|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
Abstract |
|---|
|
|
|---|
Pulmonary surfactant protein-A (SP-A) has been reported to regulate the uptake and secretion of surfactant by alveolar type II cells, to stabilize large surfactant aggregates including tubular myelin, and to protect the surface activity of surfactant from protein inhibitors. In this study we investigated the consequences of overexpression of SP-A on pulmonary homeostasis and surfactant function in transgenic mice. The human SP-C promoter was used to direct synthesis of rat surfactant protein A (rSP-A) in alveolar type II cells and nonciliated bronchiolar cells of the distal respiratory epithelium. Levels of SP-A measured through enzyme-linked immunosorbent assay were 7- to 8-fold higher in lung homogenates and alveolar lavage fluid of the rSP-A mice than in those of transgene-negative littermates. The swimming exercise tolerance and lung compliance of mice bearing the transgene were unchanged. Mean air space sizes seen in randomly selected light-microscopic fields were not significantly different in the transgene-positive and -negative mice by morphometric analysis, but 15% of transgenic animals had scattered foci containing dilated alveoli and alveolar ducts without evidence of inflammation or fibrosis. Some alveolar macrophages contained bar-shaped osmophilic inclusions that had a highly ordered ultrastructure. There were no differences between the transgene-positive and -negative mice in the tissue or alveolar pool sizes of saturated phosphatidylcholine or in the large-aggregate composition of alveolar surfactant. The surface activity of surfactant isolated from the rSP-A mice was similar to that of the controls, but in the presence of protein inhibitors, the surface tension-reducing properties of the rSP-A surfactant were better preserved (P < 0.05). We conclude that overexpression of SP-A does not affect resting surfactant phospholipid levels, but that it enhances the resistance of surfactant to protein inhibition.
| |
Introduction |
|---|
|
|
|---|
The primary function of pulmonary surfactant, a mixture of phospholipids and proteins produced by alveolar type II cells and bronchiolar cells, is to reduce surface tension forces in the lung and stabilize pulmonary alveoli (1). The surface-active properties of surfactant are attributable to the assembly of a noncompressible film of saturated phosphatidylcholine (satPC) at the alveolar air-liquid interface. The surfactant proteins are thought to play important roles in the assembly and integrity of the surfactant membrane (2). Surfactant protein A (SP-A) is an oligomeric, Ca2+-dependent phospholipid-binding glycoprotein that is intimately associated with surfactant lipids in the alveolar space (2). SP-A has been reported to maintain the stability and/or structure of large surfactant aggregates, including the latticelike array tubular myelin (7, 8), and to preserve the surface activity of the surfactant film in the presence of protein inhibitors (9, 10). The binding of SP-A to a high-affinity SP-A receptor on the surface of isolated alveolar type II cells results in inhibition of surfactant secretion and increased surfactant uptake, suggesting that SP-A may regulate the intraalveolar levels of surfactant phospholipids (11). However, targeted disruption of the murine SP-A gene did not affect surfactant pool sizes or lung compliance in resting mice (8). Isolated surfactant from the SP-A-null mouse was susceptible to inhibition by serum proteins, and was more easily depleted of large surfactant aggregates when subjected to cyclical expansion and compression at an air-liquid interface in vitro (14). The recent recognition that SP-A has host defense properties (15, 16), and the finding of discrepancies between the in vitro and in vivo experimental surfactant functions of SP-A, have generated controversy about the fundamental physiologic importance of SP-A in the air space.
To investigate the roles of SP-A in pulmonary homeostasis in vivo, we overexpressed rat SP-A in transgenic mice and performed histologic, physiologic, biochemical, and surfactant functional analyses.
| |
Materials and Methods |
|---|
|
|
|---|
Transgene Construction and Development of Transgenic Animals
A rat SP-A (rSP-A) transgene was constructed by ligating
a full-length, 1.6-kb complementary DNA (cDNA) for
rSP-A (17) into the unique EcoR1 site of the 3.7 kb human
SP-C (hSP-C) plasmid (gift of J. Whitsett and S. Glasser,
Children's Hospital, Cincinnati, OH) (18), downstream from
the hSP-C promoter. In this construct, sequences encoding
the SV40/small T intron and polyadenine (poly A) present
in the plasmid are positioned at the 3' end of the gene.
Proper orientation of the SP-A insert was confirmed with BamH1, and nonessential elements of the plasmid were
removed by digestion with Nde1 and Not1. The hSP-C/
rSP-A DNA fragment was purified by agarose gel electrophoresis, phenol/chloroform extraction, and ethanol precipitation, and was injected into the pronuclei of fertilized
FVB/N mouse eggs. The eggs were then implanted into the wombs of pseudopregnant female FVB/N mice. Transgenic progeny were identified by amplification through
the polymerase chain reaction (PCR) of DNA in ear clips
digested with detergent (0.45% Tween and 0.45% NP 40)
and proteinase K (1 mg/ml). The 5' PCR primer was complementary to nucleotides 307-335 (AACGTGGAGACAAGGGAGAGCC), and the 3' primer was complementary
to nucleotides 1,193-1,172 (GACACCGAGCTACAGAAGGGTG) of the rSP-A cDNA. Control primers amplified a 400-bp endogenous mouse thyrotropin-stimulating
hormone
(THS
) sequence. Founder lines and germ-line transmission were also confirmed by Southern blot
analysis. Briefly, tail clips (0.5-1 cm) were digested overnight at 55°C in buffer containing 50 mM Tris, 100 mM
ethylenediaminetetraacetic acid (EDTA), 0.5% sodium dodecylsulfate (SDS), and 100 µg/ml proteinase K. Tail DNA
was phenol/chloroform extracted, digested with EcoR1,
size-fractionated through agarose gel electrophoresis, and
transferred to nitrocellulose membranes by capillary action. The DNA was crosslinked to the membrane with ultraviolet (UV) light, and was blocked with prehybridization solution at 65°C. 32P-labeled probe was synthesized
with the 0.75-kb Pst 1 fragment from the cDNA for rSP-A
as the template and a random-primer labeling kit (Prime-It II Random Primer labeling Kit; Stratagene, La Jolla, CA). The membrane was hybridized with the probe overnight at 65°C, washed three times with 20 mM Na2HPO4, 1 mM EDTA, 1% SDS, and placed on film. All animals
were housed in positively ventilated microisolator cages
with automatically recirculating water, located in a room
with laminar flow of high-energy particulate air-filtered air. The animals received autoclaved food, water, and bedding.
Northern Blot Analysis of Transgenic Mice
The expression of rSP-A messenger RNA (mRNA) in transgenic mice was verified by Northern blot analysis. Northern blots containing 15 µg of total mRNA purified by acid phenol extraction of lung homogenates (Trizol; GIBCO; Grand Island, NY) were prehybridized at 65°C for 1 h in 15% formamide. The blots were then hybridized for 20 h under the same conditions with a 32P-labeled probe containing the Pst 1 fragment of rSP-A cDNA (17). Filters were washed with 20 mM Na2HPO4, 1 mM EDTA, 1% SDS for 30 min at 65°C, and were then exposed to film.
Histologic, Immunohistochemical, and Morphometric Analyses
Mice were killed with an overdose of pentobarbital and exsanguinated by transection of the abdominal aorta. The lungs were infused via an intratracheal catheter at a controlled pressure of 25 cm H2O with modified Karnovsky's fixative containing 2.0% glutaraldehyde, 2% paraformaldehyde, and 0.1% CaCl2 in 0.1 M sodium cacodylate buffer. The lungs were removed, paraffin embedded, sectioned with a microtome, and stained with hematoxylin and eosin (H&E). For electron microscopy of the lung, the tissue was inflation-fixed, stained with 1% osmium tetroxide, embedded in Eponate, and examined with a JEOL 100 CX instrument (JEOL, Tokyo, Japan). Ultrastructural analyses of alveolar macrophages and tubular myelin were done on specimens of bronchoalveolar lavage fluid that were centrifuged at 100 × g and 14,000 × g, respectively. Immunostaining for SP-A was done with a protein A-purified, serum-adsorbed, anti-rSP-A polyclonal antibody at a concentration of 4 µg/ml (4). Morphometric analyses were done by measuring mean linear intercepts (Lm) on a 2,750-µ grid as an index of air space size (19). Lm was calculated for each mouse from 10 random fields on the grid at a magnification of ×500. The values reported are means and SDs of intercepts between alveolar walls and the grid, determined by a reader who was blinded to the genotypes of the animals. Data were analyzed with the general linear model in the Statistical Analysis System (SAS Inc., Cary, NC), and values of P < 0.05 were accepted as significant.
Analysis of Surfactant Components
Mice (6-12 wk) were anesthetized with an overdose of pentobarbital, exsanguinated by aortic transection, and intubated with an 18-gauge catheter through an incision in the exposed trachea. Alveolar lavage was done with three cycles of instillation and gentle aspiration of 1 ml saline each, repeated five times (total = 5 ml saline) for each animal. The volume of the recovered lavage fluid was recorded, and the postlavage lungs were homogenized in saline. SP-A in the lavage fluid and homogenates was measured with an enzyme-linked immunosorbent assay (ELISA), as described (20). Large- (LA) and small-aggregate (SA) surfactant were separated by centrifugation over a 0.8 M sucrose cushion. SatPC was isolated by chloroform/methanol (2:1) extraction of the lung homogenate, alveolar lavage, or LA and SA surfactant (21), followed by oxidation with OsO4 in carbon tetrachloride and alumina-column chromatography (22). Phosphorus in satPC was measured with the Bartlett assay (23). Surface activity was measured with a captive bubble surfactometer (24), using 15 µg of LA surfactant pooled from three mice of the same genotype. Sensitivity to protein inhibition was measured in the presence of 0.93 mg/ml sheep plasma protein applied to the air-water interface of the bubble by microsyringe. Data were expressed as mean ± SD, and were analyzed with the unpaired Student's t test. Values of P < 0.05 were accepted as significant.
Immunoblot Analysis
Proteins in alveolar lavage fluid were size fractionated by electrophoresis on 8-16% SDS-polyacrylamide gels under reducing conditions and transferred to nitrocellulose. For SP-A, membranes were incubated with rabbit anti-rSP-A IgG, followed by horseradish peroxidase (HRP)-conjugated antirabbit IgG as previously described (25). Immunoreactive protein species were visualized through HRP-dependent oxidation of o-phenylenediamine. The polyclonal anti-rSP-A antibody used in this assay (and in the ELISA) recognized both rSP-A and mouse SP-A, with affinities for the two proteins that appeared to be comparable on the basis of immunoblots of mouse and rat lavage prepared with equivalent loads of total lavage protein (not shown). SP-D is another hydrophilic surfactant protein with structural and functional similarities to SP-A. An immunoblot of SP-D in lavage fluid was made with a rabbit anti-rSP-D IgG primary antibody (26). To produce the antibody, a complementary DNA (cDNA) for rSP-D (27) (gift of J. H. Fisher, M.D., University of Colorado) was expressed in insect cells, and recombinant SP-D was purified by maltose- Sepharose affinity chromatography. A New Zealand White rabbit was immunized and boosted with 50 µg purified recombinant SP-D in incomplete Freund's adjuvant over a 3-wk interval. After 1 mo, serum was harvested and the IgG fraction was purified from culture medium by staphylococcal protein A-Sepharose affinity chromatography (Hi Trap; Pharmacia, Piscataway, NJ). The anti-SP-D antibody did not react with rat serum or with SP-A.
Physiologic Characterization of Transgenic Mice
Whole-lung compliance was measured in 8- to 12-wk-old
mice (8). After intraperitoneal injection into each mouse
of an overdose of sodium pentobarbital, the animal's lungs
were degassed in a 100% O2 chamber. The chest wall was
opened to fully deflate the lungs, and the trachea was cannulated and connected to a silicon pressure transducer
(X-ducer; Motorola, Phoenix, AZ). The lungs were inflated with air or saline in 100 µl increments to an airway pressure of 30 cm H2O, and were then deflated to
10 cm
H2O. Airway opening pressure and lung volume were recorded at each inflation and deflation increment. Specific
lung compliance was defined as the ratio of the slope of
the linear portion of the deflation curve (
10 to 10 cm
H2O) and the total body weight of the animal. Compliance
values were expressed as means ± SD and were compared through use of the Mann-Whitney U test. Values of P < 0.01 were accepted as significant. Exercise tolerance was
assessed by placing mice in a 22°C water bath and counting
head submersions that occurred as the swimming animals
became fatigued. Mice were removed from the tank when
their heads dropped below the surface for the eighth time.
Observers were blinded to the genotype of the mice. The mean times to the eighth head submersion for the transgene-negative and -positive groups were compared by one-way analysis of variance (ANOVA) and values of P < 0.01 were accepted as significant. Attrition in the tank test over
the entire course of the experiment was assessed through
log-rank analysis. Values of P < 0.01 were accepted as significant.
| |
Results |
|---|
|
|
|---|
Development of Lines of Transgenic Mice
Promoter sequences from the human SP-C gene were used to construct a chimeric gene directing expression of the rSP-A cDNA in the respiratory epithelial cells of mice (Figure 1A). The SP-C-rSP-A construct was injected into oocytes, which were then transferred to pseudopregnant mothers. After term birth, three founders (rSP-A-1, rSP-A-2, and rSP-A-3) were identified from among 40 total pups through the appearance of a 900-bp band on PCR analysis of genomic DNA (Figure 1B). Transmission of the transgene to F1 progeny was confirmed by the presence of 1.6-kb bands on Southern blotting of EcoR1-digested tail DNA (Figure 1C). Germ-line transmission was documented for the rSP-A-1 and rSP-A-2 lines but not for the rSP-A-3 line, and the latter was not further characterized. The rat SP-A cDNA probe used for Northern blot analysis of total lung RNA reacted with the 0.8 kb mRNA species of endogenous mouse SP-A (Figure 2). In the rSP-A animals there were two intense bands, at 0.8-0.9 kb and 1.6 kb, respectively, which were consistent with the expression of a 0.9-kb rSP-A mRNA (overlying the 0.8-kb mouse RNA band) and a 1.6-kb rSP-A mRNA.
|
|
Rest and Exercise Physiology
All rSP-A mice had a normal appearance, normal resting
respiratory rate, perinatal survival, and normal postnatal
weight gain when compared with nontransgenic littermates (not shown). The physiologic consequences of overexpression of SP-A were determined by examining resting
lung mechanics and exercise tolerance. The total and tissue-specific compliance of the lungs of the rSP-A mice
were determined by recording intratracheal pressures of
air-filled and saline-filled lungs, respectively, through the
linear portion of the deflation curve from +10 to
10 cm
H2O (Table 1). The mean lung compliance of the lungs of
the rSP-A mice inflated with air (4.48 ± 0.37 ml-cm H2O/g,
n = 6) was not significantly different from that of the nontransgenic animals (4.09 ± 0.83 ml-cm H2O/g, n = 5).
There was also no significant difference in the mean tissue-specific lung compliance of saline-inflated transgenic
mouse lungs (6.58 ± 1.26 ml-cm H2O/g, n = 8) and those
of nontransgenic littermates (5.75 ± 0.75 ml-cm H2O/g, n = 7). The swimming exercise tolerance of the rSP-A-2 mice
did not differ from that of their nontransgenic littermates.
The time required for half of the rSP-A-2 mice to tire and
be removed from the tank was 6.8 min, as compared with 7.5 min for the nontransgenic animals (P = NS) (Figure 3).
Log-rank analysis did not reveal any difference in the attrition curves for the two groups of animals over the
course of the entire experiment (P = 0.38).
|
|
Histologic and Immunohistochemical Characterization of the Lungs from rSP-A Mice
The lungs of the rSP-A mice were histologically unremarkable, with no evidence of inflammation or fibrosis in those of most of the rSP-A-1 and rSP-A-2 mice examined (Figure 4A). In approximately 15% of 30 mice examined from both transgenic lines, there were focal areas of air space enlargement and decreased alveolar septation (Figure 4B). Calculation of mean linear intercepts (Lm) in 10 random fields did not show significant differences in air space size for rSP-A mice as compared with nontransgenic mice in siblings from a single litter from the rSP-A-2 line. The Lm was 41.39 ± 1.17 (n = 4) in the transgene-positive mice and 37.87 ± 3.08 (n = 4) in the transgene-negative mice (P > 0.1). Immunohistochemical staining of lung sections from both the nontransgenic mice (Figure 4C) and their transgenic littermates (Figure 4D) with anti-rSP-A IgG was limited to type II cells and nonciliated bronchiolar cells of the pulmonary epithelium, but the intensity of staining was increased in the rSP-A-2 mice compared with the nontransgenic controls. Ultrastructural analysis of alveolar type II cells of the transgenic mice revealed no abnormalities. However, approximately 15% of the alveolar macrophages of the rSP-A mice from some litters contained rod-shaped osmophilic inclusions with a highly ordered lamellated structure (Figure 5). There was significant variation in the abundance of inclusions between litters, but they were not seen in the transgene-negative controls. Postfixation immunostaining with a gold-labeled polyclonal anti-rSP-A antibody did not suggest that the inclusions were enriched for SP-A (not shown), but it is difficult to be certain that the integrity of antigens is preserved under the conditions of such staining.
|
|
Surfactant Components
SP-A overexpression was assessed with a polyclonal anti-rSP-A IgG in an immunoblot analysis and sandwich-type ELISA. As has been previously reported (8), immunoblot analysis of alveolar lavage fluid from the nontransgenic mice revealed that migration of the mouse SP-A was very similar to that of rSP-A (25), producing broad bands at 32 and 38 kD in both cases (Figure 6). This result is not surprising, since there is 91% identity between rat and mouse SP-A at the amino acid level. There was also a narrow immunoreactive band at 26 kD in the rSP-A mice, corresponding to the nonglycosylated form of the protein that is characteristic of rSP-A. The lanes were loaded for detection of the 26 kD SP-A species, and were not optimal for comparison of SP-A levels, but there was a 1.8-fold increase in densitometric abundance of SP-A in the rSP-A mice. There were no consistent differences in the alveolar lavage levels of SP-D by immunoblot analysis. To examine the role of SP-A in surfactant homeostasis, we quantified the levels of SP-A and satPC in lavage fluid and homogenized lung tissue of the rSP-A mice (n = 17) and their transgene-negative littermates (n = 8) in the highest SP-A-producing line, rSP-A-2 (Figure 7). The level of SP-A as determined through ELISA was much higher in the transgenic animals than in their transgene-negative littermates, by more than 8.0-fold in lavage fluid (89.3 ± 5.0 versus 11.1 ± 5.3 µg SP-A/kg body weight [BW], respectively) and by 7.5-fold in lung tissue (116.5 ± 28.2 versus 15.5 ± 7.8 µg SP-A/kg BW, respectively). The marked increase in SP-A levels did not affect the levels of satPC in the lavage fluid (11.7 ± 1.5 versus 12.2 ± 1.9 µmol PC/kg BW for rSP-A mice versus control mice, respectively) or in the lung homogenate (40 ± 6.8 versus 36.0 ± 3.2 µmol PC/kg BW for rSP-A mice versus control mice, respectively). The ratio of SP-A/satPC (in µg/µmol) was 7.64 ± 1.81 for rSP-A mice and 0.88 ± 0.33 for their transgene-negative littermates (mean ± SD, P < 0.001). There were also no significant differences in the composition of LA surfactant composition in alveolar lavage fluid from the rSP-A mice (35.0 ± 2.5%, n = 7) and their transgene-negative littermate controls (32.6 ± 2.6%, n = 7) (P = NS).
|
|
Surfactant Function
The surface activities of LA surfactant from rSP-A mice and from their transgene-negative littermates were compared through use of the captive bubble surfactometer. The results are shown in Figure 8. In the absence of inhibitors, the surfactant isolated from the rSP-A mice and from their transgene-negative littermates had minimum surface tensions of 1.1 ± 0.3 mN/m (n = 3 sets of three mice each) versus 1.4 ± 0.5 mN/m (n = 3 sets of three mice each) (P = NS), respectively, and equilibrium surface tensions of 21.3 ± 0.5 mN/m (n = 3 sets of three mice each) versus 21.0 ± 0.3 mN/m (n = 3 sets of three mice each) (P = NS), respectively. In the presence of 0.93 mg/ml serum protein, the surface activity of surfactant from control mice was inhibited to a greater extent than surfactant from the rSP-A mice. With inhibitor present, the minimum surface tension of the rSP-A surfactant was 8.9 ± 2.6 mN/m (n = 6 sets of three mice each), as compared with 16.7 ± 2.4 mN/m (n = 7 sets of three mice each) for the controls (P < 0.05), and the equilibrium surface tension of surfactant from the rSP-A mice was 29.0 ± 5.1 mN/m (n = 6 sets of three mice each) as compared with 45.0 ± 4.4 mN/m for their transgene-negative littermates (n = 7 sets of three mice each) (P < 0.05).
|
| |
Discussion |
|---|
|
|
|---|
The primary objective of this study was to examine the effect of overexpression of SP-A on surfactant pool sizes. Our hypothesis was that lung-specific overexpression of SP-A in transgenic mice would result in enrichment of surfactant phospholipids in the intracellular compartment. We found that alveolar levels of SP-A that were as much as 7- to 8-fold higher in transgenic mice than in controls did not affect the distribution of the major surfactant phospholipid, satPC, between the air space and lung tissue. Further, overexpression of SP-A did not appear to disrupt lung function, since the rSP-A mice showed normal exercise tolerance, lung compliance, and ex vivo surfactant function. In the presence of protein inhibitors, however, surfactant isolated from the rSP-A mice was more resistant to protein inhibition than that from control littermates. We conclude that increased levels of SP-A do not affect the steady-state levels of surfactant phospholipids in the normal lung, but contribute to the integrity of alveolar surfactant in the presence of protein inhibitors.
Surfactant dysfunction caused by proteinaceous pulmonary edema plays a central role in the pathophysiology of the acute respiratory distress syndrome (28, 29). The molecular interactions that preserve the integrity of the surfactant film in the injured lung are just beginning to be understood (30, 33, 34). Cockshutt and associates were the first to demonstrate that SP-A increases the resistance of surfactant to protein inhibition in vitro (9, 35). Yukitake and coworkers showed that SP-A also improved lung compliance in vivo in surfactant-deficient premature rabbits given surfactant preparations that were mixed with serum protein inhibitors (10). Recently, Ikegami and colleagues reported that the surface activity of surfactant isolated from SP-A deficient mice is more susceptible to protein inhibition (14). In the present study we show that overexpression of SP-A in transgenic mice enhances the resistance of surfactant to inhibitors. Collectively, the available data suggest that SP-A may have a physiologic role in maintaining the integrity of surfactant in the presence of lung injury. The addition of SP-A to surfactant replacement reagents may enhance their resistance to inactivation when given to patients with proteinaceous pulmonary edema (36, 37).
Surfactant isolated by bronchoalveolar lavage contains two major subfractions, called large surfactant aggregates and small surfactant aggregates, that differ in morphologic appearance, protein composition, buoyant density, and surface activity (38). SP-A has been shown to inhibit the conversion of surface-active LAs to the inactive SAs during surface-area cycling in vitro (39). SP-A deficiency in the SP-A gene-targeted mouse resulted in an LA content that was less than one-third that of control mice of the same strain (14). In contrast, we found that a 7-fold increase in the level of SP-A in the alveolar space did not result in a significant increase in the LA pool size. These data suggest that SP-A concentrations in excess of physiologic levels do not affect the surfactant subtype composition of surfactant.
Surfactant phospholipid levels in the alveolar space must be tightly regulated. Reports from several laboratories that SP-A enhances the uptake (40) and inhibits the secretion (41) of surfactant from isolated type II cells through a high-affinity-receptor-mediated mechanism (11) have suggested a role for SP-A in surfactant homeostasis. The unexpected finding that SP-A gene-targeted animals had normal surfactant pool sizes did not support this hypothesis, but regulation of surfactant phospholipid levels by a redundant mechanism could not be completely excluded (8). In the present study, the failure of markedly increased levels of SP-A to perturb steady-state surfactant pool sizes provides further evidence that SP-A is not a critical determinant of alveolar surfactant concentrations in the normal lung. Although rSP-A and mouse SP-A are 91% identical at the amino acid level, it is possible that the function of rSP-A expressed in mice is inherently different from that of mouse SP-A, or that heteroligomerization of rat and mouse SP-A in rSP-A mice affects the function of both proteins. That the antiinhibitor function of SP-A remains intact in rSP-A mice argues that the rSP-A overexpression model accurately reflects the functional consequences of SP-A excess.
Recently, several laboratories have reported that SP-A binds to multiple microorganisms and influences alveolar macrophage (AM) functions including chemotaxis (44), release of toxic oxygen species including nitric oxide (45, 46), and phagocytosis (47). Deficiency of SP-A in the gene-targeted animal results in increased susceptibility to pulmonary infection with group B streptococci, through a mechanism that appears to be macrophage-dependent (16). Although the host defense properties of SP-A were not directly addressed in the present study, we found that macrophage ultrastructure was abnormal in the rSP-A mice. The ordered, osmophilic macrophage inclusions that we observed in some AM from rSP-A mice in this study had a periodicity that was more consistent with crystalline protein than with phospholipid lattices (Nades Palyshar, M.D., personal communication). Immunogold labeling with a polyclonal anti-SP-A antibody did not demonstrate enrichment for SP-A in the inclusions, but the integrity of the SP-A antigen with use of this postfixation technique is unclear. Similar inclusions have been reported in smokers (48). Overexpression of SP-A clearly has an effect on macrophage structure, but further studies will be required to determine the nature and significance of the macrophage inclusions.
The focal dilation of distal air spaces in some of the rSP-A mice in our study also remains unexplained. Not all transgene-positive mice within a single litter had focal air space dilation, and the changes we observed were not sufficiently severe or diffuse to be detectable by morphometric analyses of randomly chosen fields or by measurement of lung compliance. The variability in expression of histologic lesions among transgenic animals may have been due to a yet undefined environmental cofactor. Experiments are in progress to attempt to enhance the severity and extent of the histologic lesions in rSP-A mice by breeding these mice to homozygosity, by exposure of the animals to inhaled agents, and by aging of the animals. The availability of a transgenic model with a consistent emphysema-like phenotype would be a valuable tool for the study of obstructive lung disease.
In summary, we find that high-level overexpression of SP-A in the respiratory epithelium of transgenic mice does not perturb resting lung mechanics, exercise tolerance, or resting surfactant phospholipid pool sizes. Surfactant isolated from the SP-A overexpressing animals in our study exhibited enhanced resistance to foreign protein inhibitors. Future studies will explore the effect of overexpression of SP-A on host defense and pulmonary function after lung injury.
| |
Footnotes |
|---|
Abbreviations: enzyme-linked immunosorbent assay, ELISA; large aggregate, LA; nonsignificant, NS; small aggregate, SA; surfactant protein-A, SP-A; saturated phosphatidylcholine, satPC; rat surfactant protein-A, rSP-A.
(Received in original form January 28, 1999 and in revised form March 31, 1999).
Acknowledgments: The authors thank Jeffrey Whitsett, M.D., and Stephen Glasser, Ph.D., for the gift of the SP-C promoter and helpful discussions, and Susan Wert and Sherri Proffitt for help with the immunostaining. This work was supported in part by grant 61612 from the National Heart, Lung, and Blood Institute (F.X.M.), the Medical Research Service Department of Veteran Affairs (F.X.M.), grant 06096 from the National Institute of Environmental and Health Sciences (M.L.M., F.X.M.), and grant HD-11932 from the National Institutes of Health (M.I.).
| |
References |
|---|
|
|
|---|
1. Goerke, J., and J. A. Clements. 1986. Mechanics of breathing. In P. T. Macklem and J. Mead, editors. Handbook of Physiology. American Physiological Society, Bethesda, MD. 247-261.
2.
Hawgood, S.,
B. J. Benson,
J. Schilling,
D. Damm,
J. A. Clements, and
R. T. White.
1987.
Nucleotide and amino acid sequences of pulmonary surfactant protein SP 18 and evidence for cooperation between SP-18 and SP 28-36 in surfactant lipid adsorption.
Proc. Natl. Acad. Sci. USA
84:
66-70
3.
Kuroki, Y.,
F. X. McCormack,
Y. Ogasawara,
R. J. Mason, and
D. R. Voelker.
1994.
Epitope mapping for monoclonal antibodies identifies
functional domains of pulmonary surfactant protein A that interact with
lipids.
J. Biol. Chem.
269:
29793-29800
4. McCormack, F. X., J. J. Stewart, D. R. Voelker, and M. D. Damodarasamy. 1997. Alanine mutagenesis of SP-A reveals that lipid binding and pH-dependent aggregation of liposomes are mediated by the carbohydrate recognition domain of SP-A. Biochemistry 36:13963-13971.
5. King, R. J.. 1984. Lipid-apoprotein interactions in surfactant studied by reassembly. Exp. Lung Res. 6: 237-253 [Medline].
6. Hawgood, S., B. Benson, and R. J. Hamilton. 1985. Effects of a surfactant-associated protein and calcium ions on the structure and surface activity of lung surfactant lipids. Biochemistry 24: 184-190 [Medline].
7. Suzuki, Y., Y. Fujita, and K. Kogishi. 1989. Reconstitution of tubular myelin from synthetic lipids and proteins associated with pig pulmonary surfactant. Am. Rev. Respir. Dis. 140: 75-81 [Medline].
8.
Korfhagen, T. R.,
M. D. Bruno,
G. F. Ross,
K. M. Huelsman,
M. Ikegami,
A. H. Jobe,
S. E. Wert,
B. R. Stripp,
R. E. Morris,
S. W. Glasser,
C. J. Bachurski,
H. S. Iwamoto, and
J. A. Whitsett.
1996.
Altered surfactant function and structure in SP-A gene targeted mice.
Proc. Natl. Acad. Sci. USA
93:
9594-9599
9. Cockshutt, A. M., J. Weitz, and F. Possmayer. 1990. Pulmonary surfactant protein A enhances the surface activity of lipid extract surfactant and reverses inhibition by blood proteins in vitro. Biochemistry 29: 8424-8429 [Medline].
10. Yukitake, K., C. L. Brown, M. A. Schlueter, J. A. Clements, and S. Hawgood. 1994. Surfactant apoprotein A modifies the inhibitory effect of plasma proteins on surfactant activity in vivo. Pediatr. Res. 37: 21-25 [Medline].
11. Ryan, R. M., R. E. Morris, W. R. Rice, G. Ciraolo, and J. A. Whitsett. 1989. Binding and uptake of pulmonary surfactant protein (SP-A) by pulmonary type II epithelial cells. J. Histochem. Cytochem. 37: 429-440 [Abstract].
12.
Kuroki, Y.,
R. J. Mason, and
D. R. Voelker.
1988.
Alveolar type II cells express a high-affinity receptor for pulmonary surfactant protein A.
Proc.
Natl. Acad. Sci. USA
85:
5566-5570
13.
Wright, J. R.,
J. D. Borchelt, and
S. Hawgood.
1989.
Lung surfactant apoprotein SP-A (26-36 kDa) binds with high affinity to isolated alveolar type
II cells.
Proc. Natl. Acad. Sci. USA
86:
5410-5414
14. Ikegami, M., T. R. Korfhagen, J. A. Whitsett, M. D. Bruno, S. E. Wert, K. Wada, and A. H. Jobe. 1998. Characteristics of surfactant from SP-A-deficient mice. Am. J. Physiol. 275 (2 Pt. 1):L247-L254.
15.
Wright, J. R..
1997.
Immunomodulatory functions of surfactant.
Physiol.
Rev.
77:
931-962
16. LeVine, A. M., M. D. Bruno, K. M. Huelsman, G. F. Ross, J. A. Whitsett, and T. R. Korfhagen. 1997. Surfactant protein A-deficient mice are susceptible to group B streptococcal infection. J. Immunol. 158: 4336-4340 [Abstract].
17. Sano, K., J. Fisher, R. J. Mason, Y. Kuroki, J. Schilling, B. Benson, and D. Voelker. 1987. Isolation and sequence of a cDNA clone for the rat pulmonary surfactant-associated protein (PSP-A). Biochem. Biophys. Res. Commun. 144: 367-374 [Medline].
18.
Glasser, S. W.,
T. R. Korfhagen,
S. E. Wert,
M. D. Bruno,
D. K. McWilliams,
D. K. Vorbroker, and
J. A. Whitsett.
1991.
Genetic element from a
human surfactant protein gene confers bronchiolar-alveolar cell specificity
in transgenic mice.
Am. J. Physiol. (Lung Cell Mol. Physiol.)
261:
L349-L356
19.
Dunhill, M. S..
1962.
Quantitative methods in the study of pulmonary pathology.
Thorax
17:
320-328
20. McCormack, F. X., J. H. Fisher, A. Suwabe, D. L. Smith, J. M. Shannon, and D. R. Voelker. 1990. Expression and characterization of rat surfactant protein A synthesized in Chinese hamster ovary cells. Biochim. Biophys. Acta 1087: 190-198 [Medline].
21. Bligh, E. G., and W. J. Dyer. 1959. A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 37: 911-917 .
22. Mason, R. J., J. A. Nellenbogen, and J. A. Clements. 1976. Isolation of disaturated phosphatidylcholine with osmium tetroxide. J. Lipid. Res. 17: 281-284 [Abstract].
23.
Bartlett, G. R..
1959.
Phosphorus assay in column chromatography.
J. Biol.
Chem.
234:
466-468
24.
Schurch, S.,
H. Bachofen,
J. Goerke, and
F. Possmayer.
1989.
A captive
bubble method reproduces the in situ behavior of lung surfactant monolayers.
J. Appl. Physiol.
67:
2389-2396
25. McCormack, F. X., A. L. Festa, R. P. Andrews, M. Linke, and P. D. Walzer. 1997. The carbohydrate recognition domain of surfactant protein A mediates binding to the major surface glycoprotein of P. Carinii. Biochemistry 36: 8092-8099 [Medline].
26.
Korfhagen, T. R.,
V. Sheftelyevich,
M. S. Burhans,
M. D. Bruno,
G. F. Ross,
S. E. Wert,
M. T. Stahlman,
A. H. Jobe,
M. Ikegami,
J. A. Whitsett, and
J. H. Fisher.
1998.
Surfactant protein-D regulates surfactant phospholipid
homeostasis in vivo.
J. Biol. Chem.
273:
28438-28443
27.
Shimizu, H.,
J. H. Fisher,
P. Papst,
B. Benson,
K. Lau,
R. J. Mason, and
D. R. Voelker.
1992.
Primary structure of rat pulmonary surfactant protein D:
cDNA and deduced amino acid sequence.
J. Biol. Chem.
267:
1853-1857
28. Ashbaugh, D. G., C. B. Bigelow, T. L. Petty, and B. E. Levine. 1967. Acute respiratory distress in adults. Lancet 2: 319-323 [Medline].
29. Gregory, T. J., W. J. Longmore, M. A. Moxeley, J. A. Whitsett, C. R. Reed, A. A. Fowler, L. D. Hudson, R. J. Maunder, C. Crim, and T. M. Hyers. 1991. Surfactant chemical composition and biophysical activity in acute respiratory distress syndrome. J. Clin. Invest. 88: 1976-1981 .
30. Seeger, W., C. Grube, A. Gunther, and R. Schmidt. 1993. Surfactant inhibition by plasma proteins: differential sensitivity of various surfactant preparations. Eur. Respir. J. 6: 971-977 [Abstract].
31. Bruni, R., B. R. Fan, R. David-Cu, H. W. Taeusch, and F. J. Walther. 1996. Inactivation of surfactant in rat lungs. Pediatr. Res. 39: 236-240 [Medline].
32.
Seeger, W.,
G. Stohr,
H. R. Wolf, and
H. Neuhof.
1985.
Alteration of surfactant function due to protein leakage: special interaction with fibrin
monomer.
J. Appl. Physiol.
58:
326-338
33. Kobayashi, T., K. Nitta, M. Ganzuka, S. Inui, G. Grossmann, and B. Robertson. 1991. Inactivation of exogenous surfactant by pulmonary edema fluid. Pediatr. Res. 29:(Pt. 1):353-356.
34. Bummer, P. M., L. P. Sanders, T. H. Pauly, and M. N. Gillespie. 1994. In vitro inactivation of pulmonary surfactant replacement preparations by serum albumin. Am. J. Med. Sci. 307: 401-404 [Medline].
35. Venkitaraman, A. R., J. E. Baatz, J. A. Whitsett, S. B. Hall, and R. H. Notter. 1990. Biophysical inhibition of synthetic phospholipid-apoprotein mixtures by plasma proteins. Chem. Phys. Lipids 57: 49-57 .
36.
Anzueto, A.,
R. P. Baughman,
K. K. Guntupalli,
J. G. Weg,
H. P. Wiedemann,
A. A. Raventos,
F. Lemaire,
W. Long,
D. S. Zaccardelli, and
E. N. Pattishall.
1996.
Aerosolized surfactant in adults with sepsis-induced acute
respiratory distress syndrome.
N. Engl. J. Med.
334:
1417-1421
37. Gregory, T. J., K. P. Steinberg, R. Spragg, J. E. Gadek, T. M. Hyers, W. J. Longmore, M. A. Moxley, G. Z. Cai, R. D. Hite, R. M. Smith, L. D. Hudson, C. Crim, P. Newton, B. R. Mitchell, and A. J. Gold. 1997. Bovine surfactant therapy for patients with acute respiratory distress syndrome. Am. J. Respir. Crit. Care Med. 155: 1309-1315 [Abstract].
38. Magoon, M. W., J. R. Wright, A. Baritussio, M. C. Williams, J. Goerke, B. Benson, R. L. Hamilton, and J. A. Clements. 1983. Subfractionation of lung surfactant: implications for metabolism and surface activity. Biochim. Biophys. Acta. 750: 18-31 [Medline].
39. Veldhuizen, R. A., L. J. Yao, S. A. Hearn, F. Possmayer, and J. F. Lewis. 1996. Surfactant-associated protein A is important for maintaining surfactant large-aggregate forms during surface-area cycling. Biochem. J. 313: 835-840 .
40.
Wright, J. R.,
R. E. Wager,
R. L. Hamilton,
M. Huang, and
J. A. Clements.
1986.
Uptake of lung surfactant subfractions into lamellar bodies of adult
rabbit lungs.
J. Appl. Physiol.
60:
817-825
41.
Rice, W. R.,
G. F. Ross,
F. M. Singleton,
S. Dingle, and
J. A. Whitsett.
1987.
Surfactant-associated protein inhibits phospholipid secretion from type II
cells.
J. Appl. Physiol.
63:
692-698
42.
Dobbs, L. G.,
J. R. Wright,
S. Hawgood,
R. Gonzalez,
K. Venstrom, and
J. Nellenbogen.
1987.
Pulmonary surfactant and its components inhibit secretion of phosphatidylcholine from cultured rat alveolar type II cells.
Proc. Natl. Acad. Sci. USA
84:
1010-1014
43.
Kuroki, Y.,
R. J. Mason, and
D. R. Voelker.
1988.
Pulmonary surfactant apoprotein A structure and modulation of surfactant secretion by rat alveolar type II cells.
J. Biol. Chem.
263:
3388-3394
44.
Wright, J. R., and
D. C. Youmans.
1993.
Pulmonary surfactant protein A
stimulates chemotaxis of alveolar macrophage.
Am. J. Physiol.
264:
L338-L344
45.
Weissbach, S.,
A. Neuendank,
M. Pettersson,
T. Schaberg, and
U. Pison.
1994.
Surfactant protein A modulates release of reactive oxygen species
from alveolar macrophages.
Am. J. Physiol.
267:
L660-L664
46.
Blau, H.,
S. Riklis,
D. Minc-Golomb,
J. F. van Iwaarden,
F. X. McCormack, and
M. Kalina.
1997.
Nitric oxide production by rat alveolar macrophages
can be modulated in vitro by surfactant protein A.
Am. J. Physiol.
272:
L1198-L1204
47. McNeely, T. B., and J. D. Coonrod. 1994. Aggregation and opsonization of type A but not type B Hemophilus influenzae by surfactant protein A. Am. J. Respir. Cell. Mol. Biol. 11: 114-122 [Abstract].
48. Brody, A. R., and J. E. Craighead. 1975. Cytoplasmic inclusions in pulmonary macrophages of cigarette smokers. Lab. Invest. 32: 125-132 [Medline].
This article has been cited by other articles:
![]() |
L. Brauer, C. Kindler, K. Jager, S. Sel, B. Nolle, U. Pleyer, M. Ochs, and F. P. Paulsen Detection of Surfactant Proteins A and D in Human Tear Fluid and the Human Lacrimal System Invest. Ophthalmol. Vis. Sci., September 1, 2007; 48(9): 3945 - 3953. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang, M. Ikegami, T. R. Korfhagen, F. X. McCormack, M. Yoshida, R. M. Senior, J. M. Shipley, S. D. Shapiro, and J. A. Whitsett Neither SP-A nor NH2-terminal domains of SP-A can substitute for SP-D in regulation of alveolar homeostasis Am J Physiol Lung Cell Mol Physiol, August 1, 2006; 291(2): L181 - L190. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Starosta, E. Rietschel, K. Paul, U. Baumann, and M. Griese Oxidative Changes of Bronchoalveolar Proteins in Cystic Fibrosis. Chest, February 1, 2006; 129(2): 431 - 437. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Linke, A. Ashbaugh, J. Koch, R. Tanaka, and P. Walzer Efficient resolution of Pneumocystis murina infection in surfactant protein A-deficient mice following withdrawal of corticosteroid-induced immunosuppression J. Med. Microbiol., February 1, 2006; 55(2): 143 - 147. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E. Cogo, G. M. Toffolo, A. Gucciardi, A. Benetazzo, C. Cobelli, and V. P. Carnielli Surfactant disaturated phosphatidylcholine kinetics in infants with bronchopulmonary dysplasia measured with stable isotopes and a two-compartment model J Appl Physiol, July 1, 2005; 99(1): 323 - 329. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Condon, P. Jeyasuria, J. M. Faust, and C. R. Mendelson Surfactant protein secreted by the maturing mouse fetal lung acts as a hormone that signals the initiation of parturition PNAS, April 6, 2004; 101(14): 4978 - 4983. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Herrmann, F. van der Hoeven, H.-J. Grone, A. F. Stewart, L. Langbein, I. Kaiser, G. Liebisch, I. Gosch, F. Buchkremer, W. Drobnik, et al. Mice with targeted disruption of the fatty acid transport protein 4 (Fatp 4, Slc27a4) gene show features of lethal restrictive dermopathy J. Cell Biol., June 23, 2003; 161(6): 1105 - 1115. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Epaud, M. Ikegami, J. A. Whitsett, A. H. Jobe, T. E. Weaver, and H. T. Akinbi Surfactant Protein B Inhibits Endotoxin-Induced Lung Inflammation Am. J. Respir. Cell Mol. Biol., March 1, 2003; 28(3): 373 - 378. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. R. Rice, J. J. Conkright, C.-L. Na, M. Ikegami, J. M. Shannon, and T. E. Weaver Maintenance of the mouse type II cell phenotype in vitro Am J Physiol Lung Cell Mol Physiol, August 1, 2002; 283(2): L256 - L264. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Palaniyar, L. Zhang, A. Kuzmenko, M. Ikegami, S. Wan, H. Wu, T. R. Korfhagen, J. A. Whitsett, and F. X. McCormack The Role of Pulmonary Collectin N-terminal Domains in Surfactant Structure, Function, and Homeostasis in Vivo J. Biol. Chem., July 19, 2002; 277(30): 26971 - 26979. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. A. Quintero, T. R. Korfhagen, and J. R. Wright Surfactant protein A regulates surfactant phospholipid clearance after LPS-induced injury in vivo Am J Physiol Lung Cell Mol Physiol, July 1, 2002; 283(1): L76 - L85. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang, K. L. Hartshorn, E. C. Crouch, M. Ikegami, and J. A. Whitsett Complementation of Pulmonary Abnormalities in SP-D(-/-) Mice with an SP-D/Conglutinin Fusion Protein J. Biol. Chem., June 14, 2002; 277(25): 22453 - 22459. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Klein, T. A. McCarthy, J. M. Dagle, and J. M. Snyder Pre- and Postnatal Lung Development, Maturation, and Plasticity: Antisense inhibition of surfactant protein A decreases tubular myelin formation in human fetal lung in vitro Am J Physiol Lung Cell Mol Physiol, March 1, 2002; 282(3): L386 - L393. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Malloy, R. A. W. Veldhuizen, F. X. McCormack, T. R. Korfhagen, J. A. Whitsett, and J. F. Lewis Pulmonary surfactant and inflammation in septic adult mice: role of surfactant protein A J Appl Physiol, February 1, 2002; 92(2): 809 - 816. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Harrison, M. L. Bell, D. L. Allen, W. C. Byrnes, and L. A. Leinwand Skeletal muscle adaptations in response to voluntary wheel running in myosin heavy chain null mice J Appl Physiol, January 1, 2002; 92(1): 313 - 322. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Conkright, C.-L. Na, and T. E. Weaver Overexpression of Surfactant Protein-C Mature Peptide Causes Neonatal Lethality in Transgenic Mice Am. J. Respir. Cell Mol. Biol., January 1, 2002; 26(1): 85 - 90. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ochs, G. Johnen, K.-M. Muller, T. Wahlers, S. Hawgood, J. Richter, and F. Brasch Intracellular and Intraalveolar Localization of Surfactant Protein A (SP-A) in the Parenchymal Region of the Human Lung Am. J. Respir. Cell Mol. Biol., January 1, 2002; 26(1): 91 - 98. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ikegami, B. M. Elhalwagi, N. Palaniyar, K. Dienger, T. Korfhagen, J. A. Whitsett, and F. X. McCormack The Collagen-like Region of Surfactant Protein A (SP-A) Is Required for Correction of Surfactant Structural and Functional Defects in the SP-A Null Mouse J. Biol. Chem., October 12, 2001; 276(42): 38542 - 38548. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. G. SPRAGG and J. F. LEWIS Pathology of the Surfactant System of the Mature Lung . Second San Diego Conference Am. J. Respir. Crit. Care Med., January 1, 2001; 163(1): 280 - 282. [Full Text] |
||||
![]() |
M. Ikegami, A. H. Jobe, J. Whitsett, and T. Korfhagen Tolerance of SP-A-deficient mice to hyperoxia or exercise J Appl Physiol, August 1, 2000; 89(2): 644 - 648. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Reed, M. Ikegami, L. Robb, C. G. Begley, G. Ross, and J. A. Whitsett Distinct changes in pulmonary surfactant homeostasis in common beta -chain- and GM-CSF-deficient mice Am J Physiol Lung Cell Mol Physiol, June 1, 2000; 278(6): L1164 - L1171. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Paine III, A. M. Preston, S. Wilcoxen, H. Jin, B. B. Siu, S. B. Morris, J. A. Reed, G. Ross, J. A. Whitsett, and J. M. Beck Granulocyte-Macrophage Colony-Stimulating Factor in the Innate Immune Response to Pneumocystis carinii Pneumonia in Mice J. Immunol., March 1, 2000; 164(5): 2602 - 2609. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mishra, T. E. Weaver, D. C. Beck, and M. E. Rothenberg Interleukin-5-mediated Allergic Airway Inflammation Inhibits the Human Surfactant Protein C Promoter in Transgenic Mice J. Biol. Chem., March 9, 2001; 276(11): 8453 - 8459. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Crit. Care Med. |