help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elhalwagi, B. M.
Right arrow Articles by McCormack, F. X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elhalwagi, B. M.
Right arrow Articles by McCormack, F. X.
Am. J. Respir. Cell Mol. Biol., Volume 21, Number 3, September 1999 380-387

Normal Surfactant Pool Sizes and Inhibition-Resistant Surfactant from Mice That Overexpress Surfactant Protein A

Baher M. Elhalwagi, Mei Zhang, Machiko Ikegami, Harriet S. Iwamoto, Randall E. Morris, Marian L. Miller, Krista Dienger, and Francis X. McCormack

Departments of Medicine, Environmental Health, and Cell Biology, University of Cincinnati College of Medicine, Cincinnati; and Department of Pediatrics, Children's Hospital Research Foundation, Cincinnati, Ohio


    Abstract
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Pulmonary surfactant protein-A (SP-A) has been reported to regulate the uptake and secretion of surfactant by alveolar type II cells, to stabilize large surfactant aggregates including tubular myelin, and to protect the surface activity of surfactant from protein inhibitors. In this study we investigated the consequences of overexpression of SP-A on pulmonary homeostasis and surfactant function in transgenic mice. The human SP-C promoter was used to direct synthesis of rat surfactant protein A (rSP-A) in alveolar type II cells and nonciliated bronchiolar cells of the distal respiratory epithelium. Levels of SP-A measured through enzyme-linked immunosorbent assay were 7- to 8-fold higher in lung homogenates and alveolar lavage fluid of the rSP-A mice than in those of transgene-negative littermates. The swimming exercise tolerance and lung compliance of mice bearing the transgene were unchanged. Mean air space sizes seen in randomly selected light-microscopic fields were not significantly different in the transgene-positive and -negative mice by morphometric analysis, but 15% of transgenic animals had scattered foci containing dilated alveoli and alveolar ducts without evidence of inflammation or fibrosis. Some alveolar macrophages contained bar-shaped osmophilic inclusions that had a highly ordered ultrastructure. There were no differences between the transgene-positive and -negative mice in the tissue or alveolar pool sizes of saturated phosphatidylcholine or in the large-aggregate composition of alveolar surfactant. The surface activity of surfactant isolated from the rSP-A mice was similar to that of the controls, but in the presence of protein inhibitors, the surface tension-reducing properties of the rSP-A surfactant were better preserved (P < 0.05). We conclude that overexpression of SP-A does not affect resting surfactant phospholipid levels, but that it enhances the resistance of surfactant to protein inhibition.


    Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The primary function of pulmonary surfactant, a mixture of phospholipids and proteins produced by alveolar type II cells and bronchiolar cells, is to reduce surface tension forces in the lung and stabilize pulmonary alveoli (1). The surface-active properties of surfactant are attributable to the assembly of a noncompressible film of saturated phosphatidylcholine (satPC) at the alveolar air-liquid interface. The surfactant proteins are thought to play important roles in the assembly and integrity of the surfactant membrane (2). Surfactant protein A (SP-A) is an oligomeric, Ca2+-dependent phospholipid-binding glycoprotein that is intimately associated with surfactant lipids in the alveolar space (2). SP-A has been reported to maintain the stability and/or structure of large surfactant aggregates, including the latticelike array tubular myelin (7, 8), and to preserve the surface activity of the surfactant film in the presence of protein inhibitors (9, 10). The binding of SP-A to a high-affinity SP-A receptor on the surface of isolated alveolar type II cells results in inhibition of surfactant secretion and increased surfactant uptake, suggesting that SP-A may regulate the intraalveolar levels of surfactant phospholipids (11). However, targeted disruption of the murine SP-A gene did not affect surfactant pool sizes or lung compliance in resting mice (8). Isolated surfactant from the SP-A-null mouse was susceptible to inhibition by serum proteins, and was more easily depleted of large surfactant aggregates when subjected to cyclical expansion and compression at an air-liquid interface in vitro (14). The recent recognition that SP-A has host defense properties (15, 16), and the finding of discrepancies between the in vitro and in vivo experimental surfactant functions of SP-A, have generated controversy about the fundamental physiologic importance of SP-A in the air space.

To investigate the roles of SP-A in pulmonary homeostasis in vivo, we overexpressed rat SP-A in transgenic mice and performed histologic, physiologic, biochemical, and surfactant functional analyses.

    Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Transgene Construction and Development of Transgenic Animals

A rat SP-A (rSP-A) transgene was constructed by ligating a full-length, 1.6-kb complementary DNA (cDNA) for rSP-A (17) into the unique EcoR1 site of the 3.7 kb human SP-C (hSP-C) plasmid (gift of J. Whitsett and S. Glasser, Children's Hospital, Cincinnati, OH) (18), downstream from the hSP-C promoter. In this construct, sequences encoding the SV40/small T intron and polyadenine (poly A) present in the plasmid are positioned at the 3' end of the gene. Proper orientation of the SP-A insert was confirmed with BamH1, and nonessential elements of the plasmid were removed by digestion with Nde1 and Not1. The hSP-C/ rSP-A DNA fragment was purified by agarose gel electrophoresis, phenol/chloroform extraction, and ethanol precipitation, and was injected into the pronuclei of fertilized FVB/N mouse eggs. The eggs were then implanted into the wombs of pseudopregnant female FVB/N mice. Transgenic progeny were identified by amplification through the polymerase chain reaction (PCR) of DNA in ear clips digested with detergent (0.45% Tween and 0.45% NP 40) and proteinase K (1 mg/ml). The 5' PCR primer was complementary to nucleotides 307-335 (AACGTGGAGACAAGGGAGAGCC), and the 3' primer was complementary to nucleotides 1,193-1,172 (GACACCGAGCTACAGAAGGGTG) of the rSP-A cDNA. Control primers amplified a 400-bp endogenous mouse thyrotropin-stimulating hormone beta  (THSbeta ) sequence. Founder lines and germ-line transmission were also confirmed by Southern blot analysis. Briefly, tail clips (0.5-1 cm) were digested overnight at 55°C in buffer containing 50 mM Tris, 100 mM ethylenediaminetetraacetic acid (EDTA), 0.5% sodium dodecylsulfate (SDS), and 100 µg/ml proteinase K. Tail DNA was phenol/chloroform extracted, digested with EcoR1, size-fractionated through agarose gel electrophoresis, and transferred to nitrocellulose membranes by capillary action. The DNA was crosslinked to the membrane with ultraviolet (UV) light, and was blocked with prehybridization solution at 65°C. 32P-labeled probe was synthesized with the 0.75-kb Pst 1 fragment from the cDNA for rSP-A as the template and a random-primer labeling kit (Prime-It II Random Primer labeling Kit; Stratagene, La Jolla, CA). The membrane was hybridized with the probe overnight at 65°C, washed three times with 20 mM Na2HPO4, 1 mM EDTA, 1% SDS, and placed on film. All animals were housed in positively ventilated microisolator cages with automatically recirculating water, located in a room with laminar flow of high-energy particulate air-filtered air. The animals received autoclaved food, water, and bedding.

Northern Blot Analysis of Transgenic Mice

The expression of rSP-A messenger RNA (mRNA) in transgenic mice was verified by Northern blot analysis. Northern blots containing 15 µg of total mRNA purified by acid phenol extraction of lung homogenates (Trizol; GIBCO; Grand Island, NY) were prehybridized at 65°C for 1 h in 15% formamide. The blots were then hybridized for 20 h under the same conditions with a 32P-labeled probe containing the Pst 1 fragment of rSP-A cDNA (17). Filters were washed with 20 mM Na2HPO4, 1 mM EDTA, 1% SDS for 30 min at 65°C, and were then exposed to film.

Histologic, Immunohistochemical, and Morphometric Analyses

Mice were killed with an overdose of pentobarbital and exsanguinated by transection of the abdominal aorta. The lungs were infused via an intratracheal catheter at a controlled pressure of 25 cm H2O with modified Karnovsky's fixative containing 2.0% glutaraldehyde, 2% paraformaldehyde, and 0.1% CaCl2 in 0.1 M sodium cacodylate buffer. The lungs were removed, paraffin embedded, sectioned with a microtome, and stained with hematoxylin and eosin (H&E). For electron microscopy of the lung, the tissue was inflation-fixed, stained with 1% osmium tetroxide, embedded in Eponate, and examined with a JEOL 100 CX instrument (JEOL, Tokyo, Japan). Ultrastructural analyses of alveolar macrophages and tubular myelin were done on specimens of bronchoalveolar lavage fluid that were centrifuged at 100 × g and 14,000 × g, respectively. Immunostaining for SP-A was done with a protein A-purified, serum-adsorbed, anti-rSP-A polyclonal antibody at a concentration of 4 µg/ml (4). Morphometric analyses were done by measuring mean linear intercepts (Lm) on a 2,750-µ grid as an index of air space size (19). Lm was calculated for each mouse from 10 random fields on the grid at a magnification of ×500. The values reported are means and SDs of intercepts between alveolar walls and the grid, determined by a reader who was blinded to the genotypes of the animals. Data were analyzed with the general linear model in the Statistical Analysis System (SAS Inc., Cary, NC), and values of P < 0.05 were accepted as significant.

Analysis of Surfactant Components

Mice (6-12 wk) were anesthetized with an overdose of pentobarbital, exsanguinated by aortic transection, and intubated with an 18-gauge catheter through an incision in the exposed trachea. Alveolar lavage was done with three cycles of instillation and gentle aspiration of 1 ml saline each, repeated five times (total = 5 ml saline) for each animal. The volume of the recovered lavage fluid was recorded, and the postlavage lungs were homogenized in saline. SP-A in the lavage fluid and homogenates was measured with an enzyme-linked immunosorbent assay (ELISA), as described (20). Large- (LA) and small-aggregate (SA) surfactant were separated by centrifugation over a 0.8 M sucrose cushion. SatPC was isolated by chloroform/methanol (2:1) extraction of the lung homogenate, alveolar lavage, or LA and SA surfactant (21), followed by oxidation with OsO4 in carbon tetrachloride and alumina-column chromatography (22). Phosphorus in satPC was measured with the Bartlett assay (23). Surface activity was measured with a captive bubble surfactometer (24), using 15 µg of LA surfactant pooled from three mice of the same genotype. Sensitivity to protein inhibition was measured in the presence of 0.93 mg/ml sheep plasma protein applied to the air-water interface of the bubble by microsyringe. Data were expressed as mean ± SD, and were analyzed with the unpaired Student's t test. Values of P < 0.05 were accepted as significant.

Immunoblot Analysis

Proteins in alveolar lavage fluid were size fractionated by electrophoresis on 8-16% SDS-polyacrylamide gels under reducing conditions and transferred to nitrocellulose. For SP-A, membranes were incubated with rabbit anti-rSP-A IgG, followed by horseradish peroxidase (HRP)-conjugated antirabbit IgG as previously described (25). Immunoreactive protein species were visualized through HRP-dependent oxidation of o-phenylenediamine. The polyclonal anti-rSP-A antibody used in this assay (and in the ELISA) recognized both rSP-A and mouse SP-A, with affinities for the two proteins that appeared to be comparable on the basis of immunoblots of mouse and rat lavage prepared with equivalent loads of total lavage protein (not shown). SP-D is another hydrophilic surfactant protein with structural and functional similarities to SP-A. An immunoblot of SP-D in lavage fluid was made with a rabbit anti-rSP-D IgG primary antibody (26). To produce the antibody, a complementary DNA (cDNA) for rSP-D (27) (gift of J. H. Fisher, M.D., University of Colorado) was expressed in insect cells, and recombinant SP-D was purified by maltose- Sepharose affinity chromatography. A New Zealand White rabbit was immunized and boosted with 50 µg purified recombinant SP-D in incomplete Freund's adjuvant over a 3-wk interval. After 1 mo, serum was harvested and the IgG fraction was purified from culture medium by staphylococcal protein A-Sepharose affinity chromatography (Hi Trap; Pharmacia, Piscataway, NJ). The anti-SP-D antibody did not react with rat serum or with SP-A.

Physiologic Characterization of Transgenic Mice

Whole-lung compliance was measured in 8- to 12-wk-old mice (8). After intraperitoneal injection into each mouse of an overdose of sodium pentobarbital, the animal's lungs were degassed in a 100% O2 chamber. The chest wall was opened to fully deflate the lungs, and the trachea was cannulated and connected to a silicon pressure transducer (X-ducer; Motorola, Phoenix, AZ). The lungs were inflated with air or saline in 100 µl increments to an airway pressure of 30 cm H2O, and were then deflated to -10 cm H2O. Airway opening pressure and lung volume were recorded at each inflation and deflation increment. Specific lung compliance was defined as the ratio of the slope of the linear portion of the deflation curve (-10 to 10 cm H2O) and the total body weight of the animal. Compliance values were expressed as means ± SD and were compared through use of the Mann-Whitney U test. Values of P < 0.01 were accepted as significant. Exercise tolerance was assessed by placing mice in a 22°C water bath and counting head submersions that occurred as the swimming animals became fatigued. Mice were removed from the tank when their heads dropped below the surface for the eighth time. Observers were blinded to the genotype of the mice. The mean times to the eighth head submersion for the transgene-negative and -positive groups were compared by one-way analysis of variance (ANOVA) and values of P < 0.01 were accepted as significant. Attrition in the tank test over the entire course of the experiment was assessed through log-rank analysis. Values of P < 0.01 were accepted as significant.

    Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Development of Lines of Transgenic Mice

Promoter sequences from the human SP-C gene were used to construct a chimeric gene directing expression of the rSP-A cDNA in the respiratory epithelial cells of mice (Figure 1A). The SP-C-rSP-A construct was injected into oocytes, which were then transferred to pseudopregnant mothers. After term birth, three founders (rSP-A-1, rSP-A-2, and rSP-A-3) were identified from among 40 total pups through the appearance of a 900-bp band on PCR analysis of genomic DNA (Figure 1B). Transmission of the transgene to F1 progeny was confirmed by the presence of 1.6-kb bands on Southern blotting of EcoR1-digested tail DNA (Figure 1C). Germ-line transmission was documented for the rSP-A-1 and rSP-A-2 lines but not for the rSP-A-3 line, and the latter was not further characterized. The rat SP-A cDNA probe used for Northern blot analysis of total lung RNA reacted with the 0.8 kb mRNA species of endogenous mouse SP-A (Figure 2). In the rSP-A animals there were two intense bands, at 0.8-0.9 kb and 1.6 kb, respectively, which were consistent with the expression of a 0.9-kb rSP-A mRNA (overlying the 0.8-kb mouse RNA band) and a 1.6-kb rSP-A mRNA.


View larger version (52K):
[in this window]
[in a new window]
 
Figure 1.   (A) Transgene construction. The cloning vector p3.7SP-C-SV40 (18) was used to construct the transgene. A 1.6-kb cDNA for rSP-A (17) was inserted into the unique EcoR1 site downstream of the human SP-C promoter and upstream of the SV40 small T-intron and polyadenylation signal. (B) PCR analysis of genomic DNA. Three founders were identified from 40 total progeny (11 are shown) by PCR analysis of ear-clip DNA with primers that amplified a 900-bp region of rSP-A cDNA. Control primers that amplified a 400-bp region of the mouse THSbeta locus were included. (C) Southern blot analysis of genomic DNA. Genotype was determined by Southern blotting of EcoR1-digested tail DNA, using an rSP-A cDNA probe. Transgene-positive mice (+) were distinguished from nontransgenic mice (-) by the presence of a 1.6-kb band.


View larger version (70K):
[in this window]
[in a new window]
 
Figure 2.   SP-A mRNA in rSP-A and wild-type mice. Total lung RNA from two transgene-negative and two transgene-positive rSP-A littermates was probed with a 32P-labeled rat SP-A cDNA probe. Genotype (transgene negative [-] or transgene positive [+]) is depicted below the lanes.

Rest and Exercise Physiology

All rSP-A mice had a normal appearance, normal resting respiratory rate, perinatal survival, and normal postnatal weight gain when compared with nontransgenic littermates (not shown). The physiologic consequences of overexpression of SP-A were determined by examining resting lung mechanics and exercise tolerance. The total and tissue-specific compliance of the lungs of the rSP-A mice were determined by recording intratracheal pressures of air-filled and saline-filled lungs, respectively, through the linear portion of the deflation curve from +10 to -10 cm H2O (Table 1). The mean lung compliance of the lungs of the rSP-A mice inflated with air (4.48 ± 0.37 ml-cm H2O/g, n = 6) was not significantly different from that of the nontransgenic animals (4.09 ± 0.83 ml-cm H2O/g, n = 5). There was also no significant difference in the mean tissue-specific lung compliance of saline-inflated transgenic mouse lungs (6.58 ± 1.26 ml-cm H2O/g, n = 8) and those of nontransgenic littermates (5.75 ± 0.75 ml-cm H2O/g, n = 7). The swimming exercise tolerance of the rSP-A-2 mice did not differ from that of their nontransgenic littermates. The time required for half of the rSP-A-2 mice to tire and be removed from the tank was 6.8 min, as compared with 7.5 min for the nontransgenic animals (P = NS) (Figure 3). Log-rank analysis did not reveal any difference in the attrition curves for the two groups of animals over the course of the entire experiment (P = 0.38).

                              
View this table:
[in this window]
[in a new window]
 

TABLE 1
Lung compliance in transgenic mice and control littermates


View larger version (17K):
[in this window]
[in a new window]
 
Figure 3.   Swimming exercise tolerance in rSP-A and wild-type mice. Transgenic rSP-A mice and nontransgenic littermates were placed in a warm water tank and observed while swimming. Animals that tired were removed from the tank after the eighth head submersion.

Histologic and Immunohistochemical Characterization of the Lungs from rSP-A Mice

The lungs of the rSP-A mice were histologically unremarkable, with no evidence of inflammation or fibrosis in those of most of the rSP-A-1 and rSP-A-2 mice examined (Figure 4A). In approximately 15% of 30 mice examined from both transgenic lines, there were focal areas of air space enlargement and decreased alveolar septation (Figure 4B). Calculation of mean linear intercepts (Lm) in 10 random fields did not show significant differences in air space size for rSP-A mice as compared with nontransgenic mice in siblings from a single litter from the rSP-A-2 line. The Lm was 41.39 ± 1.17 (n = 4) in the transgene-positive mice and 37.87 ± 3.08 (n = 4) in the transgene-negative mice (P > 0.1). Immunohistochemical staining of lung sections from both the nontransgenic mice (Figure 4C) and their transgenic littermates (Figure 4D) with anti-rSP-A IgG was limited to type II cells and nonciliated bronchiolar cells of the pulmonary epithelium, but the intensity of staining was increased in the rSP-A-2 mice compared with the nontransgenic controls. Ultrastructural analysis of alveolar type II cells of the transgenic mice revealed no abnormalities. However, approximately 15% of the alveolar macrophages of the rSP-A mice from some litters contained rod-shaped osmophilic inclusions with a highly ordered lamellated structure (Figure 5). There was significant variation in the abundance of inclusions between litters, but they were not seen in the transgene-negative controls. Postfixation immunostaining with a gold-labeled polyclonal anti-rSP-A antibody did not suggest that the inclusions were enriched for SP-A (not shown), but it is difficult to be certain that the integrity of antigens is preserved under the conditions of such staining.


View larger version (158K):
[in this window]
[in a new window]
 
Figure 4.   Lung morphology of pressure-controlled inflation-fixed lungs. Low power (original magnification: ×10) view of H&E-stained lung sections of wild-type (A) and rSP-A-2 (B) mice revealed focally dilated air spaces in 15% of the transgenic mice. Immunohistochemical staining of alveolar type II cells (arrows) and nonciliated bronchiolar cells (not shown) with polyclonal anti-rSP-A antibody was present in lung sections from nontransgenic mice (C), but was more intense in rSP-A mice (D) (original magnification: ×100).


View larger version (136K):
[in this window]
[in a new window]
 
Figure 5.   Ultrastructural analyses of AM from rSP-A mice. (A) Low-power view of rod-shaped osmophilic inclusions present in 15% of AM of rSP-A mice but not present in transgene-negative controls. (B) Under higher magnification, inclusions are shown to have a highly ordered lamellated appearance. Some but not all inclusions appeared to be delimited by a membrane.

Surfactant Components

SP-A overexpression was assessed with a polyclonal anti-rSP-A IgG in an immunoblot analysis and sandwich-type ELISA. As has been previously reported (8), immunoblot analysis of alveolar lavage fluid from the nontransgenic mice revealed that migration of the mouse SP-A was very similar to that of rSP-A (25), producing broad bands at 32 and 38 kD in both cases (Figure 6). This result is not surprising, since there is 91% identity between rat and mouse SP-A at the amino acid level. There was also a narrow immunoreactive band at 26 kD in the rSP-A mice, corresponding to the nonglycosylated form of the protein that is characteristic of rSP-A. The lanes were loaded for detection of the 26 kD SP-A species, and were not optimal for comparison of SP-A levels, but there was a 1.8-fold increase in densitometric abundance of SP-A in the rSP-A mice. There were no consistent differences in the alveolar lavage levels of SP-D by immunoblot analysis. To examine the role of SP-A in surfactant homeostasis, we quantified the levels of SP-A and satPC in lavage fluid and homogenized lung tissue of the rSP-A mice (n = 17) and their transgene-negative littermates (n = 8) in the highest SP-A-producing line, rSP-A-2 (Figure 7). The level of SP-A as determined through ELISA was much higher in the transgenic animals than in their transgene-negative littermates, by more than 8.0-fold in lavage fluid (89.3 ± 5.0 versus 11.1 ± 5.3 µg SP-A/kg body weight [BW], respectively) and by 7.5-fold in lung tissue (116.5 ± 28.2 versus 15.5 ± 7.8 µg SP-A/kg BW, respectively). The marked increase in SP-A levels did not affect the levels of satPC in the lavage fluid (11.7 ± 1.5 versus 12.2 ± 1.9 µmol PC/kg BW for rSP-A mice versus control mice, respectively) or in the lung homogenate (40 ± 6.8 versus 36.0 ± 3.2 µmol PC/kg BW for rSP-A mice versus control mice, respectively). The ratio of SP-A/satPC (in µg/µmol) was 7.64 ± 1.81 for rSP-A mice and 0.88 ± 0.33 for their transgene-negative littermates (mean ± SD, P < 0.001). There were also no significant differences in the composition of LA surfactant composition in alveolar lavage fluid from the rSP-A mice (35.0 ± 2.5%, n = 7) and their transgene-negative littermate controls (32.6 ± 2.6%, n = 7) (P = NS).


View larger version (50K):
[in this window]
[in a new window]
 
Figure 6.   Immunoblot analysis of SP-A and SP-D in rSP-A and wild-type mice. Equivalent aliquots of the alveolar lavage fluid from transgene-negative (-) and transgene-positive (+) mice were reduced with beta -mercaptoethanol and loaded onto an 8-16% SDS-polyacrylamide gel and electrophoresed, with the bands transferred to nitrocellulose and blotted with anti-rSP-A (B) and SP-D (A) antibodies as described in MATERIALS AND METHODS.


View larger version (38K):
[in this window]
[in a new window]
 
Figure 7.   SP-A and satPC in alveolar lavage fluid and lung tissue of rSP-A and wild-type mice. The alveolar wash and the lung homogenates were assayed for SP-A with ELISA, and for satPC according to the method of Mason and coworkers (22).

Surfactant Function

The surface activities of LA surfactant from rSP-A mice and from their transgene-negative littermates were compared through use of the captive bubble surfactometer. The results are shown in Figure 8. In the absence of inhibitors, the surfactant isolated from the rSP-A mice and from their transgene-negative littermates had minimum surface tensions of 1.1 ± 0.3 mN/m (n = 3 sets of three mice each) versus 1.4 ± 0.5 mN/m (n = 3 sets of three mice each) (P = NS), respectively, and equilibrium surface tensions of 21.3 ± 0.5 mN/m (n = 3 sets of three mice each) versus 21.0 ± 0.3 mN/m (n = 3 sets of three mice each) (P = NS), respectively. In the presence of 0.93 mg/ml serum protein, the surface activity of surfactant from control mice was inhibited to a greater extent than surfactant from the rSP-A mice. With inhibitor present, the minimum surface tension of the rSP-A surfactant was 8.9 ± 2.6 mN/m (n = 6 sets of three mice each), as compared with 16.7 ± 2.4 mN/m (n = 7 sets of three mice each) for the controls (P < 0.05), and the equilibrium surface tension of surfactant from the rSP-A mice was 29.0 ± 5.1 mN/m (n = 6 sets of three mice each) as compared with 45.0 ± 4.4 mN/m for their transgene-negative littermates (n = 7 sets of three mice each) (P < 0.05).


View larger version (36K):
[in this window]
[in a new window]
 
Figure 8.   Surface activity of surfactant isolated from rSP-A and control mice. Pooled surfactants from rSP-A mice and their transgene-negative littermates were measured with the captive bubble surfactometer.

    Discussion
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The primary objective of this study was to examine the effect of overexpression of SP-A on surfactant pool sizes. Our hypothesis was that lung-specific overexpression of SP-A in transgenic mice would result in enrichment of surfactant phospholipids in the intracellular compartment. We found that alveolar levels of SP-A that were as much as 7- to 8-fold higher in transgenic mice than in controls did not affect the distribution of the major surfactant phospholipid, satPC, between the air space and lung tissue. Further, overexpression of SP-A did not appear to disrupt lung function, since the rSP-A mice showed normal exercise tolerance, lung compliance, and ex vivo surfactant function. In the presence of protein inhibitors, however, surfactant isolated from the rSP-A mice was more resistant to protein inhibition than that from control littermates. We conclude that increased levels of SP-A do not affect the steady-state levels of surfactant phospholipids in the normal lung, but contribute to the integrity of alveolar surfactant in the presence of protein inhibitors.

Surfactant dysfunction caused by proteinaceous pulmonary edema plays a central role in the pathophysiology of the acute respiratory distress syndrome (28, 29). The molecular interactions that preserve the integrity of the surfactant film in the injured lung are just beginning to be understood (30, 33, 34). Cockshutt and associates were the first to demonstrate that SP-A increases the resistance of surfactant to protein inhibition in vitro (9, 35). Yukitake and coworkers showed that SP-A also improved lung compliance in vivo in surfactant-deficient premature rabbits given surfactant preparations that were mixed with serum protein inhibitors (10). Recently, Ikegami and colleagues reported that the surface activity of surfactant isolated from SP-A deficient mice is more susceptible to protein inhibition (14). In the present study we show that overexpression of SP-A in transgenic mice enhances the resistance of surfactant to inhibitors. Collectively, the available data suggest that SP-A may have a physiologic role in maintaining the integrity of surfactant in the presence of lung injury. The addition of SP-A to surfactant replacement reagents may enhance their resistance to inactivation when given to patients with proteinaceous pulmonary edema (36, 37).

Surfactant isolated by bronchoalveolar lavage contains two major subfractions, called large surfactant aggregates and small surfactant aggregates, that differ in morphologic appearance, protein composition, buoyant density, and surface activity (38). SP-A has been shown to inhibit the conversion of surface-active LAs to the inactive SAs during surface-area cycling in vitro (39). SP-A deficiency in the SP-A gene-targeted mouse resulted in an LA content that was less than one-third that of control mice of the same strain (14). In contrast, we found that a 7-fold increase in the level of SP-A in the alveolar space did not result in a significant increase in the LA pool size. These data suggest that SP-A concentrations in excess of physiologic levels do not affect the surfactant subtype composition of surfactant.

Surfactant phospholipid levels in the alveolar space must be tightly regulated. Reports from several laboratories that SP-A enhances the uptake (40) and inhibits the secretion (41) of surfactant from isolated type II cells through a high-affinity-receptor-mediated mechanism (11) have suggested a role for SP-A in surfactant homeostasis. The unexpected finding that SP-A gene-targeted animals had normal surfactant pool sizes did not support this hypothesis, but regulation of surfactant phospholipid levels by a redundant mechanism could not be completely excluded (8). In the present study, the failure of markedly increased levels of SP-A to perturb steady-state surfactant pool sizes provides further evidence that SP-A is not a critical determinant of alveolar surfactant concentrations in the normal lung. Although rSP-A and mouse SP-A are 91% identical at the amino acid level, it is possible that the function of rSP-A expressed in mice is inherently different from that of mouse SP-A, or that heteroligomerization of rat and mouse SP-A in rSP-A mice affects the function of both proteins. That the antiinhibitor function of SP-A remains intact in rSP-A mice argues that the rSP-A overexpression model accurately reflects the functional consequences of SP-A excess.

Recently, several laboratories have reported that SP-A binds to multiple microorganisms and influences alveolar macrophage (AM) functions including chemotaxis (44), release of toxic oxygen species including nitric oxide (45, 46), and phagocytosis (47). Deficiency of SP-A in the gene-targeted animal results in increased susceptibility to pulmonary infection with group B streptococci, through a mechanism that appears to be macrophage-dependent (16). Although the host defense properties of SP-A were not directly addressed in the present study, we found that macrophage ultrastructure was abnormal in the rSP-A mice. The ordered, osmophilic macrophage inclusions that we observed in some AM from rSP-A mice in this study had a periodicity that was more consistent with crystalline protein than with phospholipid lattices (Nades Palyshar, M.D., personal communication). Immunogold labeling with a polyclonal anti-SP-A antibody did not demonstrate enrichment for SP-A in the inclusions, but the integrity of the SP-A antigen with use of this postfixation technique is unclear. Similar inclusions have been reported in smokers (48). Overexpression of SP-A clearly has an effect on macrophage structure, but further studies will be required to determine the nature and significance of the macrophage inclusions.

The focal dilation of distal air spaces in some of the rSP-A mice in our study also remains unexplained. Not all transgene-positive mice within a single litter had focal air space dilation, and the changes we observed were not sufficiently severe or diffuse to be detectable by morphometric analyses of randomly chosen fields or by measurement of lung compliance. The variability in expression of histologic lesions among transgenic animals may have been due to a yet undefined environmental cofactor. Experiments are in progress to attempt to enhance the severity and extent of the histologic lesions in rSP-A mice by breeding these mice to homozygosity, by exposure of the animals to inhaled agents, and by aging of the animals. The availability of a transgenic model with a consistent emphysema-like phenotype would be a valuable tool for the study of obstructive lung disease.

In summary, we find that high-level overexpression of SP-A in the respiratory epithelium of transgenic mice does not perturb resting lung mechanics, exercise tolerance, or resting surfactant phospholipid pool sizes. Surfactant isolated from the SP-A overexpressing animals in our study exhibited enhanced resistance to foreign protein inhibitors. Future studies will explore the effect of overexpression of SP-A on host defense and pulmonary function after lung injury.

    Footnotes

Abbreviations: enzyme-linked immunosorbent assay, ELISA; large aggregate, LA; nonsignificant, NS; small aggregate, SA; surfactant protein-A, SP-A; saturated phosphatidylcholine, satPC; rat surfactant protein-A, rSP-A.

(Received in original form January 28, 1999 and in revised form March 31, 1999).

Acknowledgments: The authors thank Jeffrey Whitsett, M.D., and Stephen Glasser, Ph.D., for the gift of the SP-C promoter and helpful discussions, and Susan Wert and Sherri Proffitt for help with the immunostaining. This work was supported in part by grant 61612 from the National Heart, Lung, and Blood Institute (F.X.M.), the Medical Research Service Department of Veteran Affairs (F.X.M.), grant 06096 from the National Institute of Environmental and Health Sciences (M.L.M., F.X.M.), and grant HD-11932 from the National Institutes of Health (M.I.).
    References
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Goerke, J., and J. A. Clements. 1986. Mechanics of breathing. In P. T. Macklem and J. Mead, editors. Handbook of Physiology. American Physiological Society, Bethesda, MD. 247-261.

2. Hawgood, S., B. J. Benson, J. Schilling, D. Damm, J. A. Clements, and R. T. White. 1987. Nucleotide and amino acid sequences of pulmonary surfactant protein SP 18 and evidence for cooperation between SP-18 and SP 28-36 in surfactant lipid adsorption. Proc. Natl. Acad. Sci. USA 84: 66-70 [Abstract/Free Full Text].

3. Kuroki, Y., F. X. McCormack, Y. Ogasawara, R. J. Mason, and D. R. Voelker. 1994. Epitope mapping for monoclonal antibodies identifies functional domains of pulmonary surfactant protein A that interact with lipids. J. Biol. Chem. 269: 29793-29800 [Abstract/Free Full Text].

4. McCormack, F. X., J. J. Stewart, D. R. Voelker, and M. D. Damodarasamy. 1997. Alanine mutagenesis of SP-A reveals that lipid binding and pH-dependent aggregation of liposomes are mediated by the carbohydrate recognition domain of SP-A. Biochemistry 36:13963-13971.

5. King, R. J.. 1984. Lipid-apoprotein interactions in surfactant studied by reassembly. Exp. Lung Res. 6: 237-253 [Medline].

6. Hawgood, S., B. Benson, and R. J. Hamilton. 1985. Effects of a surfactant-associated protein and calcium ions on the structure and surface activity of lung surfactant lipids. Biochemistry 24: 184-190 [Medline].

7. Suzuki, Y., Y. Fujita, and K. Kogishi. 1989. Reconstitution of tubular myelin from synthetic lipids and proteins associated with pig pulmonary surfactant. Am. Rev. Respir. Dis. 140: 75-81 [Medline].

8. Korfhagen, T. R., M. D. Bruno, G. F. Ross, K. M. Huelsman, M. Ikegami, A. H. Jobe, S. E. Wert, B. R. Stripp, R. E. Morris, S. W. Glasser, C. J. Bachurski, H. S. Iwamoto, and J. A. Whitsett. 1996. Altered surfactant function and structure in SP-A gene targeted mice. Proc. Natl. Acad. Sci. USA 93: 9594-9599 [Abstract/Free Full Text].

9. Cockshutt, A. M., J. Weitz, and F. Possmayer. 1990. Pulmonary surfactant protein A enhances the surface activity of lipid extract surfactant and reverses inhibition by blood proteins in vitro. Biochemistry 29: 8424-8429 [Medline].

10. Yukitake, K., C. L. Brown, M. A. Schlueter, J. A. Clements, and S. Hawgood. 1994. Surfactant apoprotein A modifies the inhibitory effect of plasma proteins on surfactant activity in vivo. Pediatr. Res. 37: 21-25 [Medline].

11. Ryan, R. M., R. E. Morris, W. R. Rice, G. Ciraolo, and J. A. Whitsett. 1989. Binding and uptake of pulmonary surfactant protein (SP-A) by pulmonary type II epithelial cells. J. Histochem. Cytochem. 37: 429-440 [Abstract].

12. Kuroki, Y., R. J. Mason, and D. R. Voelker. 1988. Alveolar type II cells express a high-affinity receptor for pulmonary surfactant protein A.  Proc. Natl. Acad. Sci. USA 85: 5566-5570 [Abstract/Free Full Text].

13. Wright, J. R., J. D. Borchelt, and S. Hawgood. 1989. Lung surfactant apoprotein SP-A (26-36 kDa) binds with high affinity to isolated alveolar type II cells. Proc. Natl. Acad. Sci. USA 86: 5410-5414 [Abstract/Free Full Text].

14. Ikegami, M., T. R. Korfhagen, J. A. Whitsett, M. D. Bruno, S. E. Wert, K. Wada, and A. H. Jobe. 1998. Characteristics of surfactant from SP-A-deficient mice. Am. J. Physiol. 275 (2 Pt. 1):L247-L254.

15. Wright, J. R.. 1997. Immunomodulatory functions of surfactant. Physiol. Rev. 77: 931-962 [Abstract/Free Full Text].

16. LeVine, A. M., M. D. Bruno, K. M. Huelsman, G. F. Ross, J. A. Whitsett, and T. R. Korfhagen. 1997. Surfactant protein A-deficient mice are susceptible to group B streptococcal infection. J. Immunol. 158: 4336-4340 [Abstract].

17. Sano, K., J. Fisher, R. J. Mason, Y. Kuroki, J. Schilling, B. Benson, and D. Voelker. 1987. Isolation and sequence of a cDNA clone for the rat pulmonary surfactant-associated protein (PSP-A). Biochem. Biophys. Res. Commun. 144: 367-374 [Medline].

18. Glasser, S. W., T. R. Korfhagen, S. E. Wert, M. D. Bruno, D. K. McWilliams, D. K. Vorbroker, and J. A. Whitsett. 1991. Genetic element from a human surfactant protein gene confers bronchiolar-alveolar cell specificity in transgenic mice. Am. J. Physiol. (Lung Cell Mol. Physiol.) 261: L349-L356 [Abstract/Free Full Text].

19. Dunhill, M. S.. 1962. Quantitative methods in the study of pulmonary pathology. Thorax 17: 320-328 [Free Full Text].

20. McCormack, F. X., J. H. Fisher, A. Suwabe, D. L. Smith, J. M. Shannon, and D. R. Voelker. 1990. Expression and characterization of rat surfactant protein A synthesized in Chinese hamster ovary cells. Biochim. Biophys. Acta 1087: 190-198 [Medline].

21. Bligh, E. G., and W. J. Dyer. 1959. A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 37: 911-917 .

22. Mason, R. J., J. A. Nellenbogen, and J. A. Clements. 1976. Isolation of disaturated phosphatidylcholine with osmium tetroxide. J. Lipid. Res. 17: 281-284 [Abstract].

23. Bartlett, G. R.. 1959. Phosphorus assay in column chromatography. J. Biol. Chem. 234: 466-468 [Free Full Text].

24. Schurch, S., H. Bachofen, J. Goerke, and F. Possmayer. 1989. A captive bubble method reproduces the in situ behavior of lung surfactant monolayers. J. Appl. Physiol. 67: 2389-2396 [Abstract/Free Full Text].

25. McCormack, F. X., A. L. Festa, R. P. Andrews, M. Linke, and P. D. Walzer. 1997. The carbohydrate recognition domain of surfactant protein A mediates binding to the major surface glycoprotein of P. Carinii. Biochemistry 36: 8092-8099 [Medline].

26. Korfhagen, T. R., V. Sheftelyevich, M. S. Burhans, M. D. Bruno, G. F. Ross, S. E. Wert, M. T. Stahlman, A. H. Jobe, M. Ikegami, J. A. Whitsett, and J. H. Fisher. 1998. Surfactant protein-D regulates surfactant phospholipid homeostasis in vivo. J. Biol. Chem. 273: 28438-28443 [Abstract/Free Full Text].

27. Shimizu, H., J. H. Fisher, P. Papst, B. Benson, K. Lau, R. J. Mason, and D. R. Voelker. 1992. Primary structure of rat pulmonary surfactant protein D: cDNA and deduced amino acid sequence. J. Biol. Chem. 267: 1853-1857 [Abstract/Free Full Text].

28. Ashbaugh, D. G., C. B. Bigelow, T. L. Petty, and B. E. Levine. 1967. Acute respiratory distress in adults. Lancet 2: 319-323 [Medline].

29. Gregory, T. J., W. J. Longmore, M. A. Moxeley, J. A. Whitsett, C. R. Reed, A. A. Fowler, L. D. Hudson, R. J. Maunder, C. Crim, and T. M. Hyers. 1991. Surfactant chemical composition and biophysical activity in acute respiratory distress syndrome. J. Clin. Invest. 88: 1976-1981 .

30. Seeger, W., C. Grube, A. Gunther, and R. Schmidt. 1993. Surfactant inhibition by plasma proteins: differential sensitivity of various surfactant preparations. Eur. Respir. J. 6: 971-977 [Abstract].

31. Bruni, R., B. R. Fan, R. David-Cu, H. W. Taeusch, and F. J. Walther. 1996. Inactivation of surfactant in rat lungs. Pediatr. Res. 39: 236-240 [Medline].

32. Seeger, W., G. Stohr, H. R. Wolf, and H. Neuhof. 1985. Alteration of surfactant function due to protein leakage: special interaction with fibrin monomer. J. Appl. Physiol. 58: 326-338 [Abstract/Free Full Text].

33. Kobayashi, T., K. Nitta, M. Ganzuka, S. Inui, G. Grossmann, and B. Robertson. 1991. Inactivation of exogenous surfactant by pulmonary edema fluid. Pediatr. Res. 29:(Pt. 1):353-356.

34. Bummer, P. M., L. P. Sanders, T. H. Pauly, and M. N. Gillespie. 1994. In vitro inactivation of pulmonary surfactant replacement preparations by serum albumin. Am. J. Med. Sci. 307: 401-404 [Medline].

35. Venkitaraman, A. R., J. E. Baatz, J. A. Whitsett, S. B. Hall, and R. H. Notter. 1990. Biophysical inhibition of synthetic phospholipid-apoprotein mixtures by plasma proteins. Chem. Phys. Lipids 57: 49-57 .

36. Anzueto, A., R. P. Baughman, K. K. Guntupalli, J. G. Weg, H. P. Wiedemann, A. A. Raventos, F. Lemaire, W. Long, D. S. Zaccardelli, and E. N. Pattishall. 1996. Aerosolized surfactant in adults with sepsis-induced acute respiratory distress syndrome. N. Engl. J. Med. 334: 1417-1421 [Abstract/Free Full Text].

37. Gregory, T. J., K. P. Steinberg, R. Spragg, J. E. Gadek, T. M. Hyers, W. J. Longmore, M. A. Moxley, G. Z. Cai, R. D. Hite, R. M. Smith, L. D. Hudson, C. Crim, P. Newton, B. R. Mitchell, and A. J. Gold. 1997. Bovine surfactant therapy for patients with acute respiratory distress syndrome. Am. J. Respir. Crit. Care Med. 155: 1309-1315 [Abstract].

38. Magoon, M. W., J. R. Wright, A. Baritussio, M. C. Williams, J. Goerke, B. Benson, R. L. Hamilton, and J. A. Clements. 1983. Subfractionation of lung surfactant: implications for metabolism and surface activity. Biochim. Biophys. Acta. 750: 18-31 [Medline].

39. Veldhuizen, R. A., L. J. Yao, S. A. Hearn, F. Possmayer, and J. F. Lewis. 1996. Surfactant-associated protein A is important for maintaining surfactant large-aggregate forms during surface-area cycling. Biochem. J. 313: 835-840 .

40. Wright, J. R., R. E. Wager, R. L. Hamilton, M. Huang, and J. A. Clements. 1986. Uptake of lung surfactant subfractions into lamellar bodies of adult rabbit lungs. J. Appl. Physiol. 60: 817-825 [Abstract/Free Full Text].

41. Rice, W. R., G. F. Ross, F. M. Singleton, S. Dingle, and J. A. Whitsett. 1987. Surfactant-associated protein inhibits phospholipid secretion from type II cells. J. Appl. Physiol. 63: 692-698 [Abstract/Free Full Text].

42. Dobbs, L. G., J. R. Wright, S. Hawgood, R. Gonzalez, K. Venstrom, and J. Nellenbogen. 1987. Pulmonary surfactant and its components inhibit secretion of phosphatidylcholine from cultured rat alveolar type II cells. Proc. Natl. Acad. Sci. USA 84: 1010-1014 [Abstract/Free Full Text].

43. Kuroki, Y., R. J. Mason, and D. R. Voelker. 1988. Pulmonary surfactant apoprotein A structure and modulation of surfactant secretion by rat alveolar type II cells. J. Biol. Chem. 263: 3388-3394 [Abstract/Free Full Text].

44. Wright, J. R., and D. C. Youmans. 1993. Pulmonary surfactant protein A stimulates chemotaxis of alveolar macrophage. Am. J. Physiol. 264: L338-L344 [Abstract/Free Full Text].

45. Weissbach, S., A. Neuendank, M. Pettersson, T. Schaberg, and U. Pison. 1994. Surfactant protein A modulates release of reactive oxygen species from alveolar macrophages. Am. J. Physiol. 267: L660-L664 [Abstract/Free Full Text].

46. Blau, H., S. Riklis, D. Minc-Golomb, J. F. van Iwaarden, F. X. McCormack, and M. Kalina. 1997. Nitric oxide production by rat alveolar macrophages can be modulated in vitro by surfactant protein A.  Am. J. Physiol. 272: L1198-L1204 [Abstract/Free Full Text].

47. McNeely, T. B., and J. D. Coonrod. 1994. Aggregation and opsonization of type A but not type B Hemophilus influenzae by surfactant protein A.  Am. J. Respir. Cell. Mol. Biol. 11: 114-122 [Abstract].

48. Brody, A. R., and J. E. Craighead. 1975. Cytoplasmic inclusions in pulmonary macrophages of cigarette smokers. Lab. Invest. 32: 125-132 [Medline].





This article has been cited by other articles:


Home page
IOVSHome page
L. Brauer, C. Kindler, K. Jager, S. Sel, B. Nolle, U. Pleyer, M. Ochs, and F. P. Paulsen
Detection of Surfactant Proteins A and D in Human Tear Fluid and the Human Lacrimal System
Invest. Ophthalmol. Vis. Sci., September 1, 2007; 48(9): 3945 - 3953.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
L. Zhang, M. Ikegami, T. R. Korfhagen, F. X. McCormack, M. Yoshida, R. M. Senior, J. M. Shipley, S. D. Shapiro, and J. A. Whitsett
Neither SP-A nor NH2-terminal domains of SP-A can substitute for SP-D in regulation of alveolar homeostasis
Am J Physiol Lung Cell Mol Physiol, August 1, 2006; 291(2): L181 - L190.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
V. Starosta, E. Rietschel, K. Paul, U. Baumann, and M. Griese
Oxidative Changes of Bronchoalveolar Proteins in Cystic Fibrosis.
Chest, February 1, 2006; 129(2): 431 - 437.
[Abstract] [Full Text] [PDF]


Home page
J Med MicrobiolHome page
M. Linke, A. Ashbaugh, J. Koch, R. Tanaka, and P. Walzer
Efficient resolution of Pneumocystis murina infection in surfactant protein A-deficient mice following withdrawal of corticosteroid-induced immunosuppression
J. Med. Microbiol., February 1, 2006; 55(2): 143 - 147.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
P. E. Cogo, G. M. Toffolo, A. Gucciardi, A. Benetazzo, C. Cobelli, and V. P. Carnielli
Surfactant disaturated phosphatidylcholine kinetics in infants with bronchopulmonary dysplasia measured with stable isotopes and a two-compartment model
J Appl Physiol, July 1, 2005; 99(1): 323 - 329.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. C. Condon, P. Jeyasuria, J. M. Faust, and C. R. Mendelson
Surfactant protein secreted by the maturing mouse fetal lung acts as a hormone that signals the initiation of parturition
PNAS, April 6, 2004; 101(14): 4978 - 4983.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
T. Herrmann, F. van der Hoeven, H.-J. Grone, A. F. Stewart, L. Langbein, I. Kaiser, G. Liebisch, I. Gosch, F. Buchkremer, W. Drobnik, et al.
Mice with targeted disruption of the fatty acid transport protein 4 (Fatp 4, Slc27a4) gene show features of lethal restrictive dermopathy
J. Cell Biol., June 23, 2003; 161(6): 1105 - 1115.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
R. Epaud, M. Ikegami, J. A. Whitsett, A. H. Jobe, T. E. Weaver, and H. T. Akinbi
Surfactant Protein B Inhibits Endotoxin-Induced Lung Inflammation
Am. J. Respir. Cell Mol. Biol., March 1, 2003; 28(3): 373 - 378.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
W. R. Rice, J. J. Conkright, C.-L. Na, M. Ikegami, J. M. Shannon, and T. E. Weaver
Maintenance of the mouse type II cell phenotype in vitro
Am J Physiol Lung Cell Mol Physiol, August 1, 2002; 283(2): L256 - L264.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Palaniyar, L. Zhang, A. Kuzmenko, M. Ikegami, S. Wan, H. Wu, T. R. Korfhagen, J. A. Whitsett, and F. X. McCormack
The Role of Pulmonary Collectin N-terminal Domains in Surfactant Structure, Function, and Homeostasis in Vivo
J. Biol. Chem., July 19, 2002; 277(30): 26971 - 26979.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
O. A. Quintero, T. R. Korfhagen, and J. R. Wright
Surfactant protein A regulates surfactant phospholipid clearance after LPS-induced injury in vivo
Am J Physiol Lung Cell Mol Physiol, July 1, 2002; 283(1): L76 - L85.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Zhang, K. L. Hartshorn, E. C. Crouch, M. Ikegami, and J. A. Whitsett
Complementation of Pulmonary Abnormalities in SP-D(-/-) Mice with an SP-D/Conglutinin Fusion Protein
J. Biol. Chem., June 14, 2002; 277(25): 22453 - 22459.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. M. Klein, T. A. McCarthy, J. M. Dagle, and J. M. Snyder
Pre- and Postnatal Lung Development, Maturation, and Plasticity: Antisense inhibition of surfactant protein A decreases tubular myelin formation in human fetal lung in vitro
Am J Physiol Lung Cell Mol Physiol, March 1, 2002; 282(3): L386 - L393.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
J. L. Malloy, R. A. W. Veldhuizen, F. X. McCormack, T. R. Korfhagen, J. A. Whitsett, and J. F. Lewis
Pulmonary surfactant and inflammation in septic adult mice: role of surfactant protein A
J Appl Physiol, February 1, 2002; 92(2): 809 - 816.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
B. C. Harrison, M. L. Bell, D. L. Allen, W. C. Byrnes, and L. A. Leinwand
Skeletal muscle adaptations in response to voluntary wheel running in myosin heavy chain null mice
J Appl Physiol, January 1, 2002; 92(1): 313 - 322.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. J. Conkright, C.-L. Na, and T. E. Weaver
Overexpression of Surfactant Protein-C Mature Peptide Causes Neonatal Lethality in Transgenic Mice
Am. J. Respir. Cell Mol. Biol., January 1, 2002; 26(1): 85 - 90.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. Ochs, G. Johnen, K.-M. Muller, T. Wahlers, S. Hawgood, J. Richter, and F. Brasch
Intracellular and Intraalveolar Localization of Surfactant Protein A (SP-A) in the Parenchymal Region of the Human Lung
Am. J. Respir. Cell Mol. Biol., January 1, 2002; 26(1): 91 - 98.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Ikegami, B. M. Elhalwagi, N. Palaniyar, K. Dienger, T. Korfhagen, J. A. Whitsett, and F. X. McCormack
The Collagen-like Region of Surfactant Protein A (SP-A) Is Required for Correction of Surfactant Structural and Functional Defects in the SP-A Null Mouse
J. Biol. Chem., October 12, 2001; 276(42): 38542 - 38548.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
R. G. SPRAGG and J. F. LEWIS
Pathology of the Surfactant System of the Mature Lung . Second San Diego Conference
Am. J. Respir. Crit. Care Med., January 1, 2001; 163(1): 280 - 282.
[Full Text]


Home page
J. Appl. Physiol.Home page
M. Ikegami, A. H. Jobe, J. Whitsett, and T. Korfhagen
Tolerance of SP-A-deficient mice to hyperoxia or exercise
J Appl Physiol, August 1, 2000; 89(2): 644 - 648.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. A. Reed, M. Ikegami, L. Robb, C. G. Begley, G. Ross, and J. A. Whitsett
Distinct changes in pulmonary surfactant homeostasis in common beta -chain- and GM-CSF-deficient mice
Am J Physiol Lung Cell Mol Physiol, June 1, 2000; 278(6): L1164 - L1171.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Paine III, A. M. Preston, S. Wilcoxen, H. Jin, B. B. Siu, S. B. Morris, J. A. Reed, G. Ross, J. A. Whitsett, and J. M. Beck
Granulocyte-Macrophage Colony-Stimulating Factor in the Innate Immune Response to Pneumocystis carinii Pneumonia in Mice
J. Immunol., March 1, 2000; 164(5): 2602 - 2609.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Mishra, T. E. Weaver, D. C. Beck, and M. E. Rothenberg
Interleukin-5-mediated Allergic Airway Inflammation Inhibits the Human Surfactant Protein C Promoter in Transgenic Mice
J. Biol. Chem., March 9, 2001; 276(11): 8453 - 8459.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elhalwagi, B. M.
Right arrow Articles by McCormack, F. X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elhalwagi, B. M.
Right arrow Articles by McCormack, F. X.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 1999 American Thoracic Society.