larger version (13K): [in this window] [in a new window]   Figure 5.   Ad vector-mediated gene transfer and expression of the human IFN- cDNA in human AMs. Human AMs were obtained from BAL of an HIV-1-seropositive individual undergoing bronchoscopy for suspected pulmonary infection. The cells were plated in 24-well plates at 105 cells/well. After 1 h, the nonadherent cells were removed and the cells infected (moi 200) with AdIFN or AdNull. The conditioned media were removed periodically and replaced with fresh media. Shown is the IFN- concentration measured by ELISA for triplicate parallel wells expressed as IFN- produced per 24 h.

Role of CAR in Ad Entry into AMs

Evaluation of the ability of soluble fiber protein to inhibit transgene expression by AMs demonstrated a dose-dependent inhibition, suggesting an important functional role for fiber in facilitating Ad gene transfer to AMs (Figure 6A). The overall pattern of inhibition was similar to that of fiber inhibition of the A549 control cells (Figure 6B). The difference between AMs and A549 expression in the absence of fiber was 20-fold in this experiment, in which measurements were made 72 h after infection, rather than at 40 h as in the experiment shown in Figure 3.

View larger version (12K): [in this window] [in a new window]   Figure 6.   Dose-dependent inhibition of Adgal-mediated expression of -gal in human AMs by the addition of soluble Ad5 fiber. Adherent human AMs and A549 cells were pretreated with increasing concentrations of purified recombinant soluble fiber protein (30 min, 37°C). Adgal was added (moi 100) without removing the soluble fiber. After 1 h, the media containing excess virus and fiber were removed and the cells were maintained in growth media for an additional 72 h. Transgene expression was quantified with a chemiluminescence assay. (A) AMs. (B) A549 cells.

To confirm that low levels of CAR expression by AMs are a limiting factor for Ad vector-mediated transgene expression, we tested the ability of AdCAR, an Ad vector encoding CAR, to enhance transgene expression in AMs. First, AdCAR infection increased the expression of CAR on the surface of AMs as assessed by immunofluorescence microscopy (Figure 7). Interestingly, there were variable degrees of enhanced CAR expression, with some cells exhibiting large amounts of CAR and some much less. The overall proportion of CAR+ cells was not increased, but 5% of cells displayed a much higher intensity of immunofluorescence staining for CAR, relative to uninfected cells. In a second experiment, AMs were infected with AdCAR, followed by infection 72 h later with Adgal, and after an additional 72 h -gal activity was quantified (Figure 8). Compared with untreated cells, AMs exposed to AdCAR showed a 5-fold increase in expression of the -gal transgene when subsequently challenged with -gal. In contrast, prior AdNull infection had no significant effect on subsequent transgene expression. The differences between groups were significant by ANOVA (F = 3.18, P < 0.0001). Post hoc testing ( = 0.05) showed a significant difference between AdCAR pretreatment and either AdNull or no previous pretreatment. These data are consistent with the hypothesis that low levels of CAR expression are a limiting factor for AM transgene expression.

View larger version (24K): [in this window] [in a new window]   Figure 7.   Increased surface expression of CAR on AMs following infection by AdCAR. Surface expression of CAR was detected by immunofluorescence using the RcmB anti-CAR antibody. (A) Untreated AMs. (B) AMs infected with AdCAR, moi 200, 72 h. Arrows indicate normal level of CAR immunofluorescence. Arrowheads indicate enhanced CAR immunofluorescence. Bar = 10 µm.

View larger version (16K): [in this window] [in a new window]   Figure 8.   Effect of prior AdCAR infection on Ad vector-mediated gene transfer to human AMs. Adherent human AMs were infected with AdCAR (moi 200) or AdNull (moi 200), or were uninfected. After 72 h, all cells were infected with Adgal (moi 20). After an additional 72 h, -gal activity was quantified with a chemiluminescence assay.

	Discussion

Expression of cell-surface viral receptors is an important determinant of viral tropism in vivo. Consistent with this concept, the present study demonstrates that expression of the high-affinity CAR limits the efficiency of Ad gene vectors to transfer and express genes in freshly isolated human AMs. In this regard, CAR mRNA levels in AM were detected by RT-PCR and by Northern analysis, but at lower levels than in the A549 lung epithelial cell line, cells known to be easy targets for Ad vector gene transfer and expression. AMs exhibited variable, but low, surface expression of CAR protein as measured by indirect immunofluorescence microscopy with a CAR-specific antibody. Consistent with these observations, quantitation of Ad-mediated gene expression of -gal by AMs was 100- to 1,000-fold less efficient than A549 cells. At a relatively high moi, AM expression of the jellyfish GFP was observed by fluorescence microscopy, and flow cytometry showed 50% of the AMs expressed the GFP transgene. At a high moi, AMs from an HIV+ individual (an IFN--deficient condition) could also be genetically modified by an Ad vector to secrete the cytokine IFN- for 16 d. Despite the inefficiency of Ad transgene expression, soluble Ad5 fiber blocked expression of Adgal, implying a key role for fiber receptor in the Ad entry pathway into AMs. Finally, infection of AMs with an Ad expressing the human CAR cDNA led to enhanced surface expression of CAR, as shown by indirect immunofluorescence microscopy. When the AMs with increased CAR expression were then infected with a second Ad vector containing a marker gene, subsequent expression was increased 5-fold, indicating that CAR deficiency is indeed a barrier to efficient Ad-mediated gene transfer by AM.

Inefficiency of AM Gene Transduction

Transduction with AdCAR, however, did not increase the sensitivity of AMs to Ad-mediated gene transfer to levels characteristic of fully permissive cells, such as A549. AMs are terminally differentiated cells that derive from circulating blood monocytes and, to a small extent, from local replication in the lung (8, 9, 16). Previous studies have demonstrated that blood monocytes, and monocytes differentiated into macrophages in vitro, express adenoviral transgenes inefficiently (10, 14, 15, 32). It is likely, therefore, that this cell lineage is generally resistant to genetic modification by Ad vectors. There are several mechanisms that may account for this.

First, Ad vectors may be degraded by AMs. Monocytes and macrophages are phagocytic cells, with high capacities to ingest and degrade infectious organisms (8, 9, 33). Regarding Ad vectors, tissue macrophages in the liver are capable of intracellular degradation of Ad vectors, accounting for a large reduction in adenoviral DNA over the first 24 h after Ad vector administration, prior to the onset of action of acquired immune mechanisms (34, 35). Recent data from our laboratory demonstrated that mouse AMs are able to degrade Ad vectors intracellularly, resulting in a significant decrease in vector DNA over the first 24 h following Ad infection (36).

A second, not mutually exclusive hypothesis is that entry of Ad vectors into AMs is less efficient than in fully permissive cells. Monocyte-derived macrophages express Ad transgenes inefficiently, at least in part due to a deficiency in the ability of these cells to bind Ad (11, 32). The attachment that does occur is not blocked by soluble fiber proteins (11). In cells fully permissive for infection by Ad, the capsid fiber protein attaches to a cell-surface receptor. Two fiber receptors have been identified: CAR (6, 7) and the ₂ domain of MHC class I (37). MHC class I is highly expressed by the majority of AMs (31, 38). Once attachment has occurred, binding of the penton base via an RGD sequence to _V integrins facilitates internalization of the capsid (39, 40). Ad entry into monocyte-derived macrophages, which lack receptors blocked by soluble fiber (and are thus likely to be deficient in CAR), is facilitated by the integrin receptor _M2 (11). It is conceivable, although not tested, that entry of Ad into AM by a non-CAR pathway could lead to Ad degradation rather than transgene expression.

Consistent with the observations that CAR, which functions by promoting fiber-mediated Ad attachment to cells, is expressed at a low level on freshly isolated human AMs, and that Ad vector-mediated gene expression can be achieved in these cells (albeit requiring a high moi), our data demonstrate that fiber protein plays a role in Ad entry and transgene expression by AMs, on the basis of inhibition of transgene expression by soluble fiber protein. This contrasts with results from monocyte-derived macrophages and the monocytic cell line THP-1 (11), where soluble fiber does not block transgene expression. These differences may reflect the status of AMs as terminally differentiated tissue macrophages whose repertoire of expression of many cell-surface markers differs from less differentiated precursor blood monocytes (8, 9, 31). Interestingly, at high moi, human bone marrow macrophage precursors can be transduced by Ad vectors to express reporter genes (24).

Definitive determination of whether low-level CAR expression can fully account for all of the fiber-mediated transgene expression in AMs will await development of new competitive antagonists, such as blocking antibodies or recombinant soluble extracellular domains of CAR. The possibility remains open that there is a role for other fiber receptors on the AM surface, such as the MHC class I ₂ domain (37). These findings also do not exclude the possibility of significant subsequent interactions with integrins or other cell-surface receptors. However, consistent with the hypothesis that the low level of fiber receptors contributes to the inefficiency of gene transfer to AMs, increasing cell surface CAR expression by prior treatment of AMs with AdCAR, but not AdNull, enhanced subsequent expression of the marker gene -gal. This result strongly supports the hypothesis that low levels of CAR are one of the factors limiting transgene expression by human AMs in response to Ad-based vectors.

Significance of Ad Vector-Mediated Genetic Modification of AM Gene Transfer

The ability to target AMs specifically for Ad transgene expression suggests the potential for an ex vivo gene therapy approach whereby transduced AMs could be reintroduced into the lung via the tracheobronchial tree (41). A potential advantage of this approach might be a reduction in inflammation directed against adenoviral antigens, which can occur when vectors are introduced intratracheally and expression is largely in the airway epithelium (44- 48). AMs are relatively inefficient as antigen-presenting cells (9, 49, 50), so the resulting vector-induced inflammation might be less for an equivalent level of transgene expression. Furthermore, because cytotoxic T lymphocytes directed against Ad antigens hasten the elimination of transduced parenchymal cells in vivo (45, 47, 48, 51), we speculate that the expression of transgenes by AMs may be prolonged relative to epithelial cell expression. Moreover, the ability to modify Ad vectors genetically may permit the design of future generation vectors with increased macrophage tropism, which, for secreted therapeutic proteins, might improve the delicate balance between increased transgene expression and cellular immune responses to vector antigens.