help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Perez, R. L.
Right arrow Articles by Roman, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perez, R. L.
Right arrow Articles by Roman, J.
Am. J. Respir. Cell Mol. Biol., Volume 20, Number 5, May 1999 1059-1066

Transcriptional Regulation of the Interleukin-1beta Promoter via Fibrinogen Engagement of the CD18 Integrin Receptor

Rafael L. Perez, Jeffrey D. Ritzenthaler, and Jesse Roman

Pulmonary and Critical Care Division, Department of Medicine, Atlanta Veterans Affairs Medical Center, Emory University School of Medicine, Atlanta, Georgia


    Abstract
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Fibrinogen, with or without its conversion to fibrin, in the extravascular spaces of injured and inflamed lung tissues is thought to promote inflammatory responses that can eventually lead to pulmonary fibrosis. One of these responses likely involves the elaboration of the proinflammatory cytokine interleukin (IL)- 1beta . We reported that both fibrinogen and fibrin stimulated production of IL-1beta message and protein by binding to CD18 integrin receptors on normal human monocytes (J. Immunol., 1995;154:1879-1887). The purpose of the current work was to extend our previous observations by characterizing the transcriptional regulation of fibrinogen-induced IL-1beta expression. Our model was the human monocytic cell line U937 transfected with the human IL-1beta promoter connected to reporter genes. We found that fibrinogen induced the IL-1beta promoter and that induction could be blocked by anti-CD18 antibody. Transfection with deletion constructs of the promoter and DNA electrophoresis mobility gel shift assays suggested that sequences containing activator protein (AP)-1, cyclic adenosine monophosphate response element (CRE), and nuclear factor (NF)-kappa B cis-acting motifs regulate IL-1beta gene expression by fibrinogen. In combination with competitive cotransfection studies using consensus oligonucleotides mimicking these motifs, we conclude that transactivation of an NF-kappa B-like sequence is necessary for induction of the IL-1beta gene, that activation of CRE may repress induction of the gene, and that AP-1 potentially modulates induction and repression of the gene induced by fibrinogen. This study begins to define the molecular mechanisms by which fibrin(ogen) promotes and regulates expression of the IL-1beta gene and further substantiates a role for fibrin(ogen) in tissue injury and inflammation.


    Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Leakage of fibrinogen and fibrin formation is seen in lungs of patients with acute and chronic forms of lung injury (1- 4). Studies investigating the role of this molecule in lung injury have focused on the mechanisms of fibrin formation and clearance in the lung that favor fibrin deposition (4- 6), but little is known about the effects of fibrin(ogen) on the inflammatory response. There is evidence suggesting that fibrin, as a major component of a "provisional matrix" for the adhesion and migration of macrophages, fibroblasts, and epithelial cells (7, 8), also activates inflammatory cells to produce mediators that may ultimately lead to fibrosis (9). Fibrosis can be especially catastrophic in the lung, where the integrity of gas exchange tissues is paramount. In a previous study, we observed that fibrin(ogen) was codistributed with the proinflammatory cytokine interleukin (IL)-1beta in the lung granulomas of patients with pulmonary sarcoidosis, and hypothesized that fibrin could stimulate cells to express this granulomagenic cytokine (13). This hypothesis was supported by experiments showing that fibrin and its precursor fibrinogen stimulated expression of both IL-1beta messenger RNA (mRNA) and protein in normal human monocytes in vitro, and that induction occurred, in part, via binding to the CD11b/CD18 integrin receptor. Studies to date, then, suggest that the injured lung allows fibrinogen leakage into lung interstitium and alveoli with formation of fibrin. Fibrin(ogen), in turn, may play a multifunctional role in inflammation by providing an extracellular matrix support for the accumulation of inflammatory cells and by modifying cellular responses such as cytokine expression.

The purpose of this work was to characterize the transcriptional regulation of fibrinogen-induced IL-1beta expression using the human monocytic cell line U937 transfected with constructs of the IL-1beta promoter. The results indicate that fibrinogen, by binding the CD18 (beta 2) integrin receptor, regulates IL-1beta gene expression via promoter regions containing specific response elements known to regulate IL-1beta gene expression. This work begins to delineate the intracellular mechanisms responsible for modulation of cytokine expression by fibrinogen and fibrin matrices.

    Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cell Culture and Treatment

Human histiocytic lymphoma U937 cells (American Type Culture Collection CRL no. 1593.2, Rockville, MD), were maintained in RPMI-1640 supplemented with 10% heat-inactivated fetal bovine serum (FBS; Atlanta Biologicals, Norcross, GA), 1% antibiotic-antimycotic (100 U/ml penicillin G sodium, 100 U/ml streptomycin sulfate, and 0.25 µg/ml amphotericin B), and incubated at 37°C in a humidified 5% CO2 incubator.

Fibrinogen (American Diagnostica, Greenwich, CT) was used at a concentration of 500 µg/ml to stimulate induction of the IL-1beta promoter. The dose of fibrinogen chosen for this work was determined on the basis of preliminary dose-response studies showing that 500 µg/ml of fibrinogen was the maximal stimulatory concentration. The dose-response studies were performed without costimulants, such as adenosine diphosphate (ADP) or ionomycin, which have been shown to increase the ligand-binding affinity of CD11b/CD18 receptors (14). Experimental manipulations included anti-CD18 monoclonal antibody (mAb) (MAB1962; Chemicon, Temecula, CA), nonimmune murine immunoglobulin (Ig)G (Ab5, 12.5 µg/ml; Sigma, St. Louis, MO), consensus double-stranded activator protein (AP)-1 oligonucleotide (20 µg/ml), consensus double-stranded nuclear factor (NF)-kappa B oligonucleotide, and consensus double-stranded cyclic adenosine monophosphate (cAMP) response element (CRE) oligonucleotide (20 µg/ ml). Oligonucleotides were synthesized by Oligos Etc. (Guilford, CT).

Screening for Lipopolysaccharide Contamination

Strict measures were taken to avoid lipopolysaccharide (LPS) contamination of the culture system. Lyophilized fibrinogen from the manufacturer was reconstituted in endotoxin-free water (Sigma) and rotated at 4°C in B-52 END-X endotoxin removal devices (Associates of Cape Cod, Inc., Woods Hole, MA) for 4 h. The anti-CD18 antibody and nonimmune IgG were treated similarly using the smaller B-15 endotoxin removal devices from the same manufacturer. The reagents were tested for endotoxin using a timed gel Limulus amebocyte lysate (LAL) assay (Sigma) that has a lower limit of detection of 3.9 pg endotoxin/ml. The treated fibrinogen and antibodies did not clot the LAL protein, even below the lower detection limit, and were deemed to be endotoxin-free. The fibrinogen was lyophilized and stored under sterile conditions at -70°C until used. Fibrinogen was reconstituted in endotoxin-free RPMI 1640 at 2 mg/ml immediately before use. The antibodies were aliquoted in sterile cryotubes and stored at -70°C until used.

Transient Transfections and Chloramphenicol Acetyl Transferase Assay

Lipofectin reagent (Life Technologies, Gaithersburg, MD) was used for transfection of U937 cells with all IL-1beta chloramphenicol acetyl transferase (CAT) promoter deletion constructs. Briefly, U937 cells were plated at 2 × 106 cells/ml in 100-mm tissue culture dishes 24 h before transfection. Immediately before transfection, cells were washed with 14 ml of Cellgro complete serum-free medium, followed by the addition of 10 µg of IL-1beta CAT promoter construct, or 10 µg of cytomegalovirus-CAT construct (pJM750-CAT; Merck, Sharp & Dohme, West Point, PA), 5 µg of beta -galactosidase (beta gal) plasmid DNA (Promega, Madison, WI), and 50 µg of lipofectin, and incubated for 16 h at 37°C and 5% CO2. IL-1beta CAT promoter deletion constructs were previously described by Gray and colleagues (15). Constructs included the full-length 4.0-kb IL-1beta promoter-CAT construct, pIL1 (4.0-kb) CAT, pIL1 (2.98-kb) CAT, and pIL1 (2.8-kb) CAT. Transfectants were stimulated with 500 µg/ml fibrinogen for 16 h; the incubation period was determined by time-course experiments showing maximal expression at 16 h. The stimulated cells were washed twice with 15 ml of calcium- and magnesium-free phosphate-buffered saline (PBS), resuspended in 300 µl of reporter lysis buffer (Promega), and incubated at room temperature for 15 min. The cell extracts were then tested for CAT and beta gal activity.

CAT activity was measured according to Gorman and associates (16). First, the samples were normalized to total protein measured by the Bradford method using Coomassie blue G-250 (Bio-Rad, Hercules, CA) (17). Radiolabeled chloramphenicol (0.25 mCi of D-threo-[dichloroacetyl-1-14C] chloramphenicol) and acetyl coenzyme A (4 mM) were added to samples containing 100 µg total protein or standard CAT enzyme in 150 µl of 0.25 M Tris-HCl, pH 7.8. Samples were incubated at 37°C for 4 h, ethyl acetate was extracted, and samples were separated by thin layer chromatography for 1.5 h in a 95:5 ratio of chloroform to methanol. Radioactive acetylated and nonacetylated products were quantified by PhosphorImager (Molecular Dynamics, Sunnyvale, CA).

Transfection efficiency was determined by cotransfection with beta gal plasmid DNA. Cell extract (150 µl) or diluted beta gal enzyme was added to an equal volume of 2× assay buffer (120 mM Na2HPO4, 80 mM NaH2PO4, 2 mM MgCl2, 100 mM beta -mercaptoethanol, and 1.33 mg/ml O-nitrophenyl-beta -D-galactopyranoside), mixed, and incubated at 37°C for 3 h. The reaction was terminated with 500 µl 1 M NaCO3, and the optical density was analyzed by spectrophotometry at a wavelength of 420 nm.

Transient Transfections and Luciferase Assay

Studies of the neutralizing effects of the anti-CD18 antibody and cotransfection experiments with consensus oligonucleotides were performed with IL-1beta promoter constructs attached to the luciferase (LUC) gene. Compared with the CAT gene constructs, the LUC gene constructs were more rapidly and reproducibly inducible and did not involve the use of radioactivity. Thus, the bulk of the experiments reported were performed using the LUC constructs.

Transfection of U937 cells with IL-1beta LUC promoter deletion constructs was performed by electroporation. LUC constructs, pIL1 (4.0-kb) LUC and pIL1 (3.1-kb) LUC, were made by restriction digest of the full-length IL-1beta promoter with either XbaI or PvuII, respectively, and ligated into the LUC reporter vector pGL3 (Promega). Briefly, cells were washed twice with 30 ml PBS and added to Cellgro complete serum-free medium (MediaTech, Herndon, VA) supplemented with 10 mM dextrose and 0.1 mM dithiothreitol (DTT) to a final concentration of 6 × 107 cells/ml. U937 cells (4.8 × 107) were added to electroporation cuvettes (0.4-cm electrode gap) along with 40 µg pIL1 (4.0-kb) LUC or pIL1 (3.1-kb) LUC plasmid DNA, 20 µg beta gal plasmid DNA, and, in cotransfection studies, 20 µg of consensus double-stranded phosphorothioate oligonucleotides, and subjected to 400 V and 1075 µF (Gene Pulser II electroporation system; Bio-Rad). Electroporated cells were pooled, aliquoted into 24-well plates, and incubated with or without fibrinogen (500 µg/ ml) for 6 h at 37°C and 5% CO2. The incubation period was determined by time-course experiments showing maximal expression at 6 h for the promoter-LUC constructs.

For the antibody neutralization studies, cells were preincubated for 1 h at 37°C and 5% CO2 with the anti-CD18 murine mAb MAB1962 or the nonimmune control murine IgG Ab5. MAB1962, provided as lyophilized ascites, was reconstituted per the manufacturer's instructions (100 µl PBS) and used at a final dilution of 1:200 in culture. The control IgG Ab5 was used at a final concentration of 12.5 µg/ml.

After incubation with the various treatments, cells were harvested, washed with PBS, and resuspended in 100 µl cell lysis buffer (25 mM Tris-phosphate, pH 7.8; 2 mM DTT; 2 mM 1,2-diaminocyclohexane-N,N,N',N'-tetraacetic acid; 10% glycerol; and 1% Triton X-100), and a 20-µl aliquot was tested for LUC activity by adding 50 µl Luciferase Assay Reagent (20 mM tricine, 1.07 mM [MgCO3]4-Mg[OH]2-5 H2O, 2.67 mM MgSO4, 0.1 mM ethylenediaminetetraacetic acid [EDTA], 33.3 mM DTT, 270 µM coenzyme A, 470 µM luciferin, and 530 µM adenosine triphosphate [ATP]). Light intensity was measured using a Dynatech ML 3000 microtiter plate luminometer (Chantilly, VA). Results were recorded as relative LUC units and standardized for transfection efficiency using beta gal activity.

Cotransfection studies using complementary consensus oligonucleotides for AP-1, CRE, or NF-kappa B with pIL1 (4.0-kb) LUC or pIL1 (3.1-kb) LUC plasmid DNA were performed. The phosphorothioate-protected oligonucleotides for AP-1 (CGCTTGATGACTCAGCCGGAA), CRE (AGAGATTGCCTGACGTCAGAGAGCTAG), and NF-kappa B (ATGTGAGGGGACTTTCCCAGGC) were annealed in 200 mM NaCl by heating to 94°C for 7 min and cooling slowly to 4°C.

DNA Electrophoresis Mobility Gel Shift Assay

U937 cells (1 × 108) were grown in suspension in RPMI-1640 supplemented with 10% heat-inactivated FBS, 1% antibiotic/antimycotic, in 75-mm tissue culture flasks with or without 500 µg/ml LPS-free fibrinogen at 37°C in a 5% CO2 incubator. Some experiments included cells treated with LPS at 10 µg/ml. Cells were treated for 16 h and washed with ice-cold PBS, and nuclear binding proteins were extracted. Proteins were extracted in buffer containing 0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 25% glycerol, 0.5 mM phenylmethylsulfonyl fluoride, 5 µg/ml leupeptin, 1% aprotinin, 5 µg/ml pepstatin A, and 20 mM N-2-hydroxyethylpiperazine-N'-2-ethane sulfonic acid (Hepes), pH 7.9. Protein concentrations were determined by the Bradford method using the Bio-Rad protein assay reagent as described previously.

Double-stranded AP-1, CRE, or NF-kappa B consensus oligonucleotides were radiolabeled with 33P-gamma ATP using T4 polynucleotide kinase enzyme. A total of 5 µg of nuclear protein was incubated with radiolabeled AP-1, CRE, or NF-kappa B (1 to 200,000 counts per min/ng) for 30 min at room temperature in a reaction mixture containing 15 mM Hepes, 90 mM KCl, 1 mM EDTA, 1 mM DTT, 5% glycerol, and 0.1 µg/reaction poly(deoxyinosine/deoxycytidine). The DNA-protein complexes were separated on 6% native polyacrylamide gels (20:1 acrylamide/bis ratio) in low ionic-strength buffer (22.25 mM Tris borate, 22.25 mM boric acid, 500 mM EDTA) for 2 to 3 h at 4°C at 10 V/ cm2. Gels were fixed in a 10% acid/10% methanol solution for 10 min, dried under vacuum, and exposed to X-ray film. For the competition studies, 50-fold molar excess of nonradiolabeled double-stranded oligonucleotides was added to the reaction mix.

Statistical Analysis

Mean values are presented ± 1 SEM in all figures. Because more than two treatments with a single independent categorical value were compared, one-way analysis of variance (ANOVA) was used. The Student-Newman-Keuls (SNK) test for multiple comparisons was then used to test for differences between pairs of means (18).

    Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The IL-1beta Promoter Is Induced by Engagement of the CD18 (beta 2) Integrin Receptor by Fibrinogen

To determine whether the effects of fibrinogen on IL-1beta gene transcription in the U937 cell line were mediated through CD18 receptors, neutralization experiments were performed using the anti-CD18 antibody MAB1962. U937 cells transfected with the full-length 4.0-kb IL-1beta promoter-LUC construct were exposed to fibrinogen with or without pretreatment with MAB1962 at a final dilution of 1:200 from the manufacturer's preparation. Figure 1 shows that fibrinogen averaged almost three times greater stimulation of the construct than did unstimulated control cells (seven experiments, range 1.8 to 4.4 times the control value of 1). Control murine IgG did not affect constitutive or fibrinogen-induced levels of IL-1beta . The anti-CD18 antibody MAB1962 alone did not induce the IL-1beta promoter. The ANOVA for the effects of the antibodies on fibrinogen-treated cells gave a level of P = 0.019. Both fibrinogen and fibrinogen + IgG stimulated the IL-1beta promoter, and there were no significant differences between them. Both fibrinogen and fibrinogen + IgG each produced greater stimulation of the promoter than did fibrinogen + MAB1962, P < 0.05. Serial dilutions of MAB1962 produced correspondingly less inhibition of fibrinogen-induced IL-1beta promoter expression (Figure 2). These experiments indicate that expression of the IL-1beta promoter by fibrinogen-treated U937 cells, like normal leukocytes, is mediated via CD18 receptors.


View larger version (22K):
[in this window]
[in a new window]
  		Figure 1.   U937 cells transfected with the 4.0-kb IL-1beta promoter LUC construct were incubated with fibrinogen (Fbg) with or without pretreatment with anti-CD18 antibody. Fibrinogen stimulated expression of the 4.0-kb IL-1beta promoter LUC (relative stimulation ± 1 SEM) compared with untreated control cultures (value of 1; line). Control murine antibody (IgG) did not induce or inhibit promoter stimulation by fibrinogen. The anti-CD18 antibody MAB1962 inhibited induction of the IL-1beta promoter by fibrinogen. Seven separate experiments were performed comparing Fbg stimulation with Fbg + IgG and Fbg + MAB1962 in each experiment. ANOVA yielded a value of P = 0.019. There was no difference between fibrinogen and fibrinogen + IgG in the stimulation of the IL-1beta promoter. Both fibrinogen and fibrinogen + IgG each produced greater stimulation of the promoter than fibrinogen + MAB1962, P < 0.05.


View larger version (25K):
[in this window]
[in a new window]
  		Figure 2.   MAB1962 inhibited induction of the IL-1beta 4.0-kb LUC construct by fibrinogen (Fbg) in a dose-dependent fashion. Three sequential experiments, each with a different dilution of the antibody, were performed. The dilution labeled 1:1 was selected as the optimal antibody concentration inhibiting fibrinogen effects and was used in all blocking experiments at a 1:200 dilution of the manufacturer's preparation. Control murine antibody (IgG) was used in all three experiments and did not induce or inhibit promoter stimulation by fibrinogen (relative stimulation ± 1 SEM) compared with untreated control cultures (value of 1; line).

LPS Does Not Induce the IL-1beta Promoter Transfected in U937 Cells

LPS, a potent inducer of IL-1beta in normal monocytes (19, 20), was carefully monitored to assure that induction produced by fibrinogen was not due to contaminating LPS. Additionally, five experiments using U937 cells transfected with the inducible 4.0-kb promoter exposed to 10 µg/ml LPS (Sigma) yielded a relative stimulation of only 1.15 ± 0.08 SEM. This level of stimulation was significantly less than stimulation with fibrinogen alone (P = 0.003). Undifferentiated U937 cells, in fact, do not express IL-1beta in the presence of LPS (15, 21). Because of the care taken to eliminate LPS from our system, we are confident that LPS did not account for any of our results.

Fibrinogen-Response Elements in IL-1beta Promoter Regions Are Located Near, or Include, AP-1, CRE, and NF-kappa B

To explore which regions in the IL-1beta promoter are important for fibrinogen-induced IL-1beta expression, 5'-deletion constructs of the promoter linked to the CAT reporter gene were transfected into U937 cells and stimulated with fibrinogen. This was done by making discrete deletions of the fibrinogen-inducible 4.0-kb IL-1beta promoter sequence, producing a 2.98-kb construct and a 2.8-kb construct lacking a CRE-like motif found in the most upstream 180 base pairs (bp) of the construct (Figure 3A).


View larger version (12K):
[in this window]
[in a new window]
  		Figure 3.   (A) AP-1-, CRE-, and NF-kappa B-containing sequences are contained in the 4.0-kb IL-1beta promoter. Sequential deletion of AP-1 and CRE yielded the 2.98- and 2.8-kb deletion constructs, respectively. (B) Fibrinogen (Fbg) stimulation of the IL-1beta promoter 4.0-kb CAT construct was lost upon removal of the AP-1-containing sequences to create the 2.98-kb CAT construct (relative stimulation ± 1 SEM) compared with untreated control cultures (value of 1; line). Fibrinogen stimulation was regained in the 2.8-kb deletion CAT construct produced by removal of the upstream 180-bp CRE-containing region. ANOVA yielded a value of P = 0.083.

As seen with the 4.0-kb LUC construct in Figure 1, the 4.0-kb CAT construct was also stimulated by fibrinogen (Figure 3B). The 2.98-kb CAT construct, missing two upstream AP-1 response elements (positions -3491 and -3116) and two AP-1-like regions (positions -3194 and -3103), was not induced by fibrinogen. However, further deletion, including removal of the CRE-like site (position -2865, six of eight consensus nucleotides), produced the 2.8-kb IL-1beta promoter construct that was fully inducible by fibrinogen. The 2.8-kb construct contains an NF-kappa B-like element at position -2756 flanked immediately upstream by a CRE/AP-1 motif at position -2764. The alternate induction, suppression, and reinduction of the sequential deletion constructs by fibrinogen suggested an interdependent association between promoter regions containing AP-1, CRE, and NF-kappa B response elements in the regulation of IL-1beta .

Statistical analysis using ANOVA of the IL-1beta promoter deletion construct expression by fibrinogen-stimulated cells gave a level of P = 0.083, too large to perform multiple comparisons by the SNK test. Given this level of significance, we estimate a 10% chance that the observed differences between the inducible 4.0- and 2.8-kb constructs and the noninducible 2.98-kb construct could have occurred by chance alone. However, the corroborative competitive cotransfection studies described below showed highly significant differences and thus increase the likelihood that our findings with the deletion constructs are real.

Fibrinogen Induces DNA-Binding Activity of AP-1, CRE Binding Protein, and NF-kappa B Nuclear Binding Proteins

The deletion studies implied that AP-1, CRE, and NF-kappa B response elements could be important in fibrinogen- induced IL-1beta expression. DNA electrophoresis mobility gel shift assays were performed to determine whether nuclear binding proteins corresponding to these response elements were activated upon fibrinogen stimulation. Figure 4 shows a representative gel of five separate experiments, with competition oligonucleotides in two of the experiments showing that fibrinogen induced greater DNA-binding activity of the nuclear binding proteins AP-1, CRE binding protein (CREB), and NF-kappa B compared with no fibrinogen treatment in U937 cells. Incubation with excess unlabeled AP-1, CRE, and NF-kappa B consensus oligonucleotides competed out their respective nuclear binding proteins from fibrinogen-treated cells to labeled probe. LPS-stimulated cells did not significantly increase activation of any of these binding factors (not shown).


View larger version (86K):
[in this window]
[in a new window]
  		Figure 4.   Nuclear binding proteins were extracted from fibrinogen-stimulated U937 cells and probed specifically for AP-1, CREB, and NF-kappa B proteins. DNA electrophoresis mobility gel-shift assays showed increased binding of AP-1, CREB, and NF-kappa B to their respective probes in fibrinogen-stimulated cells (lanes 3, 7, and 11) compared with unstimulated control (C) cells (lanes 2, 6, and 10). A 50-fold molar excess unlabeled competitor successfully competed out all three nuclear binding proteins (lanes 4, 8, and 12). Bound probe is indicated by the letter B. The first lane in each set shows migration of the unbound or free (F ) probe (the CRE extracts in the gel shown had high levels of protein, so free probe was retained at the origin). The shift pattern of this gel is representative of five separate experiments, with competition oligonucleotides in two of the experiments.

We should point out that nuclear binding proteins were extracted after 16 h of incubation with fibrinogen, on the basis of our experience with the IL-1beta promoter-CAT transfections. Translocation/activation of the nuclear binding proteins upon stimulation with fibrinogen probably occurs much sooner and possibly with greater binding than later. Nevertheless, the shifts in oligonucleotide-bound proteins were clear.

Transactivation of NF-kappa B Is Required for the Induction of the IL-1beta Promoter by Fibrinogen

Competitive cotransfection studies using consensus oligonucleotides mimicking AP-1, CRE, and NF-kappa B cis-acting regions were performed to determine which sites on the IL-1beta promoter repressed or enhanced transcription. Neither AP-1 nor CRE consensus oligonucleotides prevented induction of the full-length 4.0-kb LUC IL-1beta promoter by fibrinogen (Figure 5). In contrast, NF-kappa B consensus oligonucleotides prevented fibrinogen induction of IL-1beta . ANOVA comparing fibrinogen treatment alone with fibrinogen + competitive oligonucleotides gave a value of P = 0.02. Multiple-comparison testing showed that only competition with NF-kappa B oligonucleotide was significantly different from fibrinogen treatment alone (P < 0.05). Thus, transactivation of NF-kappa B or NF-kappa B-like sequences appears to be required for induction of the IL-1beta gene.


View larger version (25K):
[in this window]
[in a new window]
  		Figure 5.   U937 cells were cotransfected with the 4.0-kb-LUC IL-1beta promoter construct and competitive consensus oligonucleotides for AP-1, CRE, or NF-kappa B. LUC activity is displayed relative to untreated control cells that were not cotransfected (relative stimulation ± 1 SEM greater or less than a value of 1). ANOVA comparing fibrinogen (Fbg) treatment alone with fibrinogen + competitive oligonucleotides gave a value of P = 0.02. Multiple-comparison testing showed that only competition with NF-kappa B oligonucleotide was significantly different from fibrinogen treatment alone (P < 0.05). The oligonucleotides alone (open bars) did not affect constitutive expression of the 4.0-kb IL-1beta promoter construct.

Transactivation of CRE Represses Induction of the IL-1beta Promoter by Fibrinogen

Experiments using the 5'-deletion constructs and DNA mobility gel shift assays indicated that transactivation of CRE by CREB can suppress IL-1beta expression under certain conditions. To determine whether occupancy of CRE by its nuclear binding protein CREB could repress induction of the IL-1beta promoter, studies were performed using the 3.1-kb LUC 5'-deletion construct cotransfected with the CRE consensus oligonucleotide. Like the 2.98-kb CAT construct, the 3.1-kb LUC construct was not induced by fibrinogen (Figure 6). Cotransfection with competitive CRE oligonucleotides allowed recovery of promoter induction by fibrinogen. Recovery of promoter induction was significant, as determined by ANOVA comparing the effect of CRE cotransfection on fibrinogen stimulation with fibrinogen or CRE treatment alone (P < 0.0001). Multiple-comparison testing showed that cotransfection with CRE oligonucleotide followed by fibrinogen treatment produced greater stimulation than fibrinogen treatment alone (P < 0.05). These findings support a role for CRE as a repressor element.


View larger version (18K):
[in this window]
[in a new window]
  		Figure 6.   U937 cells were cotransfected with the 3.1-kb-LUC IL-1beta promoter construct and competitive consensus oligonucleotides for CRE. Competition with CRE oligonucleotides permitted induction of the 3.1-kb IL-1beta promoter construct by fibrinogen (Fbg). LUC activity is displayed relative to untreated control cells that were not cotransfected (relative stimulation ± 1 SEM greater or less than a value of 1). ANOVA comparing the effect of CRE cotransfection on fibrinogen stimulation with fibrinogen or CRE treatment alone gave a value of P < 0.0001. Multiple-comparison testing showed that cotransfection with CRE oligonucleotide followed by fibrinogen treatment produced greater stimulation than did fibrinogen treatment alone (P < 0.05). CRE oligonucleotide alone did not affect constitutive expression of the 3.1-kb IL-1beta promoter construct.

    Discussion
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

This study extends our observations that fibrinogen induces expression of IL-1beta in a specific receptor-mediated way. We show that fibrinogen affects expression through regions in the IL-1beta gene promoter that contain motifs important in the regulation of the IL-1beta gene (15, 22). The results implicate regions containing AP-1, CRE, and NF-kappa B-like response elements in the control of IL-1beta expression induced by fibrinogen.

The IL-1beta Promoter Is Induced by Fibrinogen Engagement of the CD18 (beta 2) Integrin Receptor

Fibrinogen binding to leukocytes has been well established (23), but only recently have the specific receptors and binding dynamics been described (24, 25). Like other extracellular matrix proteins, such as fibronectin and collagen, fibrin binds to cells via heterodimeric integrin receptors. The family of beta 2 integrins, designated CD18, are the primary receptors for fibrinogen on leukocytes (reviewed in Ref. 26). Fibrin(ogen) binding to leukocytes is mediated mainly via the integrin receptor designated CD11b/CD18 (also termed Mac-1 or CR3) (27, 28), but binding to CD11c/CD18 has also been shown (29). In this report, we demonstrate with antibody-blocking studies that a CD18 receptor in U937 cells is responsible for the IL-1beta promoter-inducing effects of fibrinogen. This finding was expected on the basis of the studies cited above and our own study using normal monocytes (13). The results reported here confirm that fibrinogen interacts with U937 cells via the same family of CD18 receptors found on normal leukocytes. In addition, neutralization studies in progress show that the anti-CD11b mAbs 2LPM19c (DAKO, Carpinteria, CA), and D12 (Becton Dickinson, Bedford, MA) also inhibit induction of the IL-1beta promoter by fibrinogen (two separate experiments, each in duplicate, not shown). These experiments suggest that expression of the IL-1beta promoter by fibrinogen-treated U937 cells may be mediated primarily via the CD11b/ CD18 fibrinogen receptor.

As indicated in MATERIALS AND METHODS, neither ADP nor ionomycin (both of which promote activation of the CD18 receptor into a high-affinity state [14]) was used in these studies. Treatment of the cell cultures with these agents could have increased the sensitivity of the cells to fibrinogen. It is possible that the stress of cell isolation and transfection was sufficient to activate CD18 enough to produce the results reported.

The anti-CD18 mAb MAB1962, or clone P4H9, has been compared with a prototypical anti-CD18 clone, mAb 60.3 (30). Both have a propensity to neutralize a number of leukocyte functions, such as monocyte adherence to endothelium, cell-mediated responses, and mitogen-induced cell proliferation (30). In our experiments, MAB1962 effectively inhibited fibrinogen induction of the IL-1beta gene. The antibody alone did not induce the promoter, in keeping with the findings of Yurochko and associates, who found that mAb 60.3 did not induce IL-1beta mRNA in normal human monocytes (33). Thus, MAB1962 does not appear to behave as a surrogate ligand, but instead prevents the interaction of natural ligands, including fibrinogen, with a CD18 receptor.

Fibrinogen-Response Elements in the IL-1beta Promoter Involving AP-1-, CRE-, and NF-kappa B-like Motifs Regulate Transcription of IL-1beta

Transcription of IL-1beta induced by fibrin appears to involve the complex interaction of several regulatory elements in the IL-1beta promoter. Our study shows that NF-kappa B, CREB, and AP-1 nuclear binding proteins are activated to interact with the IL-1beta promoter after fibrinogen stimulation. The specificity of this interaction was supported by competitive cotransfection and gel-shift experiments using unlabeled consensus oligonucleotides. Once activated, NF-kappa B, CREB, and AP-1 may induce or repress transcription of IL-1beta .

An important role for the transcription factor NF-kappa B in inflammation has been described by in vitro studies (reviewed in Ref. 34), by work in models of lung injury, and in patients with the acute respiratory distress syndrome (35). Our findings are consistent with this role for NF-kappa B and advance a mechanistic explanation for the postulated proinflammatory effects of fibrin(ogen) deposited in the injured lung. Specifically, we found that NF-kappa B transcription factor was activated by fibrinogen and then interacted with an NF-kappa B-like response element to induce the IL-1beta promoter. Competition for the NF-kappa B transcription factor by consensus oligonucleotide in fibrinogen-stimulated cells completely abrogated induction of the IL-1beta promoter. Thus, an NF-kappa B-like sequence appears to be a necessary fibrinogen response element in the transcriptional regulation of IL-1beta . It should be noted, however, that although our findings in the promoter-deletion experiments were corroborated by the cotransfection experiments, a causal link between binding and activation cannot be conclusively assumed.

cAMP pathways, which involve transactivation of CRE by CREB, can lead to induction or suppression of IL-1beta , depending on the experimental conditions (38, 39). Increased levels of cAMP induced by LPS were found by Brandwein to suppress IL-1beta synthesis in mouse peritoneal macrophages (38). In contrast, Chandra and coworkers found that LPS-stimulated increases in cAMP enhanced IL-1beta in THP-1 cells (39). Therefore, differences in stimulating agents and cell types likely have a major role in transcriptional regulation of IL-1beta (15) and should be taken into consideration when comparing one experimental system with another. Though we did not measure cAMP, interaction of CREBs with CREs suggested involvement of a fibrinogen-activated cAMP pathway that could have repressed IL-1beta gene expression in our model. However, repression by CRE seemed to be conditional on upstream regulatory sequences, because even though CREB was activated in the cell nucleus after treatment with fibrinogen, induction of the full-length IL-1beta promoter was not repressed. Only when upstream sequences containing AP-1 were deleted did CREB-CRE interaction repress the promoter. When this interaction was interrupted by competition for CREB with excess CRE oligonucleotides, the truncated promoter (3.1-kb LUC) was inducible by fibrinogen.

AP-1 response elements composed of combinations of the proto-oncogenes c-jun and c-fos are known to be involved in the transcriptional upregulation of IL-1beta induced by phorbol esters (40). We found that deletion of AP-1-containing sequences creating the 2.98-kb CAT or 3.1-kb LUC constructs resulted in complete loss of IL-1beta promoter stimulation by fibrinogen. In the context of the cotransfection experiments showing that NF-kappa B oligonucleotides blocked fibrinogen induction of the full-length promoter (Figure 5) whereas CRE oligonucleotides recovered induction in the 3.1-kb construct (Figure 6), we suggest that activation of the upstream AP-1 or AP-1-like elements is required to permit IL-1beta transcription in the intact promoter. We should also point out that known AP-1/CRE and AP-1 sequences downstream from the CRE element at position -2865 could potentially affect the induction or suppression of the IL-1beta promoter in ways not detected by our experimental design. Thus, various combinations of activated AP-1/activating transcription factor (ATF)/CREB family heterodimeric nuclear binding proteins could regulate the degree to which fibrinogen induces transcription of IL-1beta .

Fibrin(ogen) as a Proinflammatory Molecule in Lung Injury

Plasma fibrinogen leaks into the extravascular spaces (41, 42) or is produced by alveolar epithelial cells (43) where it can be converted to fibrin under procoagulant conditions in injured and inflamed tissues (5, 44, 45). There, fibrin(ogen) may interact with leukocytes bearing beta 2 integrin receptors to promote the synthesis of IL-1beta and possibly other immediate/early inflammatory mediators such as tissue factor (46). Coagulation factor X, the complement component C3bi, and intracellular adhesion molecules (ICAM)-1 and -2 also bind beta 2 integrins (47). It is possible, then, that activation of the coagulation or complement systems, or contact with damaged endothelium expressing increased ICAM, may also promote IL-1beta induction via the beta 2 integrin family of leukocyte receptors. The signal transduction pathways activated by fibrin(ogen) and the other beta 2 integrin ligands are not completely understood, but may involve changes in cAMP, calcium fluxes, and even cell cytoskeletal rearrangements (13, 48).

In conclusion, we have extended our previous work by elucidating some of the potential transcriptional regulatory mechanisms through which fibrin(ogen) induces IL-1beta . These mechanisms involve regions on the IL-1beta promoter that enhance, permit, and, in some cases, may suppress transcription of IL-1beta . Although our study focused on fibrinogen stimulation of promoter sequences known to regulate IL-1beta transcription, other as-yet-undescribed fibrin(ogen) response elements could also be involved in the regulation of this multifunctional inflammatory cytokine.

    Footnotes

Address correspondence to: Rafael L. Perez, M.D., Dept. of Medicine (111), Veterans Affairs Medical Center, 1670 Clairmont Rd., Decatur, GA 30033. E-mail: rperez{at}emory.edu

(Received in original form December 29, 1997 and in revised form October 28, 1998).

Abbreviations: analysis of variance, ANOVA; activator protein, AP; beta - galactosidase, beta gal; cyclic adenosine monophosphate, cAMP; chloramphenicol acetyl transferase, CAT; cAMP response element, CRE; CRE binding protein, CREB; dithiothreitol, DTT; ethylenediaminetetraacetic acid, EDTA; immunoglobulin, Ig; interleukin, IL; lipopolysaccharide, LPS; luciferase, LUC; monoclonal antibody, mAb; nuclear factor, NF; phosphate-buffered saline, PBS.

Acknowledgments: The authors thank Dr. Matthew Fenton for providing the IL-1beta promoter constructs. This work was supported by research grants from the American Lung Association (R.L.P.) and R01-HL51639 (J.R.).
    References
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Kuhn, C. III, J. Boldt, T. E. King Jr., E. Crouch, T. Vartio, and J. A. McDonald. 1989. An immunohistochemical study of architectural remodeling and connective tissue synthesis in pulmonary fibrosis. Am. Rev. Respir. Dis. 140: 1693-1703 [Medline].

2. Spencer, H. 1977. Pathology of the Lung. W. B. Saunders, Philadelphia.

3. Idell, S., K. K. James, E. G. Levin, B. S. Schwartz, N. Manchanda, R. J. Maunder, T. R. Martin, J. McLarty, and D. S. Fair. 1989. Local abnormalities in coagulation and fibrinolytic pathways predispose to alveolar fibrin deposition in the adult respiratory distress syndrome. J. Clin. Invest. 84: 695-705 .

4. Bertozzi, P., B. Astedt, L. Zenzius, K. Lynch, F. LeMaire, W. Zapol, and J. H. A. Chapman. 1990. Depressed bronchoalveolar urokinase activity in patients with adult respiratory distress syndrome. N. Engl. J. Med. 322: 890-897 [Abstract].

5. Chapman, H. A., P. Bertozzi, and J. J. Reilly. 1988. Role of enzymes mediating thrombosis and thrombolysis in lung disease. Chest 93: 1256-1263 [Abstract/Free Full Text].

6. Olman, M. A., N. Mackman, C. L. Gladson, K. M. Moser, and D. J. Loskutoff. 1995. Changes in procoagulant and fibrinolytic gene expression during bleomycin-induced lung injury in the mouse. J. Clin. Invest. 96: 1621-1630 .

7. Clark, R. A. F., J. M. Lanigan, P. DellaPelle, E. Manseau, H. F. Dvorak, and R. B. Colvin. 1982. Fibronectin and fibrin provide a provisional matrix for epidermal cell migration during wound reepithelialization. J. Invest. Derm. 79: 264-269 [Medline].

8. Altieri, D. C., J. Plescia, and E. F. Plow. 1993. The structural motif glycine 190-valine 202 of the fibrinogen gamma  chain interacts with CD11b/CD18 integrin (alpha Mbeta 2, Mac-1) and promotes leukocyte adhesion. J. Biol. Chem. 268: 1847-1853 [Abstract/Free Full Text].

9. Rowland, F. N., M. J. Donovan, P. T. Picciano, G. D. Wilner, and D. L. Kreutzer. 1984. Fibrin-mediated vascular injury. Identification of fibrin peptides that mediate endothelial cell retraction. J. Pathol. 117: 418-428 .

10. Senior, R. M., W. F. Skogen, G. L. Griffin, and G. D. Wilner. 1986. Effects of fibrinogen derivatives upon the inflammatory response. Studies with human fibrinopeptide B.  J. Clin. Invest. 77: 1014-1019 .

11. McDonald, J. A.. 1990. The yin and yang of fibrin in the airways. N. Engl. J. Med. 322: 929-931 [Medline].

12. Brown, L. F., A. M. Dvorak, and H. F. Dvorak. 1989. Leaky vessels, fibrin deposition, and fibrosis: a sequence of events common to solid tumors and to many other types of disease. Am. Rev. Respir. Dis. 140: 1104-1107 [Medline].

13. Perez, R. L., and J. Roman. 1995. Fibrin enhances the expression of interleukin-1beta by human peripheral blood mononuclear cells. Implications in pulmonary inflammation. J. Immunol. 154: 1879-1887 [Abstract].

14. Altieri, D. C., and T. S. Edgington. 1988. The saturable high affinity association of factor X to ADP-stimulated monocytes defines a novel function of the Mac-1 receptor. J. Biol. Chem. 263: 7007-7015 [Abstract/Free Full Text].

15. Gray, J. G., G. Chandra, W. C. Clay, S. W. Stinnett, S. A. Haneline, J. J. Lorenz, I. R. Patel, G. B. Wisely, P. J. Furdon, J. D. Taylor, and T. A. Kost. 1993. A CRE/ATF-like site in the upstream regulatory sequence of the human interleukin-1beta gene is necessary for induction in U937 and THP-1 monocytic cell lines. Mol. Cell. Biol. 13: 6678-6689 [Abstract/Free Full Text].

16. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2: 1044-1051 [Abstract/Free Full Text].

17. Bradford, M. M.. 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-254 [Medline].

18. Glantz, S. A. 1987. Primer of Biostatistics. McGraw-Hill Book Company, New York.

19. Shaw, R. J., and R. A. F. Clark. 1989. Interleukins and their interactions in inflammation. In Mediators of the Inflammatory Process. P. M. Henson and R. C. Murphy, editors. Elsevier, New York. 245-267.

20. Galve de-Rochemonteix, B., L. P. Nicod, R. Chicheportiche, S. Lacraz, C. Baumberger, and J.-M. Dayer. 1993. Regulation of interleukin-1ra, interleukin-1alpha , and interleukin-1beta production by human alveolar macrophages with phorbol myristate acetate, lipopolysaccharide, and interleukin-4. Am. J. Respir. Cell Mol. Biol. 8: 160-168 .

21. Knudsen, P. J., C. A. Dinarello, and T. B. Strom. 1986. Prostaglandins posttranscriptionally inhibit monocyte expression of interleukin 1 activity by increasing intracellular cyclic adenosine monophosphate. J. Immunol. 137: 3189-3194 [Abstract].

22. Fenton, M. J.. 1992. Review: transcriptional and post-transcriptional regulation of interleukin 1 gene expression. Int. J. Immunopharmacol. 14: 401-411 [Medline].

23. Colvin, R. B., and H. F. Dvorak. 1975. Fibrinogen/fibrin on the surface of macrophages: detection, distribution, binding requirements, and possible role in macrophage adherence phenomena. J. Exp. Med. 142: 1377-1390 [Abstract/Free Full Text].

24. Diamond, M. S., and T. S. Springer. 1993. A subpopulation of Mac-1 (CD11b/CD18) molecules mediates neutrophil adhesion to ICAM-1 and fibrinogen. J. Cell Biol. 120: 545-556 [Abstract/Free Full Text].

25. Trezzini, C., T. W. Jungi, P. Kuhnert, and E. Peterhans. 1988. Fibrinogen association with human monocytes: evidence for constitutive expression of fibrinogen receptors and for involvement of Mac-1 (CD18, CR3) in the binding. Biochem. Biophys. Res. Commun. 156: 477-484 [Medline].

26. Hynes, R. O.. 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell 69: 11-25 [Medline].

27. Altieri, D. C., R. Bader, P. M. Mannucci, and T. S. Edgington. 1988. Oligospecificity of the cellular adhesion receptor MAC-1 encompasses an inducible recognition specificity for fibrinogen. J. Cell Biol. 107: 1893-1900 [Abstract/Free Full Text].

28. Wright, S. D., J. I. Weitz, A. J. Huang, S. M. Levin, S. C. Silverstein, and J. D. Loike. 1988. Complement receptor type three (CD11b/CD18) of human polymorphonuclear leukocytes recognizes fibrinogen. Proc. Natl. Acad. Sci. USA 85: 7734-7738 [Abstract/Free Full Text].

29. Loike, J. D., B. Sodeik, L. Cao, S. Leucona, J. I. Weitz, P. A. Detmers, S. D. Wright, and S. C. Silverstein. 1991. CD11c/CD18 on neutrophils recognizes a domain at the N terminus of the Aalpha chain of fibrinogen. Proc. Natl. Acad. Sci. USA 88: 1044-1048 [Abstract/Free Full Text].

30. Wayner, E. A., S. G. Gil, G. F. Murphy, M. S. Wilke, and W. G. Carter. 1993. Epiligrin, a component of epithelial basement membranes, is an adhesive ligand for a3b1 positive T lymphocytes. J. Cell Biol. 121: 1141-1152 [Abstract/Free Full Text].

31. Beatty, P. G., J. A. Ledbetter, P. J. Martin, T. H. Price, and J. A. Hansen. 1983. Definition of a common leukocyte cell-surface antigen (Lp95-150) associated with diverse cell-mediated immune functions. J. Immunol. 131: 2913-2918 [Abstract].

32. Prieto, J., P. G. Beatty, E. A. Clark, and M. Patarroyo. 1988. Molecules mediating adhesion of T and B cells, monocytes, and granulocytes to vascular endothelial cells. Immunology 63: 631-637 [Medline].

33. Yurochko, A. D., D. Y. Liu, D. Eierman, and S. Haskill. 1992. Integrins as a primary signal transduction molecule regulating monocyte immediate-early gene induction. Proc. Natl. Acad. Sci. USA 89: 9034-9038 [Abstract/Free Full Text].

34. Blackwell, T. S., and J. W. Christman. 1997. The role of nuclear factor-kappa B in cytokine gene regulation. Am. J. Respir. Cell Mol. Biol. 17: 3-9 [Abstract/Free Full Text].

35. Haddad, E. B., M. Salmon, H. Koto, P. J. Barnes, I. Adcock, and K. F. Chung. 1996. Ozone induction of cytokine-induced neutrophil chemoattractant (CINC) and nuclear factor-kappa B in rat lung: inhibition by corticosteroids. FEBS Lett. 379: 265-268 [Medline].

36. Shenkar, R., M. D. Schwartz, L. S. Terada, J. E. Repine, J. McCord, and E. Abraham. 1996. Hemorrhage activates NF-kappa-B in murine lung mononuclear cells in vivo. Am. J. Physiol. 14: L729-L735 .

37. Schwartz, M. D., E. E. Moore, F. A. Moore, R. Shenkar, P. Moine, J. B. Haenel, and E. Abraham. 1996. Nuclear factor-kB is activated in alveolar macrophages from patients with acute respiratory distress syndrome. Crit. Care Med. 24: 1285-1292 [Medline].

38. Brandwein, S. R.. 1986. Regulation of interleukin 1 production by mouse peritoneal macrophages: effects of arachidonic acid metabolites, cyclic nucleotides, and interferons. J. Biol. Chem. 261: 8624-8632 [Abstract/Free Full Text].

39. Chandra, G., J. P. Cogswell, L. R. Miller, M. M. Godlevski, S. W. Stinnett, S. L. Noel, S. H. Kadwell, T. A. Kost, and J. G. Gray. 1995. Cyclic AMP signaling pathways are important in IL-1 beta transcriptional regulation. J. Immunol. 155: 4535-4543 [Abstract].

40. Bensi, G., M. Mora, G. Raugei, D. T. Buonamassa, M. Rossini, and M. Melli. 1990. An inducible enhancer controls the expression of the human interleukin 1 beta gene. Cell Growth Differ. 1: 491-497 [Abstract].

41. Holter, J. F., J. E. Weiland, E. R. Pacht, J. E. Gadek, and W. B. Davis. 1986. Protein permeability in the adult respiratory distress syndrome: loss of size selectivity of the alveolar epithelium. J. Clin. Invest. 78: 1513-1522 .

42. Jacobs, M. P., R. P. Baughman, J. Hughes, and M. Fernandez-Ulloa. 1985. Radioaerosol lung clearance in patients with active pulmonary sarcoidosis. Am. Rev. Respir. Dis. 131: 687-689 [Medline].

43. Guadiz, G., L. A. Sporn, R. A. Goss, S. O. Lawrence, V. J. Marder, and P. J. Simpson-Haidaris. 1997. Polarized secretion of fibrinogen by lung epithelial cells. Am. J. Respir. Cell Mol. Biol. 17: 60-69 [Abstract/Free Full Text].

44. Chapman, H. A., C. L. Allen, O. L. Stone, and D. S. Fair. 1985. Human alveolar macrophages synthesize factor VII in vitro: possible role in interstitial lung disease. J. Clin. Invest. 75: 2030-2037 .

45. Edgington, T. S., H. Helin, S. A. Gregory, G. Levy, D. S. Fair, and B. S. Schwartz. 1985. Cellular pathways and signals for the induction of biosynthesis of initiators of the coagulation cascade by cells of the monocyte lineage. In Mononuclear Phagocytes. R. van Furth, editor. Martinus Nijhoff, The Hague. 687-696.

46. Fan, S.-T., and T. S. Edgington. 1991. Coupling of the adhesive receptor CD11b/CD18 to functional enhancement of effector macrophage tissue factor response. J. Clin. Invest. 87: 50-57 .

47. Ruoslahti, E.. 1991. Integrins. J. Clin. Invest. 87: 1-5 .

48. Juliano, R. L., and S. Haskill. 1993. Signal transduction from the extracellular matrix. J. Cell Biol. 120: 577-585 [Free Full Text].




This article has been cited by other articles:


Home page
 Genes Dev.Home page
B. Vidal, A. L. Serrano, M. Tjwa, M. Suelves, E. Ardite, R. De Mori, B. Baeza-Raja, M. Martinez de Lagran, P. Lafuste, V. Ruiz-Bonilla, et al.
Fibrinogen drives dystrophic muscle fibrosis via a TGF{beta}/alternative macrophage activation pathway
Genes & Dev., July 1, 2008; 22(13): 1747 - 1752.
[Abstract] [Full Text] [PDF]

Home page
 ThoraxHome page
M. Wygrecka, P. Markart, L. Fink, A. Guenther, and K. T Preissner
Raised protein levels and altered cellular expression of factor VII activating protease (FSAP) in the lungs of patients with acute respiratory distress syndrome (ARDS)
Thorax, October 1, 2007; 62(10): 880 - 888.
[Abstract] [Full Text] [PDF]

Home page
 J. Exp. Med.Home page
J. Paul, S. Strickland, and J. P. Melchor
Fibrin deposition accelerates neurovascular damage and neuroinflammation in mouse models of Alzheimer's disease
J. Exp. Med., August 6, 2007; 204(8): 1999 - 2008.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
E. East, D. Baker, G. Pryce, H. R. Lijnen, M. L. Cuzner, and D. Gveric
A Role for the Plasminogen Activator System in Inflammation and Neurodegeneration in the Central Nervous System during Experimental Allergic Encephalomyelitis
Am. J. Pathol., August 1, 2005; 167(2): 545 - 554.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
A. Sahni, M. Guo, S. K. Sahni, and C. W. Francis
Interleukin-1{beta} but not IL-1{alpha} binds to fibrinogen and fibrin and has enhanced activity in the bound form
Blood, July 15, 2004; 104(2): 409 - 414.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
K. Akassoglou, R. A. Adams, J. Bauer, P. Mercado, V. Tseveleki, H. Lassmann, L. Probert, and S. Strickland
Fibrin depletion decreases inflammation and delays the onset of demyelination in a tumor necrosis factor transgenic mouse model for multiple sclerosis
PNAS, April 27, 2004; 101(17): 6698 - 6703.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
L. Zhao and R. D. Brinton
Suppression of Proinflammatory Cytokines Interleukin-1{beta} and Tumor Necrosis Factor-{alpha} in Astrocytes by a V1 Vasopressin Receptor Agonist: A cAMP Response Element-Binding Protein-Dependent Mechanism
J. Neurosci., March 3, 2004; 24(9): 2226 - 2235.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
B. Kerlin, B. C. Cooley, B. H. Isermann, I. Hernandez, R. Sood, M. Zogg, S. B. Hendrickson, M. W. Mosesson, S. Lord, and H. Weiler
Cause-effect relation between hyperfibrinogenemia and vascular disease
Blood, March 1, 2004; 103(5): 1728 - 1734.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. E. Michaelson, J. D. Ritzenthaler, and J. Roman
Regulation of serum-induced fibronectin expression by protein kinases, cytoskeletal integrity, and CREB
Am J Physiol Lung Cell Mol Physiol, February 1, 2002; 282(2): L291 - L301.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Crit. Care Med.Home page
S. IDELL
Anticoagulants for Acute Respiratory Distress Syndrome . Can They Work?
Am. J. Respir. Crit. Care Med., August 15, 2001; 164(4): 517 - 520.
[Full Text] [PDF]

Home page
 Am. J. Respir. Crit. Care Med.Home page
S. IDELL, A. P. MAZAR, P. BITTERMAN, S. MOHLA, and A. L. HARABIN
Fibrin Turnover in Lung Inflammation and Neoplasia
Am. J. Respir. Crit. Care Med., February 1, 2001; 163(2): 578 - 584.
[Full Text]

Home page