|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
Abstract |
|---|
|
|
|---|
Mechanical tension extending throughout the structural elements of the lung is a potential stimulus for cell proliferation and gene expression. Pulmonary fibroblasts located in the interstitial space of the capillary wall throughout the lung parenchyma and within the large vessels and airways are uniquely situated to sense changes in mechanical force. Therefore, we used the polymerase chain reaction-based method of differential display analysis to screen for altered gene expression in fetal human lung fibroblasts exposed to increased cyclic stretch. IMR-90 cells were seeded at 3 × 104 cells/cm2 on laminin-coated plates. Cells were subsequently exposed to mechanical strain on a Flexercell apparatus, resulting in a maximal elongation of 20% at a rate of 60 cycles/min over a period of 48 h. A complementary DNA corresponding to the cell cycle-regulated gene calcyclin was identified in mechanically strained fibroblasts. Increased calcyclin messenger RNA levels were confirmed by Northern blot analysis. Further, calcyclin gene expression was upregulated in isolated-perfused rat lungs exposed to increased mechanical strain by ventilation at high states of lung inflation for 4 h. These data suggest that calcyclin gene expression plays a role in the response of pulmonary fibroblasts to increased mechanical tension and may alter the regulation of the fibroblast cell cycle.
| |
Introduction |
|---|
|
|
|---|
The exchange of respiratory gases requires that the lungs repeatedly expand to take in a new breath and subsequently deflate. Integral to this process is the development of mechanical forces by the structural elements composing the extensive pulmonary vasculature and airways. Mechanical forces in the lung may take the form of longitudinal, circumferential, or surface tension associated with lung inflation or shear stress due to increased air or blood flow (1). Signals stemming from these types of mechanical forces are thought to regulate cell proliferation and subsequent cellular composition of the lung. This is clearly evident in the developing fetus. Rapid fetal lung growth is inhibited by an absence of breathing movements or a size limitation of the thoracic cavity restricting lung expansion (2). Mechanical forces have also been implicated in the regulation of cellular proliferation after resection of lung tissue (3). The burst of DNA synthesis in response to compensatory growth is most likely influenced by overexpansion of the remaining lung tissue inflated by a normal tidal volume (4). In a clinical setting, mechanical ventilation commonly used in the treatment of patients can also result in overinflation of lung regions. Zhang and colleagues (5) recently increased mechanical strain in unanesthetized ferret lungs by continuous positive airway pressure ventilation over an extended 2-wk period. Ventilation at modestly high lung volumes resulted in a 40% increase in total lung capacity associated with increased lung weight, total protein, and total cellular DNA content. These biochemical changes suggest that both cellular proliferation and tissue remodeling have occurred.
Dramatic imbalances in mechanical forces are also associated with many pathologic conditions of the lung. For instance, the large increases in vascular pressures observed in pulmonary hypertension are marked by a thickening of the large- and medium-sized vessels. This remodeling response results from a proliferation of smooth-muscle cells (SMCs) and fibroblasts, accompanied by increased collagen and elastin gene expression (6). The increased wall tension associated with elevated pulmonary artery pressures has been re-created in vitro by subjecting pulmonary artery rings to increased tension over times ranging from several hours to days. Over a short-term period of 4 h DNA synthesis rate is unchanged (7). In contrast, cell proliferation is increased in pulmonary artery segments subjected to increased tension for a much longer period of 4 to 5 d (8). This proliferative response appears more evident in the adventitial fibroblasts population than in medial SMCs (8). Interestingly, the gene expression of extracellular matrix components is already initiated as early as 4 h in both mechanically strained pulmonary artery rings and in lungs ventilated at high inflation volumes (9, 10).
Several cell types isolated from the lung respond to the
direct effect of increased cyclic mechanical strain. Pulmonary cells reported to increase their rate of DNA synthesis
include epithelial cells (11), airway SMCs (12), pulmonary
artery SMCs (13), a mixed population of fetal lung cells
(14), and fetal fibroblasts (15). The precise mechanism by
which cells sense changes in mechanical strain and transduce this signal is currently under investigation. Many cell
types, including IMR-90 fibroblasts, display a mechanical
strain-dependent change in cell shape. Cells become elongated in response to strain and align perpendicular to the
direction of the force vector (15). In fetal rat lung cells,
early responses to mechanical strain involve a rapid influx of Ca2+ molecules through gadolinium-sensitive, stretch-activated ion channels (16) and translocation of the tyrosine protein kinase pp60src to the cytoskeleton, where it
is found in an active state (17). pp60src subsequently phosphorylates several intracellular proteins, including phospholipase C-
1, leading to increased levels of 1,4,5 inositol triphosphate, diacylglycerol, and protein kinase C (PKC).
Thus, through the PKC pathway, the downstream events
of growth factor activation and DNA synthesis may be initiated (18). This is true for both fibroblasts and mixed cell
populations of fetal lung cells in which the mechanical
strain-induced proliferative response is mediated by the
autocrine action of platelet-derived growth factor (PDGF)
(15, 19). Further, it has been reported that mechanical
strain itself is not sufficient to stimulate new cell division
but potentiates the action of serum growth factors (20).
The present study was undertaken to identify gene products selectively upregulated in mechanically strained pulmonary fibroblasts. We used a messenger RNA (mRNA) screening method based on polymerase chain reaction (PCR) technology to identify genes with different levels of expression in pulmonary fibroblasts exposed to cyclic mechanical strain compared with control cells. This approach has led to the isolation of a complementary DNA (cDNA) corresponding to the human calcyclin gene. Calcyclin transcripts are more abundant in IMR-90 and isolated rat fetal fibroblasts activated by mechanical strain in vitro than in control cells. Further, elevated calcyclin gene expression is observed in isolated-perfused lungs ventilated at high states of lung inflation by raising the positive end expiratory level to 13 cm H2O.
| |
Materials and Methods |
|---|
|
|
|---|
Cell Culture
The human fetal lung fibroblast cell line IMR-90 was purchased from American Type Tissue Culture (ATTC, Rockville, MD). Rat fetal lung fibroblasts were isolated from
late-gestation pups (Days 19 to 22) according to the
method of Caniggia and associates (21). Cells were maintained in minimal essential medium (MEM) with 10% fetal calf serum (FCS) and penicillin-streptomycin (50 U/
ml) (GIBCO BRL, Grand Island, NY) in a humidified atmosphere of 5% CO2/95% air at 37°C. During the application of mechanical strain the cells were supplemented with
10
5 M ascorbic acid. IMR-90 cells were used between passages 10 and 20. Rat fetal lung fibroblasts were passage 3.
In Vitro Application of Cyclic Mechanical Strain to Fibroblasts
The Flexercell strain apparatus was used to expose cell cultures to increased cyclic mechanical strain (Flexercell International Corp., McKeesport, PA). In this system, cells
were grown on a flexible-bottom elastomer coated with
laminin protein, Flex I culture plates. Fibroblasts were
seeded at a density of 3 × 104 cell/cm2 and allowed to attach for 48 h. At the initiation of cyclic mechanical strain,
fibroblasts were replenished with MEM/10% FCS supplemented with 10
5 M ascorbic acid. A maximal elongation
of 20% was obtained by applying
13 kPa of vacuum pressure and cells were cyclically strained at a rate of 60 cycles/
min over a period of 48 h unless otherwise indicated.
Isolated-Perfused Lung Preparation
The isolated rat lung preparation has been previously described (10). Briefly, male Charles River Sprague-Dawley rats weighing between 219 and 321 g (268 ± 36 g) were anesthetized with an intraperitoneal injection of pentobarbital (65 mg/kg). The trachea was cannulated and the rats were ventilated with 20% O2/5% CO2 using a rodent ventilator (Model 683; Harvard, South Natick, MA) with a tidal volume of 2.5 ml and a positive end expiratory pressure (PEEP) of 3 cm H2O. The ventilation rate was 40 breaths/min. The chest was opened and 300 U of sodium heparin were injected into the right ventricle. The pulmonary artery and left atrium were then cannulated and the heart and lungs excised en bloc. The lungs were then suspended from a counterbalanced force transducer (Grass model FT-10) calibrated so a 1.0-cm deflection equaled a 1.0-g weight gain. Lungs were perfused with a 30-ml volume. The perfusate consisted of two parts Krebs's bicarbonate buffer containing 5% bovine albumin and one part homologous blood obtained from a donor rat. The perfusate was warmed to 37°C before being pumped through the lungs at a flow rate of 6.5 or 15 ml/min using a Minipuls 3 roller pump (Gilson, Middleton, WI). Arterial, venous, and airway pressures in addition to lung weight were continuously recorded using Cobe pressure transducers (Cobe, Lakewood, CO) and a Gould model polygraph (Grass, Quincy, MA).
Application of Mechanical Stress to Isolated-Perfused Lung
Three experimental groups were established that represent increasing levels of mechanical stress. (1) Unperfused controls: lung samples were obtained from one group of anesthetized rats that were not ventilated ex vivo. (2) Low-pressure perfusion group: lungs of these rats were isolated and perfused for 4 h. Lungs were ventilated at baseline vascular and airway pressures. These parameters were set at a tidal volume of 2.5 ml, flow rate of 6.5 ml/min, PEEP of 3 cm H2O, and venous pressure (Pv) of 3 to 4 cm H2O. No significant increase in pulmonary artery pressure was observed after a ventilation period of 4 h. (3) High airway pressure group: In this group rat lungs were isolated and perfused in a similar preparation. After a baseline period of 10 to 20 min, the PEEP was increased to 13 cm H2O and blood flow to 15 ml/min, resulting in an average peak inspiratory pressure of 30.5 cm H2O ± 2.35 standard deviation (SD). Pulmonary artery pressure increased from 18 ± 2.55 SD to 32.6 ± 9.10 cm H2O after a 4-h ventilation period. In the high-PEEP group, two animals were perfused at Pv of 5 cm H2O and three animals at Pv of 8 cm H2O. Total cellular RNA (cRNA) was isolated from the outer 1 to 2 mm of lung parenchyma and the remaining central region of the lung.
Differential Display Analysis
Total cRNA was isolated from control and strained IMR-90 fibroblasts according to the method of Chomczynski
and Sacchi (22). RNA was DNase I (GIBCO BRL)-treated,
followed by phenol-chloroform/chloroform extraction and
ethanol precipitation. A total of 200 ng of total cRNA was
preheated at 65°C for 5 min and reverse transcribed with SuperScript II RNAse H
Reverse Transcriptase (GIBCO
BRL) at 37°C for 60 min. The reaction mix contained 0.2 µm anchored 3' primer M13FT12GA (GENOMYX Corp., Foster City, CA), 1× SuperScript II RT Buffer, 20 µm of
each deoxynucleotide triphosphate (dNTP), 10 ng/ml total
cRNA, and 0.25 U/µl SuperScript II RT enzyme. Samples
were then heat-inactivated at 95°C for 5 min. A total of
2 µl of the reverse transcriptase product was used for differential display amplification using PCR. Reaction conditions included the following components: 1× PCR reaction buffer including 1.5 mM MgCl2, 20 µm of each
dNTP (Boehringer Mannheim, Indianapolis, IN), 0.2 µm
3' oligo-dT anchored primer M13FT12GA, 0.2 µm 5' arbitrary primer ACAATTTACACACAGGACGACTCCAAG (GENOMYX Corp.), 0.05 U/µl AmpliTaq enzyme
(Roche Molecular Systems, Inc., Branchburg, NJ), and
0.125 µCi/µl [
-33P] (NEN DuPont, Boston, MA). PCR
was performed using a Microcycler E (Eppendorf; Brinkmann Instruments, Inc., Westbury, NY) at the following
settings: 95°C 2 min, 92°C 15 s, 50°C 30 s, and 72°C 2 min
for four cycles; 95°C 15 s, 60°C 30 s, and 72°C 2 min for 25 cycles; and 72°C for 7 min. Samples were then placed on
ice. The differentially displayed bands were resolved on a
6% denaturing gel using the LR-optimized HR-100 gel
formulation from GENOMYX and a GENOMYX LR
DNA Sequencer run at 2700 V, 100 W, at 50°C for 3.5 h.
The sequencing gel was then dried onto the glass plate and
exposed to Biomax film (Eastman Kodak Co., New Haven,
CT). Using the autoradiograph as a template, the band of
interest was cut out from the gel and reamplified directly
by PCR synthesis. The PCR reamplification reaction included 1× PCR buffer with 1.5 mM MgCl2, 20 µm of each
dNTP, 0.2 µm of the same 5' arbitrary and 3' anchored primers, 0.2 µm AmpliTaq enzyme, and the dried gel band.
PCR cycles were as follows: 95°C 2 min, 92°C 15 s, 60°C 30 s, and 72°C 2 min for 40 cycles; then 72°C for 7 min.
Subcloning and Nucleic Acid Sequencing
The reamplified product was electrophoresed on a 2% agarose gel and stained with ethidium bromide. The cDNA was purified from the gel using the QIAquick Gel Extraction Kit (Qiagen Corp., Chatsworth, CA) and subcloned into the TA cloning vector pCRII (Invitrogen, San Diego, CA).This plasmid was then used to sequence the cDNA on both strands with T7 and SP6 primers using an Applied Biosystems 373 Automated DNA Sequencer (ABI Division of Perkin-Elmer, Foster City, CA). Significant homology of the cDNA was determined by comparison to known sequences in the GenBank database through use of the basic alignment search tool (BLAST) algorithm.
Northern Blot Analysis
An aliquot of the reamplified PCR product was oligolabeled
with [
-32P]deoxycytidine triphosphate (dCTP) (Stratagene,
San Diego, CA) and used as a probe in Northern blot analysis. Total cRNA isolated from 12 wells of IMR-90 or fetal
rat lung fibroblasts or lung parenchymal tissue was quantitated by absorbance at 260 nm and intactness assessed by
ethidium bromide staining after electrophoretic separation in a 6.6% formaldehyde/1% agarose gel. Fractionated RNA was transferred by Northern blot to Zeta probe
membrane (Bio-Rad, Hercules, CA). RNA was crosslinked
to the membrane by ultraviolet irradiation and stored at
4°C. Prehybridization and hybridizations were performed
at high-stringency conditions in 50% formamide, 5× saline
sodium citrate (SSC) (20× SSC is 0.3 M sodium chloride and 0.3 M sodium citrate), 10× Denhardt's solution (100×
Denhardt's solution is 2% Ficoll, 2% polyvinyl pyrrolidone, and 2% bovine serum albumin), 50 mM sodium phosphate (pH 6.5), and 1% sodium dodecyl sulfate (SDS), 200 µg/ml salmon sperm DNA at 42°C for both human and
rat total cRNA. Blots were washed in 0.1× SSC/0.1% SDS
at 65°C. The signal was obtained by exposure to XAR-5
X-ray film (Eastman Kodak Co.) using a Cronex Lightning
Plus screen at
80°C. Autoradiographs were quantitated
by densitometry within the linear range of signals and normalized to ribosomal 18S or 28S RNA levels.
Western Blot Analysis
Lung protein was isolated from parenchymal tissue according to the procedure of Tokumitsu and coworkers
(23). Tissue was homogenized at 4°C in extraction buffer
(0.2 M NaCl, 40 mM Tris-HCl [pH 7.5], 2 mM ethyleneglycol-bis-(
-aminoethyl ether)-N,N'-tetraacetic acid, 10 mg/
liter leupeptin, 50 mg/liter trypsin inhibitor, and 0.1 mM
phenylmethylsulfonyl fluoride). Samples were then centrifuged at 100,000 × g for 60 min at 4°C. The supernatant
was quantitated by Bio-Rad protein assay (Bio-Rad Laboratories, Richmond, CA) and confirmed by staining with
amido black. A total of 40 µg of protein was electrophoresed on a 15% polyacrylamide gel under reducing conditions as described elsewhere (24). The resolved proteins
were detected using a rabbit anticalcyclin antibody, S100A6 (SWANT Antibodies, Bellinzona, Switzerland),
and an ECL Western blotting detection kit (Amersham International).
| |
Results |
|---|
|
|
|---|
Detection of a 400-Base Pair cDNA by Differential Display Analysis
The PCR-based method of differential display analysis (DD-PCR) was used to identify genes that display an altered expression pattern in lung fibroblasts subjected to increased cyclic mechanical strain. Exponentially growing, late-log fibroblasts were mechanically strained over a period of 48 h and total cRNA samples were prepared from both control and strained cells. These RNA samples were used to reverse transcribe a subset of corresponding cDNAs using a primer specific to the 3' poly A tail. First-strand cDNA products were then amplified using the PCR in the presence of a 33P-labeled deoxyadenosine triphosphate with the same 3' primer and an arbitrary 5' primer. Radioactive cDNAs were visualized by separation on a denaturing sequencing gel. Several reproducible cDNA bands appeared to be differentially expressed in the mechanically strained samples compared with control samples. In particular, an intense signal was observed for a 400-base pair (bp) cDNA in the lanes representing mechanically strained fibroblast mRNAs. This cDNA band was excised from the DD-PCR gel for further analysis (Figure 1).
|
Northern Blot Analysis of mRNA Levels from Mechanically Strained Fibroblasts
To confirm that the band identified in the differential display denaturing gel was not a false-positive result, Northern blot analysis was performed (Figure 2). Total cRNA (10 µg) originally used in the differential display reaction was electrophoresed on an agarose-formaldehyde gel and transferred to a membrane. The Northern blot was hybridized with the same cDNA that was excised from the gel and reamplified by PCR. A strong mRNA signal was observed in fibroblasts corresponding to a transcript size of approximately 0.75 kb. Although there was a high basal level of this transcript in control fibroblasts, there was a further 2-fold increase in mRNA level in mechanically strained fibroblasts. This mRNA transcript is within the size range of the originally reported 2A9/calcyclin transcript, approximately 0.6 kb (25), and later-reported transcript size of 0.75 kb (26). In addition, mRNA levels were measured in isolated rat fetal pulmonary fibroblasts (Figure 3) subjected to increased strain. Levels of mRNA were elevated above control values 24 (86%), 48 (30%), 72 (76%), and 96 h (152%) after the application of cyclic mechanical strain. Differences in mRNA levels in unstrained cultures reflect the proliferative level of the cell population.
|
|
DNA Sequence Analysis
After Northern blot analysis, the cDNA identified on the
DD-PCR gel was sequenced on both strands using an automated ABI 373A sequencer. This sequence was then compared with known sequences in the GenBank using the
BLAST algorithm (27). The match with the highest degree of homology was the human growth factor-inducible 2A9 gene (25). 2A9 is a relatively short, 434-bp cDNA sequence and the cDNA isolated by DD-PCR is almost
completely identical to 2A9. There is 97% (P = 1.4 × 10
149) identity between 2A9 and the DD-PCR-isolated
cDNA over a 387-bp length of sequence. The 2A9 gene
was initially identified by subtractive hybridization in quiescent fibroblasts stimulated to proliferate by the addition
of serum (25). The human calcyclin gene consists of three
exons. The first exon is relatively short and untranslated (28). The cDNA isolated in the DD-PCR gel extends from
the poly A tail through all of exon 3 and most of exon 2. These results indicate with a high degree of certainty that
the cDNA isolated by differential display analysis is indeed the human calcyclin gene.
Upregulation of Calcyclin Gene Expression in a Lung Model of Increased Mechanical Strain
The level of calcyclin mRNA and protein was also measured in a rat lung model of increased mechanical strain. Lungs from adult Sprague-Dawley rats were isolated and perfused ex vivo. Lungs were subsequently ventilated at physiologically control (LoPress) or high states (HiPaw) of lung inflation and compared with an unperfused lung group (UnPer). Ventilation at high lung volumes resulted in a 2-fold increase in pulmonary artery pressure (18 ± 2.55 SD to 32.6 ± 9.10 cm H2O) after a 4-h ventilation period compared with initial LoPress conditions. At the end of the ventilation period, tissue was separately dissected from the outer 1 to 2 mM peripheral or the remaining central regions of the lung. Total cRNA was isolated from the parenchymal tissue of each group for Northern blot analysis (Figure 4). Hybridization with the 32P-oligo labeled cDNA isolated from the DD-PCR gel (Figure 1) revealed the same size calcyclin transcript as observed in cultured human fibroblasts. In both unperfused control (UnPer) and LoPress lungs the calcyclin mRNA levels were undetectable. However, in the HiPaw group the calcyclin transcript was observed in each lung sample. The level of calcylcin transcript was identical in the outer peripheral and central regions of the HiPaw lung. Further, there was no increase in calcylcin mRNA levels in lungs ventilated at a Pv of 8 cm H2O compared with those ventilated with a Pv of 5 cm H2O. Western blot analysis was also performed using lung samples from HiPaw and LoPress lungs (Figure 5). An increase in signal intensity of a 10-kD band detected with an anticalcyclin antibody was observed in HiPaw lung protein compared with the LoPress lung group.
|
|
| |
Discussion |
|---|
|
|
|---|
Calcyclin Is a Member of the S100 Family of Ca2+-Binding Proteins
Although the precise cellular function of calcyclin is presently unknown, calcyclin is a member of the S100 family of Ca2+-binding proteins and is associated with cell proliferation. The calcyclin gene is overexpressed in many types of cancer cells (28) and is abundant in both the kidney and lungs (29). In the lung it is thought to interact with another Ca2+-binding protein, CAP-50 (50 kD, calcyclin-associated protein). CAP-50 is a recently identified member of the annexin family of proteins, annexin XI (30).
Potential Role of Calcyclin/CAP-50 in Mechanical Signaling Pathways
There are several indirect pieces of evidence that may suggest an involvement of calcyclin and/or its target protein CAP-50 with specific mechanically mediated events in the lung fibroblast. First, the transcriptional promoter of calcyclin contains a PDGF-responsive element and a consensus sequence identical to the shear stress-responsive element (GGCTCT) (31). The latter cis-acting promoter element is functionally active in several genes induced by shear stress, including PDGF-B (32). Both fetal fibroblasts and a mixed lung population of fetal rat cells (abundant in fibroblasts and epithelial cells) are mechanically stimulated to proliferate through the autocrine action of PDGF (15, 19). Second, the roles of calcyclin and CAP-50 are dependent on calcium. Mechanical strain results in a rapid influx of Ca2+ ions through gadolinium-sensitive, stretch-activated ion channels, and this event is necessary for DNA synthesis to occur (16). Further, activation of the protein tyrosine kinase pp60src is proposed to be a common upstream regulatory event in mechanical stretch pathways (33), and the overexpression of v-src in embryonic fibroblasts is linked to the phosphorylation and translocation of CAP-50 from the nucleus to the cytoplasm as well as its dissociation from phospholipid membranes (30). In mechanically strained fibroblasts there is a dramatic change in cell shape. Cells align perpendicular to the force vector, and this is accompanied by a reorganization of the cytoskeleton filament network. Interestingly, calcyclin specifically binds to the actin-binding protein tropomyosin in vitro (34). Similar Ca2+-dependent cytoskeletal proteins are also activated in response to mechanical strain. For example, calmodulin expression is increased in mechanically strained osteoblasts, leading to subsequent cell proliferation (35). Further, in nonmuscle cells it has recently been reported that pEL98 (an S100 protein with two endonexin fold (EF) domains very similar to calcyclin) binds to the nonmuscle tropomyosin isoform 2 and regulates tropomyosin-actin interactions (36). Decreased tropomyosin expression has been correlated with a reorganization of the cytoskeleton, altered cell shape, and loss of anchorage-dependent regulation over cell growth in many transformed cancer cells (37).
Implication of Increased Calcyclin in Mechanically Strained Lung
From our in vitro studies of mechanically strained fibroblasts, it is clear that fibroblasts increase their calcyclin level. In our laboratory these same cells grown on a laminin or elastin matrix, but not fibronectin, demonstrated an increased expression of type I collagen response to increased cyclic mechanical strain (38). Several reports have also demonstrated in vitro an increase in cell proliferation 1 to 5 d after the application of strain (14, 15), which parallels our observed increase in calcyclin mRNA in fibroblasts. Application of increased mechanical strain to the lung also resulted in a dramatic increase in calcyclin mRNA and protein levels in the HiPaw group. However, in the lung a potential signal for cells to proliferate may occur as early as 4 h after the elevation of mechanical tension. Finally, varying the Pv levels from 5 to 8 cm H2O did not result in a further increase in calcyclin mRNA levels. This observation suggests that circumferential, longitudinal, or surface tension associated with lung inflation was the main mechanical stimulus triggering calcyclin transcription.
Similar Functions of Calcyclin in the Kidneys and Lungs
In a physiologic setting, calcyclin has been reported to play a role in the injury response of the kidney. Calcyclin was found among several cell cycle genes induced in folic acid- induced nephrotic injury that results in denudation of tubular basement membrane. This study distinguished the role of cell cycle genes in regenerative hyperplasia versus hypertrophy resulting from resection of renal mass (26). More recently, calcyclin was found upregulated in ischemic injury to rat kidney (39). In this situation again, it was hypothesized that the epithelial cell in contact with the basement membrane is the main cell to respond to injury by increasing the level of cellular proliferation; although it has not been distinguished in this whole-lung preparation which cell types are expressing calcyclin mRNAs. A survey of several tissue types indicated that calcyclin protein is found exclusively in epithelial cell and fibroblasts (40). In the lung, several developmental and pathologic conditions are influenced by mechanical strain. Mechanical strain in the lung may lead to increased cell growth accompanied by normal remodeling, as in the case of fetal development or pneumonectomy (41). However, persistent abnormal application of mechanical strain may be involved in uncontrolled fibroblast and SMC proliferation and overexpression of extracellular matrix proteins as observed in pulmonary hypertension (6). Whether the calcyclin gene is merely a step in the progression of the cell cycle or is part of the mechanotransduction signaling pathway involved in Ca2+-dependent cytoskeleton reorganization remains to be determined.
| |
Footnotes |
|---|
Address correspondence to: Ellen C. Breen, Ph.D., UCSD, Dept. of Medicine 0623A, 9500 Gilman Dr., La Jolla, CA 92093-0623. E-mail: ebreen{at}ucsd.edu
(Received in original form January 21, 1998 and in revised form June 8, 1999).
Abbreviations: base pair, bp; complementary DNA, cDNA; cellular RNA, cRNA; PCR-based differential display analysis, DD-PCR; deoxynucleotide triphosphate, dNTP; messenger RNA, mRNA; polymerase chain reaction, PCR; platelet-derived growth factor, PDGF; positive end expiratory pressure, PEEP; venous pressure, Pv; standard deviation, SD; smooth-muscle cell, SMC; saline sodium citrate, SSC.Acknowledgments: The authors thank Dr. John B. West for his assistance in preparation of this manuscript and continued support. This study was supported by the National Institutes of Health RO1 HL 46910.
| |
References |
|---|
|
|
|---|
1.
West, J. B.,
K. Tsukimoto,
O. Mathieu-Costello, and
R. Prediletto.
1991.
Stress failure in pulmonary capillaries.
J. Appl. Physiol.
70:
1731-1742
2.
Joe, P.,
L. D. Wallen,
C. J. Chapin,
C. H. Lee,
L. Allen,
V. K. Han,
L. G. Dobbs,
S. Hawgood, and
J. A. Kitterman.
1997.
Effects of mechanical factors on growth and maturation of the lung in fetal sheep.
Am. J. Physiol.
272:
L95-L105
3. Rannels, D. E., and S. R. Rannels. 1988. Compensatory growth of the lung following partial pneumonectomy. Exp. Lung Res. 14: 157-182 [Medline].
4. Brody, J. S., R. Burki, and N. Kaplan. 1978. Deoxyribonucleic acid synthesis in lung cells during compensatory lung growth after pneumonectomy. Am. Rev. Respir. Dis. 117: 307-316 [Medline].
5.
Zhang, S.,
V. Garbutt, and
J. T. McBride.
1996.
Strain-induced growth of
the immature lung.
J. Appl. Physiol.
81:
1471-1476
6.
Mecham, R. P.,
L. A. Whitehouse,
D. S. Wrenn,
W. C. Parks,
G. L. Griffin,
R. M. Senior,
E. C. Crouch,
K. R. Stenmark, and
N. F. Voelkel.
1987.
Smooth muscle-mediated connective tissue remodeling in pulmonary hypertension.
Science
237:
423-426
7. Tozzi, C. A., G. J. Poiani, A. M. Harangozo, C. D. Boyd, and D. J. Riley. 1989. Pressure-induced connective tissue synthesis in pulmonary artery segments is dependent on intact endothelium. J. Clin. Invest. 84: 1005-1012 .
8.
Kolpakov, V.,
M. D. Rekhter,
D. Gordon,
W. H. Wang, and
T. J. Kulik.
1995.
Effect of mechanical forces on growth and matrix protein synthesis
in the in vitro pulmonary artery.
Circ. Res.
77:
823-831
9.
Berg, J. T.,
Z. Fu,
E. C. Breen,
H.-C. Tran,
O. Mathieu-Costello, and
J. B. West.
1997.
High lung inflation increases mRNA level of extracellular matrix components in lung parenchyma.
J. Appl. Physiol.
83:
120-128
10. Parker, J. C., E. C. Breen, and J. B. West. 1997. Basement membrane collagen gene expression increases in rat lungs at high inflation pressures. J. Appl. Physiol. 83: 697-705 .
11. Liu, M., J. Xu, A. Tanswell, and M. Post. 1993. Stretch-induced growth promoting activities stimulate fetal rat lung epithelial cell proliferation. Exp. Lung Res. 19: 505-517 [Medline].
12.
Smith, P. G.,
R. Moreno, and
M. Ikebe.
1997.
Strain increases airway
smooth muscle contractile and cytoskeletal proteins in vitro.
Am. J. Physiol.
272:
L20-L27
13. Kulik, T. J., and S. P. Alvarado. 1993. Effect of stretch on growth and collagen synthesis in cultured rat and lamb pulmonary arterial smooth muscle cells. J. Cell. Physiol. 15: 615-624 .
14.
Liu, M.,
S. Skinner,
J. Xu,
R. Han,
A. Tanswell, and
M. Post.
1992.
Stimulation of fetal rat lung cell proliferation in vitro by mechanical stretch.
Am. J. Physiol.
263:
L376-L383
15. Bishop, J. E., J. J. Mitchell, P. M. Absher, L. Baldor, H. A. Geller, J. Woodcock-Mitchell, M. J. Hamblin, P. Vacek, and B. Low. 1993. Cyclic mechanical deformation stimulates human lung fibroblasts proliferation and autocrine growth factor activity. Am. J. Respir. Cell Mol. Biol. 9: 126-133 .
16. Liu, M., J. Xu, A. K. Tanswell, and M. Post. 1994. Inhibition of mechanical strain-induced fetal rat lung cell proliferation by gadolinium, a stretch- activated channel blocker. J. Cell. Physiol. 161: 501-507 [Medline].
17.
Liu, M.,
Y. Qin,
J. Liu,
A. K. Tanswell, and
M. Post.
1996.
Mechanical strain
induces pp60src activation and translocation to cytoskeleton in fetal rat
lung cells.
J. Biol. Chem.
271:
7066-7071
18.
Liu, M.,
J. Xu,
J. Liu,
M. Kraw,
A. Tanswell, and
M. Post.
1995.
Mechanical
strain-enhanced fetal lung cell proliferation is mediated by phospholipase
C and D and protein kinase C.
Am. J. Physiol.
268:
L729-L738
19. Liu, M., J. Liu, S. Buch, A. K. Tanswell, and M. Post. 1995. Antisense oligonucleotides for PDGF-B and its receptor inhibit mechanical strain-induced fetal lung cell growth. Am. J. Physiol. 268: L178-L184 .
20. Butt, R. P., and J. E. Bishop. 1997. Mechanical load enhances the stimulatory effect of serum growth factors on cardiac fibroblast procollagen synthesis. J. Mol. Cell. Cardiol. 29: 1141-1151 [Medline].
21.
Caniggia, I.,
I. Tseu,
R.N. Han,
B. T. Smith,
K. Tanswell, and
M. Post.
1991.
Spatial and temporal differences in fibroblast behavior in fetal rat lung.
Am. J. Physiol.
261:
L424-L433
22. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium, thiocyanate-phenol chloroform extraction. Anal. Biochem. 162: 156-159 [Medline].
23. Tokumitsu, H., R. Kobayashi, and H. Hidaka. 1991. A calcium-binding protein from rabbit lung cytosol identified as the product of growth-regulated gene (2A9) and its binding proteins. Arch. Biochem. Biophys. 291: 401 [Medline].
24. Laemmli, U.. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685 [Medline].
25.
Calabretta, B.,
R. Battini,
L. Kaczmarek,
J. K. de Riel, and
R. Baserga.
1986.
Molecular cloning of the cDNA for a growth factor-inducible gene
with strong homology to S-100, a calcium-binding protein.
J. Biol. Chem.
261:
12628-12632
26.
Norman, J. T.,
R. E. Bohman,
G. Fischmann,
J. W. Bowen,
A. McDonough,
D. Slamon, and
L. G. Fine.
1988.
Patterns of mRNA expression during
early cell growth differ in kidney epithelial cells destined to undergo compensatory hypertrophy versus regenerative hyperplasia.
Proc. Natl. Acad.
Sci. USA
85:
6768-6772
27. Altshul, S., W. Gish, W. Miller, E. Myers, and D. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215: 403-410 [Medline].
28.
Ferrari, S.,
B. Calabretta,
J. K. de Riel,
R. Battini,
F. Ghezzo,
E. Lauret,
C. Griffin,
B. S. Emanuel,
F. Gurrieri, and
R. Baserga.
1987.
Structural and
functional analysis of a growth-regulated gene, the human calcyclin.
J.
Biol. Chem.
262:
8325-8332
29.
Murphy, L. C.,
L. J. Murphy,
D. Tsuyuki,
M. L. Duckworth, and
R. P. Shiu.
1988.
Cloning and characterization of a cDNA encoding a highly conserved putative calcium binding protein, identified by an anti-prolactin receptor antiserum.
J. Biol. Chem.
263:
2397-2401
30. Mamiya, N., S. Iino, A. Mizutani, S. Kobayashi, and H. Hidaka. 1994. Development-related and cell-type specific nuclear localization of annexin XI: immunolocalization analysis in rat tissues. Biochem. Biophys. Res. Commun. 202: 403-409 [Medline].
31.
Ghezzo, F.,
E. Lauret,
S. Ferrari, and
R. Baserga.
1988.
Growth factor regulation of the promoter for calcyclin, a growth-regulated gene.
J. Biol.
Chem.
263:
4758-4763
32.
Resnick, N.,
T. Collins,
W. Atkinson,
D. T. Bonthron,
C. F. Dewey Jr., and
M. A. Gimbrone Jr..
1993.
Platelet-derived growth factor B chain promoter contains a cis-acting fluid shear-stress-responsive element.
Proc.
Natl. Acad. Sci. USA
90:
4591-4595
33. Banes, A., M. Tsuzake, J. Yamamoto, T. Fischer, B. Brigman, T. Brown, and L. Miller. 1995. Mechanoreception at the cellular level: the detection, interpretation, and diversity of responses to mechanical signals. Biochem. Cell Biol. 73: 349-365 [Medline].
34. Golitsina, N. L., J. Kordowska, C. L. Wang, and S. S. Lehrer. 1996. Ca2+- dependent binding of calcyclin to muscle tropomyosin. Biochem. Biophys. Res. Commun. 220: 360-365 [Medline].
35.
Brighton, C. T.,
J. R. Fisher Jr.,
S. E. Levine,
J. R. Corsetti,
T. Reilly,
A. S. Landsman,
J. L. Williams, and
L. E. Thibault.
1996.
The biochemical pathway mediating the proliferative response of bone cells to a mechanical
stimulus.
J. Bone Joint Surg. Am.
78:
1337-1347
36.
Takenaga, K.,
Y. Nakamura,
S. Sakiyama,
Y. Hasegawa,
K. Sato, and
H. Endo.
1994.
Binding of pEL98 protein, an S100-related calcium-binding
protein, to nonmuscle tropomyosin.
J. Cell Biol.
124:
757-768
37.
Boyd, J.,
J. Risinger,
R. Wiseman,
B. Merrick,
J. Seldirk, and
J. Barrett.
1995.
Regulation of microfilament organization and anchorage-independent growth by tropomyosin 1.
Proc. Natl. Acad. Sci. USA
92:
11534-11538
38. Breen, E.. 1998. Mechanical strain-induced increase in type I collagen is dependent on the extracellular matrix environment in pulmonary fibroblasts in vitro. Am. J. Respir. Crit. Care Med. 157: A246 .
39. Lewington, A. J. P., B. J. Padanilam, and M. R. Hammerman. 1997. Induction of calcyclin after ischemic injury to rat kidney. Am. J. Phsyiol. 273: F380-F385 .
40. Kuznicki, J., J. Kordowska, M. Puzianowska, and B. M. Wozniewicz. 1992. Calcyclin as a marker of human epithelial cells and fibroblasts. Exp. Cell Res. 200: 425-430 [Medline].
41. Koh, D. W., J. D. Roby, B. Starcher, R. M. Senior, and R. A. Pierce. 1996. Postpneumonectomy lung growth: a model of reinitiation of tropoelastin and type I collagen production in a normal pattern in adult lung. Am. J. Respir. Cell Mol. Biol. 15: 611-623 [Abstract].
This article has been cited by other articles:
![]() |
J. Guo, R. Ananthakrishnan, W. Qu, Y. Lu, N. Reiniger, S. Zeng, W. Ma, R. Rosario, S. F. Yan, R. Ramasamy, et al. RAGE Mediates Podocyte Injury in Adriamycin-induced Glomerulosclerosis J. Am. Soc. Nephrol., May 1, 2008; 19(5): 961 - 972. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pugin, I. Dunn-Siegrist, J. Dufour, P. Tissieres, P.-E. Charles, and R. Comte Cyclic Stretch of Human Lung Cells Induces an Acidification and Promotes Bacterial Growth Am. J. Respir. Cell Mol. Biol., March 1, 2008; 38(3): 362 - 370. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Gomez-Hospital, A. Cequier, P. V. Romero, C. Canete, C. Ugartemendia, E. Iraculis, and E. Esplugas Persistence of Lung Function Abnormalities Despite Sustained Success of Percutaneous Mitral Valvotomy: The Need for an Early Indication Chest, January 1, 2005; 127(1): 40 - 46. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Prudovsky, A. Mandinova, R. Soldi, C. Bagala, I. Graziani, M. Landriscina, F. Tarantini, M. Duarte, S. Bellum, H. Doherty, et al. The non-classical export routes: FGF1 and IL-1{alpha} point the way J. Cell Sci., December 15, 2003; 116(24): 4871 - 4881. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. TSCHUMPERLIN and J. M. DRAZEN Mechanical Stimuli to Airway Remodeling Am. J. Respir. Crit. Care Med., November 15, 2001; 164(10): S90 - 94. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Crit. Care Med. |