help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Billington, C. K.
Right arrow Articles by Penn, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Billington, C. K.
Right arrow Articles by Penn, R. B.
Am. J. Respir. Cell Mol. Biol., Volume 21, Number 5, November 1999 597-606

Inflammatory and Contractile Agents Sensitize Specific Adenylyl Cyclase Isoforms in Human Airway Smooth Muscle

Charlotte K. Billington, Ian P. Hall, Stuart J. Mundell, Jean-Luc Parent, Reynold A. Panettieri Jr., Jeffrey L. Benovic, and Raymond B. Penn

Department of Therapeutics, Institute of Cell Signalling, University Hospital of Nottingham, Nottingham, United Kingdom; Division of Pulmonary and Critical Care, Department of Medicine, University of Pennsylvania School of Medicine; and Department of Microbiology and Immunology, Kimmel Cancer Institute, Thomas Jefferson University, Philadelphia, Pennsylvania


    Abstract
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

beta -agonists, through activation of the beta 2-adrenergic receptor (beta 2AR)-Gs-adenylyl cyclase (AC) pathway, promote bronchodilation via functional antagonism of airway smooth muscle (ASM) spasmogens associated with the asthmatic state. Although previous studies have demonstrated that beta 2AR signaling in ASM is subject to homologous (beta -agonist-induced) beta 2AR desensitization, the potential for inflammatory and contractile agents to impact beta 2AR signaling in ASM through heterologous mechanisms has not been defined. Here we report that chronic exposure of human ASM (HASM) to carbachol, serotonin, the thromboxane analogue U46619, or histamine induced little change or a small increase in isoproterenol-stimulated cyclic adenosine monophosphate (cAMP) formation, but significantly increased cAMP formation elicited by stimulation with forskolin. This latter increase in intrinsic AC activity was largely reversed by pertussis toxin pretreatment, and was unaffected by protein kinase C inhibition. Analysis of both AC function and isoform expression supports a dominant role of AC VI in HASM, and points to important differences in ASM AC isoform expression among species. Additional studies identify AC as the limiting component in beta 2AR-Gs-AC signaling in HASM, and thus a potentially important target of therapeutic strategies designed to influence airway contractile state.


    Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Regulation of transmembrane signaling through G protein-coupled receptors (GPCRs) occurs through diverse processes. Acute or chronic modifications of any of the three signaling proteins in the GPCR-G protein-effector pathway can alter the physiologic response of a cell to a given agonist. In addition, coordinated regulation of complementary or counteracting signaling pathways can further serve to modulate cellular responsiveness (1).

Numerous studies have suggested that regulation of GPCR signaling, predominantly in the form of GPCR desensitization, impacts the pathogenesis or pharmacologic management of various disease states. For example, heart failure is known to be associated with elevated circulating catecholamines and a reduction in both myocardial beta -adrenergic receptor density and responsiveness (2, 3) that likely limits contractile function and cardiac reserve. Persistent exposure to inhaled beta -agonists induces homologous desensitization of airway smooth-muscle (ASM) beta 2-adrenergic receptors (beta 2ARs) (4), and likely contributes to the loss of bronchoprotective effect observed with asthmatic subjects (7). Desensitization of opioid receptors in neuronal cells is believed to underlie the tolerance observed with opioid abuse (11, 12).

A significantly smaller number of studies have identified conditions in which alterations in intrinsic effector responsiveness occur. Chronic opioid exposure has been shown to induce sensitization of adenylyl cyclase (AC) (13), the enzyme that converts adenosine triphosphate (ATP) to cyclic adenosine monophosphate (cAMP) upon activation by GPCR/Gs. Because AC subserves pathways counter-regulatory to that of opioid signaling, AC sensitization is thought to exacerbate opioid tolerance and promote dependence (13, 14, 16). Although AC sensitization has also been observed in a few non-neuronal cell types, its prevalence and physiologic relevance remain poorly understood. In addition, a number of AC isoforms are known to exist and cell-specific regulation is likely to depend on the complement of isoforms expressed in a given cell type.

Here we report that AC sensitization occurs in human ASM (HASM) exposed to multiple inflammatory mediators and contractile agents relevant to the asthmatic state, and that this sensitization serves to offset any desensitization of the beta 2AR caused by these mediators, to preserve or augment beta 2AR-Gs-AC signaling. Analyses of both AC function and isoform expression support a dominant role of AC VI in HASM, thus suggesting a fundamental difference in AC function/expression between human and nonhuman ASM. Additional studies identify AC as the limiting component in beta 2AR-Gs-AC signaling in HASM, and thus a potentially important target of therapeutic strategies designed to influence airway contractile state.

    Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Materials

Bisindolylmaleimide IX (Bis IX) and pertussis toxin were purchased from Alexis Corp. (San Diego, CA). U46619 was purchased from Cayman Chemical Co. (Ann Arbor, MI). Mesulergine, ketanserine, metergoline, and doxepin were purchased from Research Biochemicals International (Natick, MA). 2,8-[3H]Adenine, 8-[14C]cAMP, and [125I]adenosine 3',5'-cyclicphosphoric acid (2,200 Ci/mmol) were purchased from NEN Dupont (Boston, MA). [8-3H]- cAMP (26 Ci/mmol) was purchased from Amersham (Arlington Heights, IL). The oligonucleotide 6-FAM 5' ccgggactcgagac(ag)ttNacNgtNttNcccca 3' was synthesized by Perkin-Elmer Biosystems (Foster City, CA). cAMP antibody was a gift from Mario Ascoli (University of Iowa, Iowa City, IA). Antibody against Gsalpha was a gift from Dave Manning (University of Pennsylvania, Philadelphia, PA). pcDNA3ACI, II, V, and VI were gifts from Ravi Iyengar (Mount Sinai School of Medicine, New York, NY). pcDNA3ACIII was a gift from Randy Reed (Johns Hopkins, Baltimore, MD). pcDNA3ACIV was a gift from Al Gilman (University of Texas Southwestern, Dallas, TX). pcDNA3Gsalpha was a gift from Phil Wedegaertner (Thomas Jefferson University, Philadelphia, PA). All other reagents were purchased from Sigma Chemical Co. (St. Louis, MO) or from sources described previously (6).

HASM Cell Culture

HASM cultures were established as described by Daykin and colleagues (Nottingham group) (17) from tracheae obtained from individuals without respiratory disease within 12 h of death, or as described by Panettieri and associates (Philadelphia group) (18) from human tracheae obtained from lung transplant donors, in accordance with procedures approved by the University of Pennsylvania Committee on Studies Involving Human Beings. Characterization of these cell lines with regard to immunofluorescence of smooth-muscle actin and agonist-induced changes in cytosolic calcium has previously been reported (19). Third- to fifth-passage cells were plated at a density of 104 cells/cm2 in either 24-well (for cAMP accumulation assays in intact cells) or 15-cm plates (AC assays) and maintained in fetal bovine serum (FBS)-supplemented Dulbecco's modified Eagle's medium (DMEM) as described previously (18). Experiments measuring [3H]cAMP accumulation in intact cells were maintained and treated as described later. For all other experiments, confluent cells were growth-arrested by refeeding cells with DMEM supplemented with 5 µg/ml each of insulin and transferrin for 24 h before stimulation.

Accumulation of cAMP in Intact Cells

Accumulation of [3H]cAMP was measured by a modification of a previously described method (4). Briefly, confluent cultures maintained with FBS-supplemented DMEM in 24-well plates were treated with vehicle or pertussis toxin (50 ng/ml) for 30 min followed by carbachol (CCh) treatment (± the m2 muscarinic acetylcholine [ACh] receptor [m2 mAChR] antagonist methoctramine) for 0 to 22 h. Cells were then washed twice with DMEM before the medium was replaced with 1 ml DMEM containing [3H]adenine (2 µCi/well). Drugs added at time zero were re-added at this stage and the cells were allowed to load for 2 h at 37°C. At the end of this period cells were washed three times with 1 ml of Hanks'/N-2-hydroxyethylpiperazine-N'-ethane sulfonic acid buffer and allowed to rewarm to 37°C for 10 min. Cells were then stimulated with the indicated agents for 10 min, reactions were terminated by the addition of 50 µl of concentrated HCl, and cells were stored at -20°C for at least 2 h. [3H]cAMP accumulation was determined by column chromatography as described previously (4) using [14C]cAMP to correct for variation in recovery among columns.

In separate experiments examining the accumulation of endogenous, unlabeled cAMP in intact cells, HASM cultures were subjected to two phases of pretreatment. Cells were initially pretreated with either vehicle, Bis IX (1 µm) for 30 min, or pertussis toxin (100 ng/ml) for 8 h. Cells were subsequently pretreated with vehicle, 10 µm histamine (HIST), 10 µm 5-hydroxytryptamine (5-HT), 1 mM CCh, or 100 nM U46619 for 18 h. In experiments examining short-term effects of protein kinase (PK) C-activating agents, cells were pretreated for 30 min with either vehicle, 10 µm HIST, or 10 to 1,000 nM phorbol-12-myristate-13-acetate (PMA). After pretreatment(s), cells were washed with cold phosphate-buffered saline (PBS) and subsequently stimulated with 500 µl PBS containing 300 µm ascorbic acid, 1 µm RO-20-1724, and either vehicle (basal), isoproterenol (ISO), or forskolin (FSK) at the indicated concentrations for 10 min at 37°C. In experiments examining the acute addition of various agents on basal and ISO- and FSK-stimulated cAMP accumulation, either 1 mM CCh, 10 µm HIST, 100 nM U46619, or 10 µm 5-HT was added to the stimulation mix. In experiments examining the effects of chronic pretreatment with various agents, the inhibitors (~ 100 × Ki concentrations) atropine, mesulergine, ketanserine, metergoline, doxepin, and SQ 29548 were included in the stimulation mix. cAMP was isolated and quantitated by radioimmunoassay as described previously (6).

AC Assay in Cell Homogenates

After 18 h pretreatment with various agents as described earlier, cells from 15-cm plates were washed with cold PBS, harvested by scraping into 10 ml of ice-cold PBS, and pelleted by centrifugation at 200 × g for 10 min, followed by snap-freezing. AC activity was subsequently measured in cell homogenates using a competitive protein binding assay and [8-3H]cAMP as described previously (20).

Accumulation of Total [3H]Inositol Phosphates

[3H]Inositol phosphate formation was determined as reported previously with minor modifications (21). Near-confluent cell monolayers in 12-well plates were incubated for 24 h at 37°C with 500 µl of inositol-free DMEM containing [3H]myoinositol (47 Ci/mmol) at a concentration of 4 µCi/ml. After loading, cells were washed once with PBS. Inositol-free DMEM containing 10 mM LiCl was added to each well and the cells were incubated for 10 min at 37°C. Cells were then stimulated with various agents for 10 min at 37°C. Reactions were stopped by aspirating medium and adding 0.8 ml of ice-cold 0.4 M perchloric acid. A total of 0.4 ml of 0.72 N KOH/0.6 M KHCO3 was added, and the sample was centrifuged to settle the precipitate. The supernatant was applied to 1 ml AG1-X8 (Bio-Rad, Hercules, CA) columns (100 to 200 mesh, formate form), columns were washed with 10 ml of 0.1 N formic acid, and total inositol phosphates were eluted with 1.5 M ammonium formate/0.1 N formic acid and counted.

Determination of AC Isoforms in HASM

AC isoforms in HASM were identified using reverse transcription/polymerase chain reaction (RT-PCR) and cloning. Degenerate primers (sense: 5' cggcagctcgagaa(a/g)at(a/ c/t)aa(a/g)acNat(a/c/t)gg 3' and antisense: 5' ccgggactcgag ac(ag)ttNacNgtNttNcccca 3') designed to amplify the C-terminus of messenger RNA (mRNA) sequences encoding AC isoforms I through IX were used in the method described by Premont (22). In addition, specific primers designed to amplify AC II (sense: 5' acgtctcgagcgactacagccaggtcttat 3' and antisense: 5' gttgctcgagatatcatattgtggcttctgagc 3') and AC VII (sense: 5' agggccgagtgcctacgcctgctcaatgaga 3' and antisense: 5' cgcgctcgagaatcactccagcaatca-caggcc 3') were also used. The RT reaction was performed using 2 µg of total mRNA isolated from HASM cultures and 100 ng of the antisense primer heated to 70°C for 10 min in 11 µl of diethyl pyrocarbonate-treated H2O. The reaction was placed on ice and subsequently incubated with 100 mM dithiothreitol, 500 nM deoxynucleotide triphosphates (dNTPs), 1× Superscript buffer, and 200 units of Superscript reverse transcriptase for 50 min at 42°C followed by 15 min at 70°C. A total of 3 µl of this reaction, or 10 ng each of pcDNA3 constructs encoding AC isoforms I through VI, was subsequently utilized in a 50-µl PCR reaction containing 500 nM sense and antisense primers, 200 µm dNTPs, 1.5 mM MgCl2, 1× Taq buffer, and 2.5 U Taq polymerase. After denaturation at 95°C for 3 min, 35 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 3 min were performed followed by one 72°C extension for 10 min, and products were subsequently analyzed on a 3% agarose gel. For more precise size analysis of products, PCR reactions were performed with the antisense primer 5' ccgggactcgagac(ag)ttNacNgtNttNcccca 3' fluorescently labeled with 6-FAM (blue) at the 5' end. The amount of 0.1% of a reaction was subsequently electrophoresed on a standard denaturing polyacrylamide gel and analyzed using Applied Biosystems 373 DNA sequencer and GeneScan/Genotyper programs (Applied Biosystems, Foster City, CA).

Cloning of AC Subtypes in HASM

Products of RT-PCR were gel-purified, digested with XhoI (sites present at 5' termini of amplification primers), and ligated into pcDNA3. DNA isolated from transformed DH-5alpha colonies was sequenced using dideoxy terminator reaction chemistry. The sequence was compared to sequences within the GenBank database by performing a BLAST search (23).

Transfection of HASM

HASM cultures were transfected using the replication- deficient adenovirus Ad5-GPT as previously described (6). Briefly, 4 × 106 cells were harvested and resuspended in 5 ml of DMEM containing 200 µg of diethylaminoethyl-dextran, 3 × 108 plaque-forming units of Ad5-GPT, and 2 µg of plasmid DNA (pcDNA3beta 2AR, pcDNA3Gsalpha , pcDNA3ACVI, or pcDNA3 vector control). The mixture was plated onto 10-cm tissue-culture plates and incubated for 2 h at 37°C. The media were then removed, the cells were washed with 2 ml of 10% dimethyl sulfoxide in Ca2+- and Mg2+-free PBS for 1 min, and the media were replaced with serum-supplemented DMEM. At 20 to 24 h later the transfected cells were harvested and replated at 2 × 104 cells/cm2 onto 24-well plates.

Data Analysis

Data are presented as means ± standard error of the mean (SEM). In the majority of experiments, data were normalized to paired control values and represented as percent of control value. In experiments examining AC activity in cell homogenates and assays of transfected cells derived from separate transfection reactions, values were normalized to account for small differences in protein content among samples. Statistically significant differences among groups were assessed by t test for paired samples, with P values < 0.05 sufficient to reject the null hypothesis.

    Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

AC Sensitization in HASM Is Affected by Numerous Agents

Initial experiments examined the effect of CCh on ISO- and FSK-stimulated cAMP accumulation in HASM cultures. Acute addition of CCh caused an inhibition of both ISO- and FSK-stimulated cAMP accumulation (Figure 1A). In contrast, 18 h pretreatment of cultures with CCh caused a small but significant increase in ISO-stimulated cAMP (1.23 ± 0.19-fold, n = 8, P < 0.05) and a much larger increase (2.02 ± 0.35-fold, n = 4, P < 0.05) in the response to FSK. When CCh was included in the stimulation mix after the 18-h pretreatment, the ability to inhibit ISO- and FSK-stimulated cAMP accumulation was maintained.


View larger version (26K):
[in this window]
[in a new window]
 
Figure 1.   Effects of CCh exposure on AC responsiveness in HASM cultures. (A) HASM cultures were pretreated with (CCh 18 h) or without (CON) 1 µm CCh for 18 h and loaded with [3H]adenine during the final 2 h of pretreatment. Cells were subsequently washed, then challenged with 1 µm ISO or 10 µm FSK (± 1 µm CCh) for 10 min at 37°C. Cellular [3H]cAMP accumulation was determined by column chromatography as described in MATERIALS AND METHODS. Basal % [3H]adenine conversion (0.13 ± 0.01% CON for ISO experiments, n = 8; 0.16 ± 0.02% for FSK experiments, n = 11) was not altered by acute or chronic CCh treatment. Fold basal stimulation: CON ISO 3.78 ± 0.93, n = 8; CON FSK 22.6 ± 5.0, n = 11. (B) HASM cultures were pretreated for the indicated times with 1 µm CCh, washed, and challenged with 10 µm FSK. (C ) Cultures were treated with 10-9 M to 10-5 M methoctramine for 30 min before 18 h treatment with 1 µm CCh. Basal % adenine conversion was not altered by methoctramine pretreatment. (D) Cultures were treated with (PT) or without (CON) 100 ng/ml pertussis toxin for 30 min before 18 h treatment with 10-8 M to 10-5 M CCh. Pertussis toxin pretreatment caused a small but significant increase in both basal % [3H]adenine conversion (1.23 ± 0.01-fold increase; P < 0.05, n = 3) and in FSK-stimulated cAMP accumulation (1.25 ± 0.05-fold paired CON values; P < 0.05, n = 3). Data represent means ± SEM from three to eight paired observations. *P < 0.05, t test for paired samples.

Examination of the time-dependent effect of CCh pretreatment revealed that AC sensitization was apparent within 20 min of treatment and continued to increase up to at least 24 h (Figure 1B). Methoctramine inhibited the effect of 18 h pretreatment with high potency (IC50 = 62 ± 16 nM), thus implicating the m2 mAChR in mediating the sensitization (Figure 1C). CCh-mediated sensitization of AC was shown to be dose-dependent (EC50 = 110 ± 11 nM) and was completely abolished by prior incubation with pertussis toxin (Figure 1D).

Having demonstrated the ability of chronic m2 mAChR stimulation to increase FSK-induced cAMP formation, we next examined the effect of other agonists active at receptors known to be expressed in cultured HASM (Figure 2). In intact cell experiments, chronic pretreatment with CCh augmented both basal (32 ± 4% increase over control values) and FSK (76 ± 23% increase)-stimulated cAMP formation while again inducing a small increase (18 ± 3%) in the response to ISO (Figures 2A-2C). In addition, similar but smaller effects of 18-h pretreatment with 5-HT (21 ± 4% increase), the thromboxane A2 receptor agonist U46619 (41 ± 18%), and HIST (20 ± 6%) were also observed on FSK-stimulated cAMP. A small, significant increase in basal cAMP accumulation (14 ± 5%) also occurred with chronic HIST pretreatment. Chronic 5-HT pretreatment caused a small, significant increase (19 ± 9%) in ISO-stimulated cAMP.


View larger version (56K):
[in this window]
[in a new window]
 
Figure 2.   Effects of acute and chronic stimulation with CCh, 5-HT, U46619, and HIST on AC responsiveness. (A, B, C ) HASM cultures were treated with vehicle (CON), 1 µm Bis IX (Bis IX) for 30 min, or 100 ng/ml pertussis toxin (PT) for 8 h before 18 h treatment with 1 mM CCh, 10 µm 5-HT, 100 nM U46619, or 10 µm HIST. Cells were then washed with cold PBS and challenged with vehicle (basal), 1 µm ISO, or 100 µm FSK for 10 min at 37°C. The stimulatory mix also contained atropine, 1 µm SQ 29548, and 100 nM each of mesulergine, ketanserine, metergoline, and doxepin to inhibit any of the pretreatment agents possibly retained after washing. cAMP was isolated and quantitated by radioimmunoassay as described in MATERIALS AND METHODS. Calculated cAMP values (pmol/well) for CON cells, to which all data are normalized for each stimulatory condition (CON representing those cells receiving vehicle as opposed to Bis IX or PT pretreatment, and further receiving vehicle pretreatment during chronic pretreatment phase): basal 1.16 ± 0.15; ISO 38.5 ± 4.7; FSK 76.7 ± 10.9. (D, E, F ) Cultures were treated with vehicle (CON), 1 µm Bis IX (Bis IX) for 30 min, or 100 ng/ml pertussis toxin (PT) for 8 h. Cells were washed with cold PBS then challenged with vehicle (basal), 1 µm ISO, or 100 µm FSK in the presence or absence of 1 mM CCh, 10 µm 5-HT, 100 nM U46619, or 10 µm HIST. Data represent means ± SEM from four to eight paired observations. Calculated cAMP values (pmol/well) for CON cells (CON representing those cells receiving vehicle as opposed to Bis IX or PT pretreatment, and further receiving vehicle addition during the acute addition phases): basal 0.90 ± 0.12; ISO 35.2 ± 6.3; FSK 76.7 ± 12.8. *P < 0.05, CON versus matched pretreatment group, t test for paired samples.

All of the statistically significant effects of chronic agonist pretreatment were reversed by prior treatment with pertussis toxin, implicating a Gi-dependent mechanism for each of the compounds. Conversely, inhibition of PKC by prior pretreatment with Bis IX did not attenuate any of the agonist-promoted increases. However, Bis IX pretreatment did cause a slight enhancement of ISO-stimulated cAMP formation in the control group and groups pretreated with CCh, 5-HT, and HIST, suggesting a possible PKC-mediated phosphorylation/desensitization of the beta 2AR associated with chronic agonist pretreatment.

In contrast to the effects of chronic pretreatment, acute addition of CCh resulted in significant inhibition of both ISO- and FSK-stimulated cAMP that was pertussis toxin- sensitive (Figures 2E and 2F). A small but statistically significant inhibition of ISO- (17 ± 4%) and FSK-stimulated cAMP formation (17 ± 5%) was also observed with acute addition of 5-HT. Acute addition of U46619 increased cAMP accumulation (67 ± 10% increase over basal levels) (Figure 2D) consistent with the ability of the thromboxane A2alpha receptor to couple to Gs. Histamine also stimulated a small increase (18 ± 6%) in cAMP accumulation (Figure 2D), possibly reflecting a low level of coupling to endogenous H2 histamine receptors.

Results similar to those observed in intact cell assays were obtained in an in vitro assay of AC activity using cell homogenates prepared from HASM cultures (Figure 3). In this assay, the augmentation of FSK-stimulated cAMP induced by pretreatment with CCh (57 ± 10% increase), 5-HT (33 ± 6%), U46619 (40 ± 7%), and HIST (41 ± 8%) was paralleled by statistically significant increases in NaF-stimulated cAMP production: CCh, 38 ± 5% increase; 5-HT 25 ± 10%; U46619 21 ± 6%; and HIST 23 ± 8%. A small but variable increase in ISO-stimulated cAMP formation was also observed for each of the pretreatment conditions.


View larger version (54K):
[in this window]
[in a new window]
 
Figure 3.   Effects of chronic agonist treatment on AC activity in HASM cell homogenates. HASM cultures grown on 15-cm plates were treated for 18 h with the indicated agents, washed with cold PBS, and harvested by scraping into 10 ml of ice-cold PBS. AC activity was subsequently measured in cell homogenates using a competitive protein binding assay and [8-3H]cAMP as described previously (20). Basal values of AC activity did not differ among groups. Data represent means ± SEM from four or five paired observations. *P < 0.05, CON versus matched pretreatment group, t test for paired samples.

The finding that Gi activation by CCh induced acute inhibition of AC but sensitization with chronic pretreatment is consistent with the subtype-specific regulation of AC V and VI recently demonstrated by Nevo and associates (24). Interestingly, the opposite effects (activation with acute exposure and reduced responsiveness following chronic exposure) are observed in cells specifically expressing AC isoform II, IV, or VII. These findings, coupled with our observation that PKC inhibition had virtually no effect on the observed AC sensitization, suggest that the PKC-sensitive AC isoforms II, IV, and VII are of relatively lesser significance in cultured HASM. However, previous studies examining both human (25) and nonhuman (26, 27) ASM have attributed an important role to PKC in the regulation of both beta 2AR and AC responsiveness. Analysis of agonist-stimulated phosphoinositide generation in HASM reveals that CCh, 5-HT, and U46619 have a limited capacity to stimulate phospholipase C, whereas stimulation with HIST causes a 5-fold increase over basal phosphoinositide production (Figure 4A). We therefore examined the potential effects of acute PKC activation on AC responsiveness by pretreating cells for 30 min with HIST or various concentrations of PMA. Under these conditions, sensitization of AC was induced by both agents and was reversed by PKC inhibition with Bis IX (Figure 4B). The apparent failure to sustain the PKC-dependent sensitization by HIST with more chronic exposure possibly reflects either homologous desensitization of the H1 histamine receptor (17) or some other form of cellular compensation.


View larger version (42K):
[in this window]
[in a new window]
 
Figure 4.   Analysis of PKC-mediated effects on AC responsiveness. (A) Agonist-stimulated phosphoinositide generation in HASM cultures. Cells were loaded with [3H]myoinositol for 24 h, then stimulated with the indicated agents for 10 min at 37°C in the presence of LiCl. [3H]Phosphoinositide accumulation was subsequently determined as described in MATERIALS AND METHODS. (B) Induction of PKC-mediated AC sensitization by short-term treatment with HIST and PMA. HASM cultures were treated with vehicle or 1 µm Bis IX for 30 min, followed by 30 min pretreatment with 10 µm HIST or 10 to 1,000 nM PMA. Cells were washed and ISO- and FSK-stimulated cAMP formation was determined as described in MATERIALS AND METHODS. Calculated cAMP values (pmol/well) for CON cells: basal 0.84 ± 0.13; ISO 32.4 ± 7.9, FSK 83.2 ± 10.7. Data represent means ± SEM from three to five paired observations. *P < 0.05, CON versus matched pretreatment group, t test for paired samples. Bis IX pretreatment significantly (P < 0.05, paired t test) reduced the FSK-stimulated cAMP accumulation in the HIST- and each of the PMA-pretreated groups.

AC VI and AC IX Are Preferentially Expressed in HASM

To identify the AC isoforms expressed in HASM, RT-PCR using degenerate primers designed to amplify mRNA encoding AC isoforms I through IX was performed (22). As shown in Figure 5A, RT-PCR products from HASM mRNA were generated that appeared to comigrate with those products generated by PCR of AC clones of subtypes I (higher and less intense band), V, and VI (lower band). Reamplification of the RT-PCR reaction resulted in the generation of an equal abundance of these same two bands. A more precise size determination of products generated using a fluorescently labeled primer and electrophoresed on a sequencing gel with a DNA ladder suggested that the less-intense upper band is slightly larger than the AC I product (Figure 5B). Subsequent cloning of Xho1-digested products from the RT-PCR reaction revealed the lower band to be AC VI and the upper band AC IX. Of 30 clones that were sequenced, 25 were identified as AC VI and five as AC IX, consistent with the distribution observed in Figures 5A and 5B. Although use of specific primers ultimately enabled us to identify AC II and AC VII in HASM (data not shown), the distribution of products generated with degenerate primers suggests that AC VI, and to a lesser extent AC IX, are the most abundantly expressed isoforms.*


View larger version (86K):
[in this window]
[in a new window]
 


View larger version (19K):
[in this window]
[in a new window]
 
Figure 5.   RT-PCR of AC isoforms from HASM. (A) Total mRNA isolated from HASM cultures was subjected to RT-PCR amplification using degenerate primers designed to amplify human AC isoforms I through IX, as described in MATERIALS AND METHODS. An aliquot of the RT-PCR reaction was further amplified by an additional round of PCR (RE-AMP). Products were electrophoresed on a 3% agarose gel and compared with PCR products amplified from each of the human clones of AC I through VI. Similar results were obtained in RT-PCR reactions using three additional mRNA preps derived from three separate HASM cultures. (B) RT reactions generated for use in A, as well as AC clones I through VI were amplified with degenerate primers, including the antisense degenerate primer fluorescently labeled with 6-FAM (blue). Reactions were electrophoresed on a standard denaturing polyacrylamide gel and analyzed using Applied Biosystems 373 DNA sequencer and GeneScan/Genotyper programs (Applied Biosystems).

AC Is a Limiting Component in the beta 2AR-Gs-AC Pathway in HASM

Recent studies examining rat ventricular myocytes (28) and NG-108-15 cells (29) have suggested that AC is the least abundantly expressed and limiting component of the Gs-coupled receptor-Gs-AC pathway. If such were the case in HASM, enhanced expression or responsiveness of AC would represent an important mechanism for the augmentation of Gs-coupled receptor signaling. To test this hypothesis, HASM cultures were transiently transfected with constructs encoding the human beta 2AR, Gsalpha , or AC VI, and subsequently analyzed for AC responsiveness. Overexpression of beta 2AR caused a large increase in basal cAMP levels (~ 150% increase over pcDNA3 vector control values) and small increases (~ 30%) in ISO- and FSK-stimulated cAMP (Figure 6). Overexpression of Galpha s also had a small effect (~ 30% increase) on basal and ISO- and FSK-stimulated cAMP. Overexpression of AC VI significantly increased basal cAMP levels (~ 65%), and produced the largest increase in both ISO- (~ 90%) and FSK- (~ 90%) stimulated cAMP formation. Chronic pretreatment of each of the transfected lines with CCh induced AC sensitization comparable to that shown in Figure 2C, with cells overexpressing AC VI exhibiting the highest level of FSK-stimulated cAMP. These findings suggest that AC expression levels limit beta 2AR-mediated cAMP formation, and that increases in AC expression or sensitization are potentially powerful means of regulating Gs-coupled receptor signaling in HASM.


View larger version (16K):
[in this window]
[in a new window]
 
Figure 6.   Effects of overexpression of beta 2AR, Gsalpha , or AC VI in HASM on AC responsiveness. Cultures were transiently transfected with pcDNA3 vector (vector), pcDNA3beta 2AR (beta 2AR), pcDNA3Gsalpha (Gsalpha ), or pcDNA3ACVI (AC VI) and subsequently plated onto 24-well plates as described in MATERIALS AND METHODS. After 18 h pretreatment with vehicle (CON) or 1 mM CCh, basal (A) or ISO- (B) or FSK-stimulated (C ) cAMP was determined as described in MATERIALS AND METHODS. Data represent means ± SEM from four paired observations. Calculated cAMP values (pmol/µg whole cell protein) for vector CON cells, to which all other conditions are compared: basal 0.110 ± 0.010; ISO 2.285 ± 0.465; FSK 9.415 ± 1.810. *P < 0.05, CON versus matched pretreatment group, t test for paired samples. Overexpression of beta 2AR (pcDNA3beta 2AR-transfected, 1,230 ± 100 fmol/ mg whole cell protein versus pcDNA3 vector-transfected, 7.2 ± 1.1 fmol/mg) and Gsalpha (> 40-fold endogenous levels) were confirmed by [125I]iodopindolol binding (6) and immunoblot analysis, respectively.

    Discussion
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Inhaled beta -agonists are the most widely used agents in asthma therapy and are universally recognized as the treatment of choice for acute asthma attacks. Activation of the beta 2AR-Gs-AC pathway results in the production of the second messenger cAMP and subsequent activation of PKA. PKA activation results in a host of physiologic effects that contribute to the functional antagonism of bronchoconstricting agents and produce ASM relaxation. Because of the critical role of beta -agonists in asthma therapy, considerable effort has been expended in characterizing airway beta 2AR function and regulation at both the organ and cellular levels. Several studies have been driven by hypotheses that beta 2AR dysfunction or hyporesponsiveness is an inherent characteristic of asthma, or that inflammation associated with asthma has deleterious effects on beta 2AR signaling and contributes to asthma severity. Although these beliefs have yet to be empirically established, a functional loss of beta 2AR responsiveness has been clearly demonstrated in the loss of prophylactic bronchoprotection associated with chronic beta -agonist use (7). This particular phenomenon has been investigated at the cellular and molecular levels in studies elucidating mechanisms by which homologous beta 2AR desensitization occurs in ASM cultures (4). In addition, HASM beta 2ARs have also been shown to be susceptible to PKA-mediated heterologous desensitization upon exposure to prostaglandin (PG) E2 (4, 6) and interleukin-1beta -mediated prostanoid release (32).

A limited number of studies have also suggested that AC is subject to regulation in both human and nonhuman ASM. Stevens and colleagues (35) and Pyne and Pyne (36, 37) demonstrated that bradykinin, platelet-derived growth factor (PDGF), and PMA stimulate cAMP formation in guinea-pig ASM, presumably via a PKC-dependent enhancement of AC II activation by Gs. Schears and coworkers (38) recently reported that chronic treatment of canine ASM cultures with CCh reduced basal and ISO-, PGE1-, guanosine triphosphate-, and FSK-stimulated AC activity, an effect that was reversed by PKC inhibition. Nogami and associates (25) demonstrated that pretreatment of HASM with either PMA or lysophosphatidic acid (LPA) could augment FSK-stimulated cAMP formation. However, LPA-mediated AC sensitization appeared to be PKC-independent and was inhibited by pertussis toxin pretreatment. The authors concluded the effects of both PMA and LPA were consistent with the expression of AC II in HASM.

The findings of the present study demonstrate a widespread role for chronic activation of Gi-coupled receptors in the sensitization of AC in HASM. Numerous agonists with the potential either to couple directly to Gi-coupled receptors, or, alternatively, to promote exocytotic release of autocrine factors linking to Gi activation, induced AC sensitization in a pertussis toxin-sensitive manner. CCh caused the largest increase in AC responsiveness, perhaps reflecting the high expression levels of m2 mAChR in HASM (39). U46619, which has previously been shown to cause AC sensitization in platelets (40), induced a pertussis toxin-sensitive AC sensitization against a backdrop of apparent PKA (Figure 2D) and PKC (Figure 4A) activation. The relatively smaller effects elicited by 5-HT and HIST may reflect a lower level of Gi activation caused either by relatively low receptor expression levels or by regulatory features of the activated receptor(s) (e.g., susceptibility to rapid desensitization) that limit sustained signaling.

The mechanisms underlying AC sensitization after chronic agonist exposure in HASM appear largely independent of PKC. Although PKC-mediated sensitization of AC could be elicited with short-term treatment by HIST or PMA, long-term effects were not altered by PKC inhibition with Bis IX, suggesting that PKC-mediated AC sensitization is transient and may ultimately be supplanted by another (PKC-independent) mechanism. Moreover, our collective findings point to a relatively minor role of the PKC-sensitive AC II in mediating AC responses in HASM, and also establish significant species differences in the modes by which AC is activated and regulated. Unlike canine ASM, HASM exhibits increased versus diminished basal and ISO- and FSK-stimulated cAMP formation after chronic CCh treatment. We were able to demonstrate this effect using two different assays for cAMP formation in intact cells and in an in vitro assay of AC activity. Unlike in guinea-pig ASM, neither PMA nor PDGF appreciably stimulate cAMP accumulation in HASM (data not shown), nor does PKC activation seem to enhance receptor-mediated AC activation (Figure 4). The recent findings of Nevo and colleagues (24) characterizing subtype-specific regulation of AC suggest that differential expression of AC isoforms can contribute to such species-specific results. In COS-7 cells used as an expression system for various AC isoforms, acute activation of D2 dopamine or m2 mAChR receptors caused an inhibition of activity of isoforms I, V, VI, and VIII, whereas isoforms II, IV, and VII were stimulated. Conversely, chronic D2 dopamine or m2 mAChR activation caused a sensitization of AC I, V, VI, and VIII, and reduced activity in AC II, IV, and VII. These and previous findings delineating the regulation of AC isoforms by PKC (41) suggest that AC II or VII is important in mediating the observed effects in guinea-pig and canine ASM. However, the Gi-mediated effects on AC responsiveness in HASM are more consistent with the expression of AC V or VI.

However, a contributory role for AC II or VII cannot be excluded from the mechanistic interpretation of our data. Clearly, PKC-mediated effects on AC responsiveness are inducible (albeit small) in HASM (Figure 4), and each of the agents tested is capable of activating Gq- (and Gi-) coupled receptors linked to PKC activation. Indeed, any increases in basal or ISO- or FSK-stimulated cAMP mediated by sensitization of AC VI may be augmented or obscured by the regulated activity of other AC isoforms. Sensitization of the PKC-responsive AC II or VII could be additive to that of AC VI. Alternatively, the inhibitory effect of chronic Gi-coupled receptor activation on AC II/ VII may partly mask the increased cAMP formation caused by enhanced AC VI responsiveness. Moreover, the effects of chronic Gi- or Gq-coupled receptor activation on the various AC isoforms may be subject to compartmentalization (45), which would complicate the interpretation of AC regulation suggested by (global) changes in cellular cAMP accumulation.

The finding that AC VI is the principal isoform amplified by RT-PCR using degenerate primers is consistent with our functional data. Although RT-PCR offers only an indirect measure of protein expression, direct assessment of endogenous AC is precluded by low AC expression levels and the lack of sensitive antibodies against any of the AC isoforms (46). These limitations have hampered the basic biochemical investigation of AC to date and contribute to the relatively poor understanding of AC function and regulation when compared with that held for GPCRs and heterotrimeric G proteins.

The amplification of the recently cloned AC IX is intriguing, but unfortunately little is known regarding the manner in which AC IX is regulated. However, because AC IX responds poorly to activation by FSK (47), its role in mediating the augmentation of FSK-stimulated cAMP in HASM is probably minimal.

Apparently inconsistent with the concept of GPCR-G protein effector pathways as amplification "cascades" are the findings that effector proteins tend be expressed at much lower levels than those of the G proteins that regulate them (29, 48). That such low levels of effector expression can limit receptor-mediated signaling has recently been demonstrated in three different cell types. In NG-108-15 cells overexpressing beta 2AR, Galpha s, or AC II, only lines overexpressing AC II exhibited a substantial increase in maximal cAMP mediated by receptor activation (29, 30, 50). In both S49 lymphoma cells (51) and rat ventricular myocytes (28), Gsalpha exists in large stoichiometric excess relative to beta AR and AC, and the levels of AC limit agonist-mediated AC activation. Similarly, our data suggest that AC is the limiting component in the beta 2AR-Gs-AC pathway in HASM, and that heterologously expressed AC VI is subject to sensitization by chronic Gi-coupled receptor activation.

The present study's findings hold numerous physiologic implications. The slight increase in ISO-stimulated cAMP formation after chronic treatment with CCh, 5-HT, U46619, or HIST suggests that the potentially deleterious effects of inflammation or chronic cholinergic stimulation on HASM beta 2AR signaling may be self-limiting. Sensitization of AC in neuronal cells after chronic opioid exposure has been proposed as a protective measure that upregulates pathways that counteract that of opioid signaling. A similar teleologic argument could be applied to the observed sensitization of HASM AC; chronic exposure to contractile/ inflammatory stimuli induces enhanced signaling of (protective) pathways that promote muscle relaxation. In addition, our data suggest an important homeostatic role for m2 mAChRs in HASM. Previously it has been suggested that inhibition of AC by stimulation of those receptors during ACh-induced contraction is the main role for m2 mAChRs in ASM. In contrast, our data suggest that m2 mAChRs may be present in ASM to counterbalance effects of ACh-induced contractile responses by promoting mechanisms important in relaxation.

In addition, our findings suggest that pharmacologic induction of AC sensitization, or manipulation of pathology-associated AC sensitization, may represent an important form of asthma therapy. In lieu of drugs that manipulate the pharmacologic and regulatory properties of the beta 2AR, selective targeting of AC could increase basal or receptor-regulated cAMP levels to promote ASM relaxation. One probable consequence of acute ipratropium bromide therapy is a large, albeit temporary, increase in AC responsiveness in asthmatic patients with a significant cholinergic component to their disease. However, should sustained ACh-mediated AC sensitization represent an important homeostatic mechanism, a selective m3 mAChR antagonist may have theoretical therapeutic advantages over nonselective antagonists such as ipratroprium bromide.

In summary, the present study demonstrates that inflammatory and contractile agents associated with the asthmatic state can increase inherent AC activity in HASM cells. AC VI appears to be the most abundantly expressed AC isoform in HASM, and its regulation is the probable mechanism through which AC sensitization occurs. Functional effects of overexpression of AC VI suggest that AC is the limiting component in beta 2AR-mediated signaling in HASM cells. Collectively, these findings in HASM cultures (1) suggest that contractile/inflammatory agents of the airway invoke homeostatic mechanisms that mitigate their deleterious effects, and (2) identify AC as a potentially important target for therapy designed to modulate the airway contractile state in vivo.

    Footnotes

Address correspondence to: Raymond B. Penn, Kimmel Cancer Institute, Thomas Jefferson University, Bluemle Life Sciences Bldg., Room 930, 233 S. 10th St., Philadelphia, PA 19107. E-mail: rpenn{at}lac.jci.tju.edu

(Received in original form April 8, 1999 and in revised form May 20, 1999).

Abbreviations: adenylyl cyclase, AC; acetylcholine, ACh; airway smooth muscle, ASM; beta 2-adrenergic receptor, beta 2AR; Bisindolylmaleimide IX, Bis IX; cyclic adenosine monophosphate, cAMP; carbachol, CCh; Dulbecco's modified Eagle's medium, DMEM; concentration that produces 50% of maximal effect, EC50; forskolin, FSK; G-protein-coupled receptor, GPCR; human ASM, HASM; histamine, HIST; 5-hydroxytryptamine, 5-HT; concentration that produces 50% inhibition of effect, IC50; isoproterenol, ISO; lysophosphatidic acid, LPA; m2 muscarinic ACh receptor, m2 mAChR; messenger RNA, mRNA; phosphate-buffered saline, PBS; protein kinase, PK; phorbol-12-myristate-13-acetate, PMA; reverse transcription/polymerase chain reaction, RT-PCR; standard error of the mean, SEM.
* The degenerate primers used do not discriminate among AC isoforms and amplify each one equally well (22).

Acknowledgments: One author (J.L.B.) is a recipient of an American Heart Association Established Investigator Award. One author (R.A.P.) is a recipient of a Career Investigator Award from the American Lung Association. One author (J.-L.P.) is a recipient of a postdoctoral fellowship from the Medical Research Council of Canada. This work was supported in part by National Institutes of Health grants HL58506, GM44944, and HL55301, and by the National Asthma Campaign, UK. The authors thank Kristin Brodbeck and Andrew Eszterhas for technical assistance.
    References
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Penn, R. B., and J. L. Benovic. 1998, Regulation of G protein-coupled receptors. In Handbook of Physiology. P. M. Conn, editor. Oxford University Press, Oxford. 125-164

2. Fowler, M. B., J. A. Laser, G. L. Hopkins, W. Minobe, and M. R. Bristow. 1986. Assessment of the beta-adrenergic receptor pathway in the intact failing human heart: progressive receptor down-regulation and subsensitivity to agonist response. Circulation 74: 1290-1302 [Abstract/Free Full Text].

3. Bristow, M. R., R. Ginsburg, V. Umans, M. Fowler, W. Minobe, R. Rasmussen, P. Zera, R. Menlove, P. Shah, and S. Jamieson. 1986. Beta 1- and beta 2-adrenergic-receptor subpopulations in nonfailing and failing human ventricular myocardium: coupling of both receptor subtypes to muscle contraction and selective beta 1-receptor down-regulation in heart failure. Circ. Res. 59: 297-309 [Abstract/Free Full Text].

4. Hall, I. P., K. Daykin, and S. Widdop. 1993. Beta 2-adrenoceptor desensitization in cultured human airway smooth muscle. Clin. Sci. (Colch.) 84: 151-157 [Medline].

5. Green, S. A., J. Turki, P. Bejarano, I. P. Hall, and S. B. Liggett. 1995. Influence of beta 2-adrenergic receptor genotypes on signal transduction in human airway smooth muscle cells. Am. J. Respir. Cell Mol. Biol. 13: 25-33 [Abstract].

6. Penn, R. B., R. A. Panettieri Jr., and J. L. Benovic. 1998. Mechanisms of acute desensitization of the beta 2AR-adenylyl cyclase pathway in human airway smooth muscle. Am. J. Respir. Cell Mol. Biol. 19: 338-348 [Abstract/Free Full Text].

7. Vathenen, A. S., B. G. Higgins, A. J. Knox, J. R. Britton, and A. E. Tattersfield. 1988. Rebound increase in bronchial responsiveness after treatment with inhaled terbutaline. Lancet 1: 554-558 [Medline].

8. O'Connor, B. J., S. L. Aikman, and P. J. Barnes. 1992. Tolerance to the nonbronchodilator effects of inhaled beta 2-agonists in asthma. N. Engl. J. Med. 327: 1204-1208 [Abstract].

9. Cockcroft, D. W., C. P. McParland, S. A. Britto, V. A. Swystun, and B. C. Rutherford. 1993. Regular inhaled salbutamol and airway responsiveness to allergen. Lancet 342: 833-837 [Medline].

10. Cheung, D., M. C. Timmers, A. H. Zwinderman, E. H. Bel, J. H. Dijkman, and P. J. Sterk. 1992. Long-term effects of a long-acting beta 2-adrenoceptor agonist, salmeterol, on airway hyperresponsiveness in patients with mild asthma. N. Engl. J. Med. 327: 1198-1203 [Abstract].

11. Prather, P. L., A. W. Tsai, and P. Y. Law. 1994. Mu and delta opioid receptor desensitization in undifferentiated human neuroblastoma SHSY5Y cells. Mol. Pharmacol. 270: 177-184 .

12. Zadina, J. E., L. M. Harrison, L. J. Ge, A. J. Kastin, and S. L. Chang. 1994. Differential regulation of mu and delta opiate receptors by morphine, selective agonists and antagonists and differentiating agents in SH-SY5Y human neuroblastoma cells. J. Pharmacol. Exp. Ther. 270: 1086-1096 [Abstract/Free Full Text].

13. Lampert, A., M. Nirenberg, and W. A. Klee. 1976. Tolerance and dependence evoked by an endogenous opioid peptide. Proc. Natl. Acad. Sci. USA 73: 3165-3167 [Abstract/Free Full Text].

14. Sharma, S. K., W. A. Klee, and M. Nirenberg. 1975. Dual regulation of adenylate cyclase for narcotic dependence and tolerance. Proc. Natl. Acad. Sci. USA 72: 3092-3096 [Abstract/Free Full Text].

15. Avidor-Reiss, T., M. Bayewitch, R. Levy, N. Matus-Leibovitch, I. Nevo, and Z. Vogel. 1995. Adenylylcyclase supersensitization in mu-opioid receptor-transfected Chinese hamster ovary cells following chronic opioid treatment. J. Biol. Chem. 270: 29732-29738 [Abstract/Free Full Text].

16. Nestler, E. J., B. T. Hope, and K. L. Widnell. 1993. Drug addiction: a model for the molecular basis of neural plasticity. Neuron 11: 995-1006 [Medline].

17. Daykin, K., S. Widdop, and I. P. Hall. 1993. Control of histamine induced inositol phospholipid hydrolysis in cultured human tracheal smooth muscle cells. Eur. J. Pharmacol. 246: 135-140 [Medline].

18. Panettieri, R. A., R. K. Murray, L. R. DePalo, P. A. Yadvish, and M. I. Kotlikoff. 1989. A human smooth muscle cell line that retains physiological responsiveness. Am. J. Physiol. 256(Cell Physiol. 25):C329-C335.

19. Hall, I. P., and M. Kotlikoff. 1995. Use of cultured airway myocytes for study of airway smooth muscle. Am. J. Physiol. (Lung Cell. Mol. Physiol.) 268: L1-L11 [Abstract/Free Full Text].

20. Mundell, S. J., and E. Kelly. 1998. Evidence for co-expression and desensitization of A2a and A2b adenosine receptors in NG108-15 cells. Biochem. Pharmacol. 55: 595-603 [Medline].

21. Penn, R. B., J. L. Parent, A. N. Pronin, R. A. Panettieri Jr., and J. L. Benovic. 1999. Pharmacological inhibition of protein kinases in intact cells: antagonism of beta adrenergic receptor ligand binding by H-89 reveals limitations of usefulness. J. Pharmacol. Exp. Ther. 288: 428-437 [Abstract/Free Full Text].

22. Premont, R. T.. 1994. Identification of adenylyl cyclases by amplification using degenerate primers. Methods Enzymol. 238: 116-127 [Medline].

23. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215: 403-410 [Medline].

24. Nevo, I., T. Avidor-Reiss, R. Levy, M. Bayewitch, E. Heldman, and Z. Vogel. 1998. Regulation of adenylyl cyclase isozymes on acute and chronic activation of inhibitory receptors. Mol. Pharmacol. 54: 419-426 [Abstract/Free Full Text].

25. Nogami, M., S. M. Whittle, D. J. Romberger, S. I. Rennard, and M. Toews. 1995. Lysophosphatidic acid regulation of cyclic AMP accumulation in cultured human airway smooth muscle cells. Mol. Pharmacol. 48: 766-773 [Abstract].

26. Pyne, N. J., P. Stevens, N. Moughal, and S. Pyne. 1995. PKC-dependent activation of the type II adenylate cyclase in airway smooth muscle limits the bradykinin-stimulated ERK-2 pathway. Biochem. Soc. Trans. 23: 200S [Medline].

27. Pyne, N. J., N. Moughal, P. A. Stevens, D. Tolan, and S. Pyne. 1994. Protein kinase C-dependent cyclic AMP formation in airway smooth muscle: the role of type II adenylate cyclase and the blockade of extracellular-signal-regulated kinase-2 (ERK-2) activation. Biochem. J. 304: 611-616 .

28. Post, S. R., R. Hilal-Dandan, K. Urasawa, L. L. Brunton, and P. A. Insel. 1995. Quantification of signalling components and amplification in the beta- adrenergic-receptor-adenylate cyclase pathway in isolated adult rat ventricular myocytes. Biochem. J. 311: 75-80 .

29. Adie, E. J., and G. Milligan. 1994. Regulation of basal adenylate cyclase activity in neuroblastoma x glioma hybrid, NG108-15, cells transfected to express the human beta 2 adrenoceptor: evidence for empty receptor stimulation of the adenylate cyclase cascade. Biochem. J. 303: 803-808 .

30. MacEwan, D. J., G. D. Kim, and G. Milligan. 1996. Agonist regulation of adenylate cyclase activity in neuroblastoma x glioma hybrid NG108-15 cells transfected to co-express adenylate cyclase type II and the beta 2-adrenoceptor: evidence that adenylate cyclase is the limiting component for receptor-mediated stimulation of adenylate cyclase activity. Biochem. J. 318: 1033-1039 .

31. Milligan, G., I. Mullaney, G. D. Kim, and D. MacEwan. 1998. Regulation of the stoichiometry of protein components of the stimulatory adenylyl cyclase cascade. Adv. Pharmacol. 42: 462-465 .

32. Pang, L., and A. J. Knox. 1997. PGE2 release by bradykinin in human airway smooth muscle cells: involvement of cyclooxygenase-2 induction. Am. J. Physiol. (Lung Cell. Mol. Physiol.) 273: L1132-L1140 [Abstract/Free Full Text].

33. Laporte, J. D., P. E. Moore, R. A. Panettieri, W. Moeller, J. Heyder, and S. A. Shore. 1998. Prostanoids mediate IL-1beta-induced beta-adrenergic hyporesponsiveness in human airway smooth muscle cells. Am. J. Physiol. (Lung Cell. Mol. Physiol.) 275: L491-L501 [Abstract/Free Full Text].

34. Shore, S. A., J. Laporte, I. P. Hall, E. Hardy, and R. A. Panettieri Jr.. 1997. Effect of IL-1 beta on responses of cultured human airway smooth muscle cells to bronchodilator agonists. Am. J. Respir. Cell Mol. Biol. 16: 702-712 [Abstract].

35. Stevens, P. A., S. Pyne, M. Grady, and N. J. Pyne. 1994. Bradykinin-dependent activation of adenylate cyclase activity and cyclic AMP accumulation in tracheal smooth muscle occurs via protein kinase C-dependent and -independent pathways. Biochem. J. 297: 233-239 .

36. Pyne, S., and N. J. Pyne. 1995. Bradykinin-stimulated phosphatidylcholine hydrolysis in airway smooth muscle: the role of Ca2+ and protein kinase C.  Biochem. J. 311: 637-642 .

37. Pyne, N. J., and S. Pyne. 1998. PDGF-stimulated cyclic AMP formation in airway smooth muscle: assessment of the roles of MAP kinase, cytosolic phospholipase A2, and arachidonate metabolites. Cell. Signal 10: 363-369 [Medline].

38. Schears, G., J. Clancy, C. A. Hirshman, and C. W. Emala. 1997. Chronic carbachol pretreatment decreases adenylyl cyclase activity in airway smooth muscle. Am. J. Physiol. (Lung Cell. Mol. Physiol.) 273: L640-L647 [Abstract/Free Full Text].

39. Widdop, S., K. Daykin, and I. P. Hall. 1993. Expression of muscarinic M2 receptors in cultured human airway smooth muscle cells. Am. J. Respir. Cell Mol. Biol. 9: 541-546 .

40. Murray, R., E. Shipp, and G. A. FitzGerald. 1990. Prostaglandin endoperoxide/thromboxane A2 receptor desensitization: cross-talk with adenylate cyclase in human platelets. J. Biol. Chem. 265: 21670-21675 [Abstract/Free Full Text].

41. Smit, M. J., D. Verzijl, and R. Iyengar. 1998. Identity of adenylyl cyclase isoform determines the rate of cell cycle progression in NIH 3T3 cells. Proc. Natl. Acad. Sci. USA 95: 15084-15089 [Abstract/Free Full Text].

42. Zimmermann, G., and R. Taussig. 1996. Protein kinase C alters the responsiveness of adenylyl cyclases to G protein alpha and beta-gamma subunits. J. Biol. Chem. 271: 27161-27166 [Abstract/Free Full Text].

43. Lustig, K. D., B. R. Conklin, P. Herzmark, R. Taussig, and H. R. Bourne. 1993. Type II adenylylcyclase integrates coincident signals from Gs, Gi, and Gq. J. Biol. Chem. 268: 13900-13905 [Abstract/Free Full Text].

44. Taussig, R., W. J. Tang, J. R. Hepler, and A. G. Gilman. 1994. Distinct patterns of bidirectional regulation of mammalian adenylyl cyclases. J. Biol. Chem. 269: 6093-6100 [Abstract/Free Full Text].

45. Neubig, R. R.. 1994. Membrane organization in G-protein mechanisms. FASEB J. 8: 939-946 [Abstract].

46. Taussig, R., and G. Zimmermann. 1998. Type-specific regulation of mammalian adenylyl cyclases by G protein pathways. Adv. Second Messenger Phosphoprotein Res. 32: 81-98 [Medline].

47. Premont, R. T., I. Matsuoka, M. G. Mattei, Y. Pouille, N. Defer, and J. Hanoune. 1996. Identification and characterization of a widely expressed form of adenylyl cyclase. J. Biol. Chem. 271: 13900-13907 [Abstract/Free Full Text].

48. Adie, E. J., and G. Milligan. 1994. Agonist regulation of cellular Gs alpha-subunit levels in neuroblastoma x glioma hybrid NG108-15 cells transfected to express different levels of the human beta 2 adrenoceptor. Biochem. J. 300: 709-715 .

49. MacEwan, D. J., G. D. Kim, and G. Milligan. 1995. Analysis of the role of receptor number in defining the intrinsic activity and potency of partial agonists in neuroblastoma x glioma hybrid NG108-15 cells transfected to express differing levels of the human beta 2-adrenoceptor. Mol. Pharmacol. 48: 316-325 [Abstract].

50. Mullaney, I., and G. Milligan. 1994. Equivalent regulation of wild type and an epitope-tagged variant of Gs alpha by the IP prostanoid receptor following expression in neuroblastoma x glioma hybrid, NG108-15, cells. FEBS Lett. 353: 23123-23124 .

51. Alousi, A. A., J. R. Jasper, P. A. Insel, and H. J. Motulsky. 1991. Stoichiometry of receptor-Gs-adenylate cyclase interactions. FASEB J. 5: 2300-2303 [Abstract].





This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
N. J. Fairbank, S. C. Connolly, J. D. MacKinnon, K. Wehry, L. Deng, and G. N. Maksym
Airway smooth muscle cell tone amplifies contractile function in the presence of chronic cyclic strain
Am J Physiol Lung Cell Mol Physiol, September 1, 2008; 295(3): L479 - L488.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
R. B. Penn and J. L. Benovic
Regulation of Heterotrimeric G Protein Signaling in Airway Smooth Muscle
Proceedings of the ATS, January 1, 2008; 5(1): 47 - 57.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Y. Osawa, P. D. Yim, D. Xu, R. A. Panettieri, and C. W. Emala
Raf-1 kinase mediates adenylyl cyclase sensitization by TNF-{alpha} in human airway smooth muscle cells
Am J Physiol Lung Cell Mol Physiol, June 1, 2007; 292(6): L1414 - L1421.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Y. Osawa, D. Xu, D. Sternberg, J. R. Sonett, J. D'Armiento, R. A. Panettieri, and C. W. Emala
Functional expression of the GABAB receptor in human airway smooth muscle
Am J Physiol Lung Cell Mol Physiol, November 1, 2006; 291(5): L923 - L931.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
K. G. Tantisira, K. M. Small, A. A. Litonjua, S. T. Weiss, and S. B. Liggett
Molecular properties and pharmacogenetics of a polymorphism of adenylyl cyclase type 9 in asthma: interaction between {beta}-agonist and corticosteroid pathways
Hum. Mol. Genet., June 15, 2005; 14(12): 1671 - 1677.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. M. Freyer, C. K. Billington, R. B. Penn, and I. P. Hall
Extracellular Matrix Modulates {beta}2-Adrenergic Receptor Signaling in Human Airway Smooth Muscle Cells
Am. J. Respir. Cell Mol. Biol., October 1, 2004; 31(4): 440 - 445.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. S. Ostrom, R. A. Bundey, and P. A. Insel
Nitric Oxide Inhibition of Adenylyl Cyclase Type 6 Activity Is Dependent upon Lipid Rafts and Caveolin Signaling Complexes
J. Biol. Chem., May 7, 2004; 279(19): 19846 - 19853.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
W. Gogarten, K. S. Lindeman, C. A. Hirshman, and C. W. Emala
Tumor Necrosis Factor Alpha Stimulates Adenylyl Cyclase Activity in Human Myometrial Cells
Biol Reprod, March 1, 2003; 68(3): 751 - 757.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. M. Pascual, C. K. Billington, I. P. Hall, R. A. Panettieri Jr., J. E. Fish, S. P. Peters, and R. B. Penn
Mechanisms of cytokine effects on G protein-coupled receptor-mediated signaling in airway smooth muscle
Am J Physiol Lung Cell Mol Physiol, December 1, 2001; 281(6): L1425 - L1435.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
D. Xu, C. Isaacs, I. P. Hall, and C. W. Emala
Human airway smooth muscle expresses 7 isoforms of adenylyl cyclase: a dominant role for isoform V
Am J Physiol Lung Cell Mol Physiol, October 1, 2001; 281(4): L832 - L843.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
K. B. Jourdan, N. A. Mason, L. Long, P. G. Philips, M. R. Wilkins, and N. W. Morrell
Characterization of adenylyl cyclase isoforms in rat peripheral pulmonary arteries
Am J Physiol Lung Cell Mol Physiol, June 1, 2001; 280(6): L1359 - L1369.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
S. J. Mundell, M. E. Olah, R. A. Panettieri Jr., J. L. Benovic, and R. B. Penn
Regulation of G Protein-Coupled Receptor-Adenylyl Cyclase Responsiveness in Human Airway Smooth Muscle by Exogenous and Autocrine Adenosine
Am. J. Respir. Cell Mol. Biol., February 1, 2001; 24(2): 155 - 163.
[Abstract] [Full Text]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. J. Ammit, R. K. Hoffman, Y. Amrani, A. L. Lazaar, D. W. P. Hay, T. J. Torphy, R. B. Penn, and R. A. Panettieri Jr.
Tumor Necrosis Factor-alpha -Induced Secretion of RANTES and Interleukin-6 from Human Airway Smooth-Muscle Cells . Modulation by Cyclic Adenosine Monophosphate
Am. J. Respir. Cell Mol. Biol., December 1, 2000; 23(6): 794 - 802.
[Abstract] [Full Text]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
S. B. Liggett
Plastic Adenylyl Cyclase
Am. J. Respir. Cell Mol. Biol., November 1, 1999; 21(5): 564 - 566.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Billington, C. K.
Right arrow Articles by Penn, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Billington, C. K.
Right arrow Articles by Penn, R. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 1999 American Thoracic Society.