help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Akiyama, J.
Right arrow Articles by Poulain, F. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Akiyama, J.
Right arrow Articles by Poulain, F. R.
Am. J. Respir. Cell Mol. Biol., Volume 21, Number 2, August 1999 193-199

Characterization of the Mouse Collectin Gene Locus

Jennifer Akiyama, Stanislav V. Volik, Ingrid Plajzer-Frick, Amy Prince, Haruhiko Sago, Heinz-Ulrich G. Weier, Jeff N. Vanderbilt, Sam Hawgood, and Francis R. Poulain

Cardiovascular Research Institute and Department of Pediatrics, University of California San Francisco, San Francisco; and Lawrence Berkeley National Laboratory, Berkeley, California


    Abstract
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Three of the four known mouse collectin genes have been mapped to chromosome 14. To further characterize the spatial relationship of these genes, a bacterial artificial chromosome (BAC) library of mouse chromosome 14 was screened using mouse surfactant protein (SP)-A and -D complementary DNAs (cDNAs). One large clone hybridized to both SP-A and SP-D cDNAs and was found by polymerase chain reaction (PCR) to contain sequences from one of the mouse mannose-binding lectin genes (Mbl1). We used Southern mapping and subcloning of overlapping restriction fragments to characterize the gene locus. Mapping was confirmed by fluorescent in situ hybridization of fiber-stretched BAC DNA and by Southern hybridization of restriction endonuclease-digested and PCR-amplified genomic DNA. We found that the SP-A, Mbl1, and SP-D genes reside contiguously within a 55-kb region. The SP-A and Mbl1 genes are in the same 5' to 3' orientation and 16 kb apart. The SP-D gene is in the opposite orientation to the two other collectin genes, 13 kb away from the 3' end of the Mbl1 gene. The mouse SP-D gene had not previously been characterized. We found its size (13 kb) and organization to be similar to that of human SP-D. Exon I is untranslated. The second exon is a hybrid exon that contains signal for initiation of translation, signal peptide, N-terminal domain, and the first seven collagen triplets of the collagen-like domain of the protein. Four short exons (III through VI) encode the collagen-like domain of the protein, and exons VII and VIII the linking and the carbohydrate-recognition domains, respectively.


    Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Collectins are a family of structurally related proteins that are characterized by the linking of globular lectin and collagen-like domains (1). Multiples of the collagen-like trimers assemble to form the mature proteins. Three collectins, the serum mannose-binding lectin (Mbl) and the lung surfactant-associated apoproteins surfactant protein (SP)-A and SP-D, have been found in all mammalian species studied. Two additional members of this protein family, bovine conglutinin and CL-43, have been isolated from cattle serum only.

Collectins bind carbohydrates through their polyvalent lectin domains, allowing selective recognition of carbohydrates arrayed on the surface of microorganisms (reviewed in [2]). Mbl and bovine conglutinin directly activate the complement cascade: Mbl by binding Clr2-Cls2 complexes (3) or its own cognate serine proteases, MASP-1 (4) and MASP-2 (5); bovine conglutinin by binding iC3b (6). The lung collectins, SP-A and SP-D, have not been shown to activate complement, but both bind and facilitate the phagocytosis of a variety of microorganisms in vitro (reviewed in [7]).

In the human, a collectin gene cluster containing two SP-A structural genes (SP-Al and SP-A2), an SP-A pseudogene, structural genes for SP-D and Mbl, and an Mbl pseudogene is found on chromosome 10 (8, 9). In the mouse, genes for SP-A, SP-D, and one Mbl gene (Mbl1) have all been assigned to chromosome 14 (10), which is syntenic to human chromosome 10. A second mouse Mbl gene (Mbl2) has been localized to chromosome 19 (12).

In the present study, we report the isolation of a single bacterial artificial chromosome (BAC) clone from mouse chromosome 14 that contains three collectin genes, SP-A, SP-D, and Mbl1. Using Southern mapping of restriction fragments and fluorescent in situ hybridization (FISH) of fiber-stretched DNA (fiber-FISH), we have determined the distribution, orientation, and spacing of the three genes. In addition, we cloned and characterized the mouse SP-D gene. The information presented may further our understanding of the phylogeny of collectins and assist in developing models of collectin deficiency.

    Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Complementary DNA Cloning of Mouse SP-A

A 346-base pair (bp) mouse SP-A complementary DNA (cDNA) fragment corresponding to nucleotides 2306-2651 of the mouse SP-A gene was amplified from reverse-transcribed adult mouse lung poly(A+) RNA (13). The cDNA fragment was ligated into a TA cloning vector (Invitrogen, Carlsbad, CA), labeled with 32P deoxycytidine triphosphate (dCTP), and used to probe a mouse B6/CBAF1J lung cDNA library (Stratagene, La Jolla, CA) plated at densities of 5 to 10 × 104 plaques/15-cm plate. Duplicate filter-lifts were hybridized using a standard protocol (Stratagene) and exposed to Kodak XAR film at -80°C. Positive clones were isolated after two further rounds of screening using identical conditions. A full-length, 870-bp cDNA clone was confirmed by automated sequencing (PE Applied Biosystems, Foster City, CA) to be identical to that previously reported (14).

cDNA Cloning of Mouse SP-D

Using similar protocols and a carbohydrate-recognition domain (CRD)-specific probe, a partial length SP-D cDNA was isolated from the same library. The missing 5' sequence was obtained by rapid amplification of cDNA ends- polymerase chain reaction (RACE-PCR) and ligated to the partial-length cDNA to yield a full-length, 1,180-bp SP-D cDNA (40).

Genomic Cloning of Mouse SP-A

A mouse 129SVJ genomic library (Stratagene) was screened with the full-length SP-A cDNA labeled with 32P by random priming. Twenty 15-cm plates grown at densities of 1 × 105 plaques/plate were lifted onto nitrocellulose. Duplicate lifts were hybridized to the labeled cDNA probe using standard protocol (Stratagene) and exposed to XAR film at -80°C overnight. Two additional rounds of screening under identical conditions led to the isolation of two overlapping clones that spanned the entire mouse SP-A gene. The extent of overlap between the isolated clones and the previously reported mouse SP-A gene (14) was established through restriction mapping and sequencing.

Genomic Cloning of Mouse SP-D

The full-length SP-D cDNA was labeled with 32P (random priming) and used to probe the mouse 129SVJ genomic library. A partial-length genomic clone was obtained that lacked the last two exons of the structural gene. The last two exons and adjacent introns of the structural gene were contained in a 6-kb HindIII restriction fragment of BAC clone 2. Exons were positioned in the genomic clone by Southern blots probed with 32P end-labeled oligonucleotides designed from SP-D cDNA and by the published information on the intron-exon structure of the human SP-D gene (15). All eight exons and intron-exon boundaries were sequenced. The size of the intervening introns was determined by DNA sequencing or agarose electrophoresis.

FISH of Mouse Chromosome 14

DNA fragments from SP-A (8 kb) and SP-D (9 kb) genes were labeled with digoxigenin-11-deoxyuridine triphosphate (dUTP) (Boehringer Mannheim, Indianapolis, IN) by nick translation (Enzo Diagnostics, Farmingdale, NY) and hybridized to metaphase chromosomes from diploid mouse embryonic fibroblasts prepared by the standard method (16). Digoxigenin-labeled probes were detected with fluorescein isothiocyanate (FITC)-conjugated antidigoxigenin Fab fragment (Boehringer Mannheim), and chromosomes were counterstained with 4',6-diamidino-2-phenylindole (DAPI) and propidium iodide. Chromosomal assignment of the SP-A and SP-D genes was based on the analysis of the DAPI banding pattern.

Characterization of Mouse BAC Clones

BAC library screening. A mouse chromosome 14 BAC library was screened with mouse SP-A and SP-D cDNAs by Research Genetics (Birmingham, AL). Two positive clones (BAC1) and BAC2) were isolated and further characterized.

Pulse-field gel electrophoresis. DNA samples of the BAC clones were prepared by chloroform-methanol extraction and ethanol purification. The total of 0.5 mg of BAC DNA was loaded onto a 1.0% low-melt agarose (FMC BioProducts, Rockland, ME) in 0.5× Tris-borate EDTA (TBE) buffer. Electrophoresis was run for 15 h at 14°C and 6 V/cm, with pulse time gradients of 1.5 to 8 s. After separation, the gel was destained for 20 min in water containing 0.5 µg/ml ethidium bromide, destained in water, and photographed.

Southern mapping of restriction fragments. Each BAC clone was digested with the restriction enzymes BamHI, EcoRI, HindIII, NheI, SacI, XbaI, and XhoI (Boehringer Mannheim). Restriction fragments were separated by agarose gel electrophoresis and blotted onto nylon Hybond-N+ membranes (Amersham, Arlington Heights, IL). Membranes were hybridized to oligonucleotides designed from sequences of either BAC or genomic subclones, and exposed to Kodak XAR films. The size of each hybridized fragment was determined by its mobility in agarose, and the maps were progressively constructed.

Fiber-FISH. Each BAC clone was studied by fiber-FISH on slides using probes from sequences matching the 5' and 3' ends of all three genes (as discussed later, in RESULTS). Probes matching the 5' end sequences of the genes were random primer-labeled with digoxigenin-dUTP. Hybridized probes were detected with rhodamine-conjugated antidigoxigenin sheep antibody. Probes matching the 3' end sequences from each gene were random primer-labeled with FITC-dUTP. The probes were detected with mouse anti-FITC antibody and the signal was amplified by binding FITC-conjugated horse antimouse antibody. Background BAC insert was random primer-labeled with biotin-14-dCTP, detected with 7-amino-4-methylcoumarin-3-acetic acid (AMCA)-conjugated avidin, and amplified twice with biotinylated antiavidin goat antibody.

Slide preparation was modified from that described by Yokota and colleagues (17). Briefly, slides were washed in an ultrasonic bath for 15 min three times in washing solution (13 ml RBS-35 detergent [Pierce, Rockford, IL], 333 ml ethanol, deionized water to 1.0 liter), rinsed three times for 5 min in deionized water, then thoroughly blow-dried. Each slide batch was then modified in an air-filled chamber at 100°C with 1 ml of 0.1% solution of 3-aminopropyltriethoxysilane (Sigma, St. Louis, MO) per slide. Slides prepared in this way and stored in air at room temperature retained their DNA binding capacity for at least 1 mo.

Fiber hybridization was performed as described by Weier and associates (18). Fiber-FISH mixtures typically consisted of 8 µl Master Mix 2.1, 1 µg Cotl DNA (GIBCO BRL, Life Technologies, Rockville, MD), and 20 to 30 ng of each probe. A biotin-labeled BAC was used to counterstain fibers at a comparatively low concentration, allowing for competitive displacement by the plasmid probes. To ascertain the position of the hybridized probes relative to the BAC vector, a set of five PCR fragments was added to the hybridization mixture. One of the fragments was labeled with FITC (green) and chosen to be off center to the other four labeled with digoxigenin (red), thereby indicating the T7 end of the BAC vector. Images were acquired in a Zeiss fluorescence microscope (Carl Zeiss, Thornwood, NY) equipped with a ×100, 1.3 NA lens, corresponding filters, and a Photometrics CCD camera (Photometrics Ltd., Tuscon, AZ) connected to a Sun SPARC workstation (Sun Microsystems, Palo Alto, CA), as described (19).

Southern Hybridization of Mouse Genomic and PCR-Amplified DNA Fragments

To confirm that the spacing of the genes within the collectin locus was not an artifact of recombination in the BAC library, we performed Southern hybridization of restriction enzyme-digested and PCR-amplified genomic DNA.

129J mouse thymus was digested in sodium dodecyl sulfate- and proteinase K-containing buffer, and genomic DNA was purified by standard phenol-chloroform extraction and ethanol precipitation. A total of 10 µg of DNA, digested with EcoRI, BamHI, and HindIII restriction enzymes, was loaded onto 0.8% agarose gels for electrophoretic separation. Fragments were transferred onto nylon membranes and hybridized to 32P-labeled DNA probes for autoradiography. Probes were obtained from the last exon of each structural gene (SP-A, Mbl1, SP-D) and were 346, 309, and 270 bp, respectively.

PCR reactions using the Expand Long Template PCR System (Boehringer Mannheim) were designed to amplify the regions between the structural genes from mouse genomic and BAC DNA. Oligonucleotides 1 (ACATTCTCTCCACAGTGC, sense) and 3 (GAGAAACTATGTCTCGAGTCCAGC, antisense) were used to span the region between SP-A and Mbl1. Oligonucleotides 4 (ACCATGAGAAGATGCCCTTTTCCA, sense) and 6 (ATGCCCAGGAGATGTGCAAACAGG, antisense) spanned the region between Mbl1 and SP-D (as shown later in Figure 3). Amplified products were separated by agarose gel electrophoresis, blotted onto nylon membranes and hybridized to 32P end-labeled oligonucleotides derived from BAC subclone sequences (oligonucleotides 2 and 5; as discussed later with Figure 3). Hybridized blots were then analyzed with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).


View larger version (32K):
[in this window]
[in a new window]
 
Figure 3.   BAC DNA fiber-FISH. DNA probes designed from sequences matching the 5' (labeled red with rhodamine) and 3' (labeled green with FITC) ends of SP-A (A1/A2), Mbl1 (M1/M2), and SP-D (D1/D2) genes were hybridized to BAC 2 DNA (counterstained blue with AMCA). Separate probes for BAC vector sequences in red are interrupted by an eccentric green dot indicating the T7 end of the vector. SP-A lies at the Sp-6 end of the BAC insert and in the same orientation as Mbl1 gene (a). Mbl1 and SP-D genes lie in opposite orientation, 3' to 3' (b).

    Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Chromosome FISH

To confirm the localization of mouse SP-A (10) and SP-D (11) genes on chromosome 14, we performed FISH on a C57BL/6J mouse chromosome spread, using labeled SP-A and SP-D genomic clones as probes (Figure 1). Both SP-A and SP-D probes hybridized to the same region of chromosome 14, identified by its DAPI banding pattern. No cross-hybridization of either probe was observed with chromosomes other than 14. 


View larger version (24K):
[in this window]
[in a new window]
 
Figure 1.   Mouse choromosome FISH. DNA fragments from SP-A (a) and SP-D (c) genes were labeled with digoxigenin-1-dUTP and hybridized to propidium oxide-counterstained chromosomes in metaphase isolated from mouse fetal fibroblasts. Hybridization was detected with anti-digoxigenin-fluorescein Fab fragments. Metaphase chromosomes are shown DAPI-stained (b and d).

BAC Clones

Screening of a mouse chromosome 14 BAC library with SP-A and SP-D cDNAs yielded two positive clones. BAC1 hybridized to SP-A, and BAC2 hybridized to both cDNAs. BACs 1 and 2 were sized by pulse-field gel electrophoresis and found to be about 70 and 160 kb, respectively (not shown). To confirm that these clones did contain mouse SP-A and SP-D genes, and to ascertain whether they might include Mbl1 gene, PCR reactions were run. Gene-specific primer pairs were designed to amplify regions of the CRD domain of each gene. The CRD fragments of all three genes were amplified in BAC2, indicating that BAC2 contained all three genes. Only the SP-A CRD fragment was amplified from the BAC1 template. Sequencing of the ends of BAC1 and Southern hybridization of restriction fragments demonstrated that BAC1 ended between exons III and IV of Mbl1. Thus, BAC1 lacked the SP-D gene and exons IV and V of Mbl1.

All three genes within BAC2 were mapped using Southern blotting of overlapping restriction fragments and sequencing of selected subclones. This approach allowed us to "walk" along the BAC2 clone and generate the physical map of the mouse collectin cluster presented in Figure 2. Only the restriction sites that were used for subcloning are shown. A distance of 15 to 16 kb separated SP-A from Mbl1, and 12 to 13 kb separated Mbl1 from SP-D. SP-A and Mbl1 were in the same orientation. The SP-D gene was in the opposite orientation, 3' end to 3' end with the Mbl1 gene. Data obtained from the overlapping region of the two BAC clones were in exact agreement. Further, there were no discrepancies noted in gene organization, restriction maps, or partial sequences between BAC and our isolated genomic clones (SP-A and SP-D), or between BAC and published data (SP-A [14] and Mbl1 [12]).


View larger version (8K):
[in this window]
[in a new window]
 
Figure 2.   Organization of the mouse collectin gene locus. Exons are shown as filled rectangles. First and last exons for each of the three genes are indicated by corresponding roman numerals. Restriction sites (B = BamHI; C = ClaI; H = HindIII; N = NheI; R = EcoRI; S = SacI; X = XhoI) used for the generation of overlapping clones and probes used in the fiber-FISH are shown and labeled A1/A2 (hybridizing to SP-A), M1/M2 (hybridizing to Mbl1), and D1/D2 (hybridizing to SP-D). Oligonucleotides used in the Southern hybridization of BAC DNA fragments are shown by asterisks, and those used in the PCR are numbered 1 to 6. Lambda phage clones isolated for SP-A and SP-D gene characterization are indicated. A 5-kb scale is shown.

Fiber-FISH of BAC Clones

Confirmation of the physical map of the mouse collectin gene cluster derived from our Southern mapping of BAC2 was obtained by fiber-FISH. In this technique, BAC DNA is stretched and fixed onto prepared glass slides (see MATERIALS AND METHODS), then hybridized to fluorescently labeled DNA fragments. DNA probes were chosen from subclones of the BAC that mapped to each of the three collectin genes 5' and 3' ends, thereby designated A1 and A2, M1 and M2, and D1 and D2, respectively. Figure 3 shows examples of the hybridization results. The pattern we observed recapitulated the information schematically presented in Figure 2 and visually confirmed the overall spacing and orientation of the three genes. In addition, fiber-FISH illustrated the position of the gene cluster relative to the ends of each BAC clone. One end of BAC2 extended 5 to 10 kb upstream of the 5' end of the SP-A gene (Figure 3a), and its other end extended about 100 kb beyond the 5' end of the SP-D gene (Figure 3b). BAC1, which was less than half the size of BAC2, spanned a region extending from the middle of the MBl1 gene to 40 to 60 kb 5' of the SP-A gene (not shown). Together, these two overlapping clones covered approximately 200 kb of DNA and included the currently known genes of the mouse collectin locus on chromosome 14.

Southern Hybridization of Genomic DNA and PCR Products

To ensure that this collectin gene cluster was not an artifact of the BAC library, we performed comparative Southern hybridization of BAC and genomic DNA fragments (Figure 4) and of PCR-amplified genomic DNA (Figure 5).


View larger version (82K):
[in this window]
[in a new window]
 
Figure 4.   Southern hybridization of genomic DNA. 32P-labeled DNA probes matching sequence from the CRDs of SP-A (a), Mbl1 (b), and SP-D (c) genes were hybridized to mouse thymus genomic DNA digested with BamHI (1), EcoRI (2), and HindIII (3) before autoradiography, as shown. The size of the fragments matches the map of the corresponding regions constructed from BAC DNA.


View larger version (52K):
[in this window]
[in a new window]
 
Figure 5.   Southern hybridization of PCR-amplified DNA. Oligonucleotide pairs 1/3 and 4/6 (see Figure 3) were used to amplify regions of the BAC DNA (lane 1) and genomic (lane 2) DNA. Hybridization to a DNA fragment probing the regions between SP-A and Mbl1 (a) and between Mbl1 and SP-D (b) are shown. The size of amplified products was identical across templates and matched that predicted by BAC mapping.

Figure 4 shows the size of hybridized restriction fragments using gene-specific CRD probes. Probes hybridized to single fragments of predicted size. Figure 5 shows a Southern blot of PCR-amplified DNA. Both genomic and BAC DNA were used as templates for comparison. Oligonucleotides 1 and 3 were used to amplify the region between SP-A and Mbl1, and oligonucleotides 4 and 6 the region between Mbl1 and SP-D. Hybridization probes for each of the intergenic regions were oligonucleotides 2 and 5, respectively. Amplified products spanning the region between SP-A and Mbl1 and between Mbl1 and SP-D genes showed unique hybridization products of the predicted size (Figures 5a and 5b). Together, these data show that no recombination occurred in the BAC clones in the region of the mouse collectin locus we characterized.

Mouse SP-D Gene

Screening of a mouse 129SVJ genomic library with a 32P-labeled SP-D cDNA fragment yielded a 16-kb clone. This clone was found to extend 7 kb 5' of the first exon of the SP-D gene but to lack the last two exons. The remainder of the SP-D gene was isolated from a HindIII restriction fragment subcloned from BAC2 (Figure 2). Using information from Southern mapping of restriction enzyme fragments and sequencing of selected fragments, we were able to generate a complete physical map of the gene (Figure 2 and Table 1). The first exon of the gene was untranslated, and extrapolation from the RACE-PCR of the SP-D cDNA (not shown) showed it to be just 25 bp long. This is similar to the size of the first untranslated exon of the rat and human genes (20).

                              
View this table:
[in this window]
[in a new window]
 

TABLE 1
Mouse SP-D gene organization

A putative TATA box (CATAAA) was found at position -31, similar to the rat and human genes (Figure 6). Unlike the human gene, the mouse and rat genes contained a CCAAT sequence at position -63. Whether this sequence represents a functional CCAAT box is unknown. A putative activator protein (AP)-1 binding site is present in all three species (position -139, Figure 6). The second exon (199 bp) contained the translation start site, signal peptide, N-terminal region, and the beginning of the collagenous domain, a pattern observed in all collectin genes described. Exons III, IV, V, and VI were all equal in size (117 bp) and encoded the remainder of the collagenous domain. Exon VII (84 bp) encoded the helical coiled-coil neck region of the protein, and exon VIII (500 bp) encoded the CRD and the 3' untranslated region. The mouse SP-D gene was similar in its organization and overall size (13 kb) to human SP-D (15) and to conglutinin (21), a bovine collectin that shares close structural homology with SP-D. As in human SP-D, all introns were in phase 1 (Table 1). The size of introns varied between the two species; in particular, intron 2 was significantly larger in the mouse than it is in the human.


View larger version (16K):
[in this window]
[in a new window]
 
Figure 6.   SP-D promoter region. Sequences from the promoter region of human SP-D, rat SP-D, and mouse SP-D genes were aligned. The transcription start site as mapped for the human gene is indicated by an arrow. The TATA box is outlined. CCAAT and potential AP-1 elements are underlined.

    Discussion
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The collectins are a small family of structurally homologous proteins found in serum and on mucosal surfaces of the lung and gastrointestinal tract (22). Genes for several members of this protein family have been described and characterized in a variety of mammalian species. The human genes for three of the collectins---SP-A, SP-D, and Mbl---are located on the long arm of chromosome 10 (23- 25). The corresponding mouse genes are located on chromosome 14 (10, 12). Using a BAC clone containing all three of these genes and a partial-length mouse SP-D genomic clone, we have characterized the structure of the mouse SP-D gene and mapped the mouse collectin locus.

The mouse collectin gene cluster is remarkably compact, extending over just 55 kb of genomic DNA. Recently, Hoover and Floros used radiation hybrid mapping to characterize the syntenic human collectin gene locus on chromosome 10 (9). Their results suggest that the collectin locus is comprised of at least two structural SP-A genes, an SP-A pseudogene, and the SP-D gene. The distance separating SP-A and SP-D genes in the mouse is similar to the distance separating SP-A2 and SP-D genes in humans (63 kb). In the mouse, two Mbl structural genes have been characterized (12). As we have shown, Mbl1 lies between SP-A and SP-D on chromosome 14, whereas Mbl2 is not found in this locus but lies instead on chromosome 19 (26). In the human, a single Mbl structural gene and an Mbl pseudogene have been identified (8), both located on chromosome 10. The human Mbl structural gene is most homologous to mouse Mbl2 (27) and was located by Hoover and Floros 25,000 to 35,000 kb from SP-D (9). The human Mbl pseudogene, which is most homologous to Mbl1, has not been precisely mapped in relation to the other collectin genes on chromosome 10. It will be of interest to determine whether the human Mbl pseudogene resides between SP-A and SP-D, in a manner analogous to Mbl1 in the mouse.

The structure of the mouse SP-D gene is similar to the gene for human SP-D (15) and closely related to the organization of the other collectin genes. The first translated exon, exon II, contains three nucleotides of the 5' untranslated region (UTR) and encodes the signal peptide, the N-terminal region, and the first seven triplet amino-acid repeats of the collagenous domain. This hybrid exon is found in all collections (12, 14, 15, 21), although the length of the encoded N-terminal region varies. The small stretch of hydrophilic collagenous domain included in this exon is highly conserved between collectins and has been proposed as a candidate sequence for recognition by collectin receptors (28). The remainder of the mouse SP-D collagenous domain is encoded in four additional exons, each 117 bp in length. This arrangement also exists in human SP-D gene (15). In both species, the collagenous intron-exon transition splits the Gly codon of a Gly-Xaa-Yaa triplet after the first base. Crouch and coworkers have suggested that this pattern might confer an evolutionary advantage by preserving the integrity of collagen triplets, and have proposed that the collagenous domain in SP-D evolved from a duplication of a primitive 117-bp element (15). Immediately following the collagen-like domain is the helical coiled-coil neck region encoded by exon VII. This domain may be important in the initial alignment and subsequent formation of trimers, a structural hallmark of collectins (29). The last exon, exon VIII, encodes for the entire CRD and 3' UTR. Although the gene organization of SP-D is similar to that of SP-A (14) and Mbl1 (12), its size is significantly greater than that of the other two collectins in the locus, due in part to the length of the collagen-like domain and the first two introns.

Rust and colleagues previously reported the characterization of the human SP-D promoter (20). Using primer extension and 5' RACE-PCR, they identified the transcription initiation site. Sequencing of the upstream region showed consensus sites for a TATA box and an AP-1 element. By aligning sequences from the mouse, rat, and human SP-D promoter regions, consensus sequences were clearly evident in the mouse sequence (Figure 6). In addition, a CCAAT sequence occurs about 30 bp upstream of the TATA box in both mouse and rat. Whether this element represents a fully functional CCAAT box in rodents is not known. As in the rat but not the human, a string of 20-dinucleotide GT repeats is found in the mouse SP-D promoter. The biologic significance, if any, of such repeats is still poorly understood, although they may modulate the binding of nuclear proteins (30).

The spatial clustering of collectin genes and the similarity of their respective gene organization supports the hypothesis that this gene family evolved from a common ancestral gene (31). SP-A-like and MASP-like molecules have been described in fish (32) and ascidians (33), respectively, tracing the presence of collectins back to the origin of vertebrates. It remains unknown whether SP-D or SP-D-like molecules exist in these early vertebrate species. The serum collectins have been implicated in innate defense as opsonins or activators of immune response. Mbl activates the lectin complement pathway (4, 34) and bovine serum conglutinin agglutinates cells or particles opsonized with iC3b (6), further linking these two molecules to the innate immune response. The role of the lung collectins in immune defense is less well established. Both SP-A and SP-D bind a variety of microorganisms in vitro, and they variably enhance phagocytosis by macrophages or neutrophils (reviewed in [7]). Patients with inflammatory (35) or infectious lung processes (36) show altered levels of collectins in their tracheal aspirates, and mice lacking SP-A clear group B streptococcus bacteria from the lung slowly and are prone to systemic spread of the organism (37). Because SP-A (38) and more recently SP-D (39) have also been implicated in the maintenance of surfactant pools, the lung collectins may participate in a more complex array of biologic events involving both lung immunity and surfactant homeostasis. Further study of these molecules in vitro and in transgenic animals may elucidate the functions of this ancient protein family.

    Footnotes

Address correspondence to: Francis Poulain, M.D., Cardiovascular Research Institute, University of California San Francisco, San Francisco, CA 94118-1245. E-mail: poulain{at}itsa.ucsf.edu

(Received in original form February 2, 1999 and in revised form March 8, 1999).

Abbreviations: activator protein, AP; bacterial artificial chromosome, BAC; base pair(s), bp; complementary DNA, cDNA; carbohydrate-recognition domain, CRD; 4,6-diamidino-2-phenylindole, DAPI; deoxycytidine triphosphate, dCTP; deoxyuridine triphosphate, dUTP; FISH of fiber-stretched DNA, fiber-FISH; fluorescent in situ hybridization, FISH; fluorescein isothiocyanate, FITC; mannose-binding lectin, MBl; polymerase chain reaction, PCR; rapid amplification of cDNA ends, RACE; surfactant protein, SP.

Acknowledgments: This work was supported by grants HL-02834, HL-58047, and HL-24075 from the National Heart Lung and Blood Institute, and by the University of California Biotechnology and Education Program (S96-03).
    References
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Thiel, S., and K. B. Reid. 1989. Structures and functions associated with the group of mammalian lectins containing collagen-like sequences. FEBS Lett. 250: 78-84 [Medline].

2. Epstein, J., Q. Eichbaum, S. Sheriff, and R. A. Ezekowitz. 1996. The collectins in innate immunity. Curr. Opin. Immunol. 8: 29-35 [Medline].

3. Lu, J. H., S. Thiel, H. Wiedemann, T. Timpl, and K. B. Reid. 1990. Binding of the pentamer/hexamer forms of mannan-binding protein to zymosan activates the proenzyme Clr2Cls2 complex, of the classical pathway of complement, without involvement of Clq. J. Immunol. 144: 2287-2294 [Abstract].

4. Matsushita, M., and T. Fujita. 1992. Activation of the classical complement pathway by mannose-binding protein in association with a novel Cls-like serine protease. J. Exp. Med 176: 1497-1502 [Abstract/Free Full Text].

5. Sato, T., Y. Endo, M. Matsushita, and T. Fujita. 1994. Molecular characterization of a novel serine protease involved in activation of the complement system by mannose-binding protein. Int. Immunol. 6: 665-669 [Abstract/Free Full Text].

6. Laursen, S. B., S. Thiel, B. Teisner, U. Holmskov, Y Wang, R. B. Sim, and J. C. Jensenius. 1994. Bovine conglutinin binds to an oligosaccharide determinant presented by iC3b, but not by C3, C3b or C3c. Immunology 81: 648-654 [Medline].

7. Wright, J. R.. 1997. Immunomodulatory functions of surfactant. Physiol. Rev. 77: 931-962 [Abstract/Free Full Text].

8. Guo, N., T. Mogues, S. Weremowicz, C. C. Morton, and K. N. Sastry. 1998. The human ortholog of rhesus mannose-binding protein-A gene is an expressed pseudogene that localizes to chromosome 10.  Mamm. Genome 9: 246-249 [Medline].

9. Hoover, R. R., and J. Floros. 1998. Organization of the human SP-A and SP-D loci at 10q22-q23. Physical and radiation hybrid mapping reveal gene order and orientation. Am. J. Respir. Cell Mol. Biol. 18: 353-362 [Abstract/Free Full Text].

10. Moore, K. J., M. A. D'Amore-Bruno, T. R. Korfhagen, S. W. Glasser, J. A. Whitsett, N. A. Jenkins, and N. G. Copeland. 1992. Chromosomal localization of three pulmonary surfactant protein genes in the mouse. Genomics 12: 388-393 [Medline].

11. Motwani, M., R. A. White, N. Guo, L. L. Dowler, A. I. Tauber, and K. N. Sastry. 1995. Mouse surfactant protein-D. cDNA cloning, characterization, and gene localization to chromosome 14.  J. Immunol. 155: 5671-5677 [Abstract].

12. Sastry, R., J. S. Wang, D. C. Brown, R. A. Ezekowitz, A. I. Tauber, and K. N. Sastry. 1995. Characterization of murine mannose-binding protein genes Mbl1 and Mbl2 reveals features common to other collectin genes. Mamm. Genome 6: 103-110 [Medline].

13. Wong, C. J., J. Akiyama, L. Allen, and S. Hawgood. 1996. Localization and developmental expression of surfactant proteins A and D in the respiratory tract of the mouse Pediatr. Res. 39: 930-937 [Medline].

14. Korfhagen, T. R., M. D. Bruno, S. W. Glasser, P. J. Ciraolo, J. A. Whitsett, D. L. Lattier, K. A. Wikenheiser, and J. C. Clark. 1992. Murine pulmonary surfactant SP-A gene: cloning, sequence, and transcriptional activity. Am. J. Physiol. 263(Lung Cell. Mol. Physiol. 7):L546-L554.

15. Crouch, E. C., K. Rust, R. Veile, H. Donis-Keller, and L. Grosso. 1993. Genomic organization of human surfactant protein D (SP-D): SP-D is encoded on chromosome 10q22.2-23.1. J. Biol. Chem. 268: 2976-2983 [Abstract/Free Full Text].

16. Shi, Y. P., T. T. Huang, E. J. Carlson, and C. J. Epstein. 1994. The mapping of transgenes by fluorescence in situ hybridization on G-banded mouse chromosomes. Mamm. Genome 5: 337-341 [Medline].

17. Yokota, H., F. Johnson, H. Lu, R. M. Robinson, A. M. Belu, M. D. Garrison, B. D. Ratner, B. J. Trask, and D. L. Miller. 1997. A new method for straightening DNA molecules for optical restriction mapping. Nucleic Acids Res. 25: 1064-1070 [Abstract/Free Full Text].

18. Weier, H., U. M. Wang, J. C. Mullikin, Y. Zhu, J. F. Cheng, K. M. Greulich, A. Bensimon, and J. W. Gray. 1995. Quantitative DNA fiber mapping. Hum. Mol. Genet. 4: 1903-1910 [Abstract/Free Full Text].

19. Weier, H. U., A. P. Rhein, F. Shadravan, C. Collins, and D. Polikoff. 1995. Rapid physical mapping of the human trk protooncogene (NTRK1) to human chromosome 1q21-q22 by P1 clone selection, fluorescence in situ hybridization (FISH), and computer-assisted microscopy. Genomics 26: 390-393 [Medline].

20. Rust, K., L. Bingle, W. Mariencheck, A. Persson, and E. C. Crouch. 1996. Characterization of the human surfactant protein D promoter: transcriptional regulation of SP-D gene expression by glucocorticoids. Am. J. Respir. Cell Mol. Biol. 14: 121-130 [Abstract].

21. Liou, L. S., R. Sastry, K. L. Hartshorn, Y. M. Lee, T. B. Okarma, A. I. Tauber, and K. N. Sastry. 1994. Bovine conglutinin gene exon structure reveals its evolutionary relationship to surfactant protein-D. J. Immunol. 153: 173-180 [Abstract].

22. Hoppe, H. J., and K. B. Reid. 1994. Collectins---soluble proteins containing collagenous regions and lectin domains---and their roles in innate immunity. Protein Sci. 3: 1143-1158 [Medline].

23. Bruns, G., H. Stroh, G. M. Veldman, S. A. Latt, and J. Floros. 1987. The 35 kd pulmonary surfactant-associated protein is encoded on chromosome 10.  Hum. Genet. 76: 58-62 [Medline].

24. Kolble, K., J. Lu, S. E. Mole, S. Kaluz, and K. B. Reid. 1993. Assignment of the human pulmonary surfactant protein D gene (SFTP4) to 10q22-q23 close to the surfactant protein A gene cluster. Genomics 17: 294-298 [Medline].

25. Sastry, K., G. A. Herman, L. Day, E. Deignan, G. Bruns, C. C. Morton, and R. A. Ezekowitz. 1989. The human mannose-binding protein gene: exon structure reveals its evolutionary relationship to a human pulmonary surfactant gene and localization to chromosome 10.  J. Exp. Med. 170: 1175-1189 [Abstract/Free Full Text].

26. White, R. A., L. L. Dowler, L. R. Adkison, R. A. Ezekowitz, and K. N. Sastry. 1994. The murine mannose-binding protein genes (Mbl 1 and Mbl 2) localize to chromosomes 14 and 19.  Mamm. Genome 5: 807-809 [Medline].

27. Mogues, T., T. Ota, A. I. Tauber, and K. N. Sastry. 1996. Characterization of two mannose-binding protein cDNAs from rhesus monkey (Macaca mulatta): structure and evolutionary implications. Glycobiology 6: 543-550 [Abstract/Free Full Text].

28. Rust, K., L. Grosso, V. Zhang, D. Chang, A. Persson, W. Longmore, G. Z. Cai, and E. Crouch. 1991. Human surfactant protein D: SP-D contains a C-type lectin carbohydrate recognition domain. Arch. Biochem. Biophys. 290: 116-126 [Medline].

29. Hoppe, H. J., P. N. Barlow, and K. B. Reid. 1994. A parallel three stranded alpha-helical bundle at the nucleation site of collagen triple-helix formation. FEBS Lett. 344: 191-195 [Medline].

30. Epplen, J. T., A. Kyas, and W. Maueler. 1996. Genomic simple repetitive DNAs are targets for differential binding of nuclear proteins. FEBS Lett. 389: 92-95 [Medline].

31. Drickamer, K., and V. McCreary. 1987. Exon structure of a mannose-binding protein gene reflects its evolutionary relationship to the asialoglycoprotein receptor and nonfibrillar collagens. J. Biol. Chem. 262: 2582-2589 [Abstract/Free Full Text].

32. Sullivan, L. C., C. B. Daniels, I. D. Phillips, S. Orgeig, and J. A. Whitsett. 1998. Conservation of surfactant protein A: evidence for a single origin for vertebrate pulmonary surfactant. J. Mol. Evol. 46: 131-138 [Medline].

33. Ji, X., K. Azumi, M. Sasaki, and M. Nonaka. 1997. Ancient origin of the complement lectin pathway revealed by molecular cloning of mannan binding protein-associated serine protease from a urochordate, the Japanese ascidian, Halocynthia roretzi. Proc. Natl. Acad. Sci. USA 94: 6340-6345 [Abstract/Free Full Text].

34. Ikeda, K., T. Sannoh, N. Kawasaki, T. Kawasaki, and I. Yamashina. 1987. Serum lectin with known structure activates complement through the classical pathway. J. Biol. Chem. 262: 7451-7454 [Abstract/Free Full Text].

35. Hamm, H., J. Luhrs, J. Guzman y Rotaeche, U. Costabel, H. Fabel, and W. Barsch. 1994. Elevated surfactant protein A in bronchoalveolar lavage fluids from sarcoidosis and hypersensitivity pneumonitis patients. Chest 106: 1766-1770 [Abstract/Free Full Text].

36. Hull, J., M. South, P. Phelan, and K. Grimwood. 1997. Surfactant composition in infants and young children with cystic fibrosis. Am. J. Respir. Crit. Care Med. 156: 161-165 [Abstract/Free Full Text].

37. LeVine, A. M., M. D. Bruno, K. M. Huelsman, G. F. Ross, J. A. Whitsett, and T. R. Korfhagen. 1997. Surfactant protein A-deficient mice are susceptible to group B streptococcal infection. J. Immunol. 158: 4336-4340 [Abstract].

38. Wright, J. R. 1990. Clearance and recycling of pulmonary surfactant. Am. J. Physiol. 259(Lung Cell. Mol. Physiol. 3):L1-L12.

39. Botas, C., F. R. Poulain, J. Akiyama, C. Brown, L. Allen, J. Goerke, J. A. Clements, E. Carlson, A. M. Gillespie, C. Epstein, and S. Hawgood. 1998. Altered surfactant homeostasis and alveolar type II cell morphology in mice lacking surfactant protein D.  Proc. Natl. Acad. Sci. USA 95: 11869-11874 [Abstract/Free Full Text].

40. Poulain, F. R., J. Akiyama, L. Allen, C. Brown, R. Chang, J. Georke, L. Dobbs, and S. Hawgood. Ultrastructure of phospholipid mixtures reconstituted with surfactant proteins B and D. Am. J. Respir. Cell Mol. Biol. 20:1049-1058.





This article has been cited by other articles:


Home page
Am. J. Respir. Crit. Care Med.Home page
J. Casey, J. Kaplan, E. N. Atochina-Vasserman, A. J. Gow, H. Kadire, Y. Tomer, J. H. Fisher, S. Hawgood, R. C. Savani, and M. F. Beers
Alveolar Surfactant Protein D Content Modulates Bleomycin-induced Lung Injury
Am. J. Respir. Crit. Care Med., October 1, 2005; 172(7): 869 - 877.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
C. M. Hogaboam, K. Takahashi, R. A. B. Ezekowitz, S. L. Kunkel, and J. M. Schuh
Mannose-binding lectin deficiency alters the development of fungal asthma: effects on airway response, inflammation, and cytokine profile
J. Leukoc. Biol., May 1, 2004; 75(5): 805 - 814.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Hawgood, M. Ochs, A. Jung, J. Akiyama, L. Allen, C. Brown, J. Edmondson, S. Levitt, E. Carlson, A. M. Gillespie, et al.
Sequential targeted deficiency of SP-A and -D leads to progressive alveolar lipoproteinosis and emphysema
Am J Physiol Lung Cell Mol Physiol, November 1, 2002; 283(5): L1002 - L1010.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Palaniyar, L. Zhang, A. Kuzmenko, M. Ikegami, S. Wan, H. Wu, T. R. Korfhagen, J. A. Whitsett, and F. X. McCormack
The Role of Pulmonary Collectin N-terminal Domains in Surfactant Structure, Function, and Homeostasis in Vivo
J. Biol. Chem., July 19, 2002; 277(30): 26971 - 26979.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
T. R. Korfhagen
Surfactant Protein A (SP-A)-Mediated Bacterial Clearance . SP-A and Cystic Fibrosis
Am. J. Respir. Cell Mol. Biol., December 1, 2001; 25(6): 668 - 672.
[Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Hawgood, J. Akiyama, C. Brown, L. Allen, G. Li, and F. R. Poulain
GM-CSF mediates alveolar macrophage proliferation and type II cell hypertrophy in SP-D gene-targeted mice
Am J Physiol Lung Cell Mol Physiol, June 1, 2001; 280(6): L1148 - L1156.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Akiyama, J.
Right arrow Articles by Poulain, F. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Akiyama, J.
Right arrow Articles by Poulain, F. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 1999 American Thoracic Society.