|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
Abstract |
|---|
|
|
|---|
The characteristic features of bronchial asthma, including airway eosinophilia and elevated immunoglobulin (Ig)E levels, are known to be orchestrated by T-helper (Th) 2 cells. Oligodeoxynucleotides containing CpG motifs (CpG) have recently been highlighted as an immunomodulator that biases toward a Th1-dominant phenotype. However, CpG may incur nonspecific Th1 activation and toxic effects. In this study we report a novel inhibition of Th2 cells by transmucosal inoculation of antigen and CpG. Intratracheal instillation of CpG inhibited airway eosinophilia and Th2 cytokine production in antigen-sensitized mice. The inhibition was observed when CpG was given at the same time or in advance of antigen challenge. Notably, concomitant administration of CpG and antigen (as opposed to either one alone) was essential for the inhibitory effects. The antigen dose could be minimized to avoid a harmful boost of eosinophilia. CpG had few effects on systemic anti-ovalbumin IgE responses. These results demonstrate that a synergism between transmucosally administered allergen and CpG inhibits Th2 cells in parallel with an improvement in airway eosinophilia and hyperresponsiveness without impeding systemic immune responses. Our data imply that inhalation of a minimal amount of allergen plus CpG could be a novel desensitization therapy for patients with bronchial asthma.
| |
Introduction |
|---|
|
|
|---|
The respiratory tract, a representative site of mucosal tissue, is repeatedly exposed to a broad array of airborne foreign allergens (1). Inhalation of allergens evokes deleterious immune and inflammatory responses in the airway, as in bronchial asthma (2). The characteristic features of bronchial asthma include airway eosinophilia and elevated serum immunoglobulin (Ig)E levels, both of which are reported to be orchestrated by type-2 T-helper (Th2) cells (3). Suppression of Th2-dominated immune responses in this setting could be a potential target of immunotherapy for bronchial asthma.
Control of airway eosinophilia by manipulation of Th2
functions has been achieved by inducing immune tolerance of Th2 cells using several distinct approaches. For example, another CD4+ T-cell subset, Th1, exerts inhibitory
effects on Th2 cells through the secretion of cytokines such
as interferon (IFN)-
(10), and those induced upon exposure to Mycobacterium tuberculosis inhibit Th2-mediated
eosinophilia (11, 12). Transforming growth factor-
-producing CD4+ T cells induced by oral or tracheal tolerance
are another subset that inhibits Th2 cells and eosinophilia
(13, 14). In these experimental models, the inhibition of
airway eosinophilia was accompanied by neutralizing Th2
activities in mediastinal lymph nodes (LNs) (13, 14).
Oligodeoxynucleotides (ODNs) containing CpG motifs
(CpG) found in bacterial but not vertebrate DNA activate
macrophages and dendritic cells to secrete interleukin
(IL)-12 and induce IFN-
-secreting Th1 cells (15). Systemic administration of CpG biased the immune responses
toward a Th1-dominant phenotype and inhibited Th2-
mediated responses, including airway eosinophilia (17, 22-
26). In light of the pathogenic roles of Th1 cells in various
types of autoimmunity (27), the effects of CpG on the activation of autoreactive T cells and autoimmunity may be
unpredictable and controversial; Gilkeson and colleagues
(28) and Mor and associates (29) reported that bacterial and
plasmid DNA did not deteriorate autoimmunity, whereas
Krieg (30) suggested that microbial DNA could be a
pathogenic factor. The toxicity of CpG was another problem. Bacterial DNA was reported to increase the toxicity
of lipopolysaccharides (LPS) (31). CpG also increased serum tumor necrosis factor (TNF)-
levels and mortality in
CpG-treated mice (32). These adverse effects would
critically hamper the usefulness of CpG as a therapeutic immunomodulator for allergic diseases.
In this study, we administered CpG via the airway mucosa and examined the effects on Th2 cells and airway eosinophilia. We found that concomitant administration of CpG and antigen (as opposed to either one alone) via a tracheal route efficiently inhibited Th2 cells in parallel with the improvement of airway eosinophilia and hyperresponsiveness, while leaving systemic immune responses unaffected. These results provide an experimental basis for the possible therapeutic application of intratracheal administration of allergen plus CpG to patients with bronchial asthma.
| |
Materials and Methods |
|---|
|
|
|---|
Animals and Immunization
BALB/c mice were bred in our animal facility and were used at 5 to 10 wk of age. These animals were primed intraperitoneally with 10 µg of ovalbumin (OVA) (Sigma Chemical Co., St. Louis, MO) precipitated with 4 mg of aluminum hydroxide (alum) in 200 µl of phosphate-buffered saline (PBS) three times at 1-wk intervals. At 7 d after the last immunization, they were challenged intratracheally with OVA either alone or with ODN (Figure 1, protocol 1). Otherwise, the OVA/alum-primed BALB/c mice were pretreated intratracheally with ODN and/or OVA (10 or 0.1 µg), and after 6 d were challenged with OVA (Figure 1, protocol 2).
|
|
CpG and Control ODNs
The ODNs were designed using published sequences (26). The CpG ODN (1826) consisted of 20 bases containing two CpG motifs (TCCATGACGTTCCTGACGTT). The control ODN (1745) was identical except that the CpG motifs were rearranged (TCCATGAGCTTCCTGAGCTT). Phosphorothioate ODNs were synthesized and purified using HPLC by Nihon Gene Research Laboratories, Inc., Sendai, Japan.
Bronchoalveolar Lavage
The lungs of BALB/c mice primed and challenged with OVA as described above were lavaged twice with PBS (0.25 and 0.20 ml each time) and approximately 0.4 ml of the instilled fluid was consistently recovered. The bronchoalveolar lavage fluid (BALF) was cytospun onto microscope slides and stained with Diff-Quik (International Reagents Corp., Kobe, Japan). Differential cell counts in BAL cells were done with at least 300 leukocytes. For cytokine measurement, BALF was centrifuged, and the supernatants were assayed by enzyme-linked immunosorbent assay (ELISA).
Histologic Evaluation
For photomicrographs, cryosections from the frozen trachea tissue were stained as described previously (13). In brief, 2 d after the last challenge the excised trachea was fixed in 10% formalin and frozen in OCT compound (Miles Laboratories, Naperville, IL). Cryosections (8 µm thick) from the frozen tissue were stained with Diff-Quik. A light-microscopic image of the trachea was captured using Light microscope Axioplan II and TV camera progress 3200 (Zeiss, Oberkochen, Germany).
Cell Culture
BALB/c mice were primed and challenged according to the protocols in Figure 1. At 2 d after the last challenge, mediastinal LN cells were pooled from three mice of each group and cultured in the presence of OVA (100 µg/ml). Where indicated, the CD4+ T-cell fraction of the LN cells was cultured with mitomycin C (Wako Chemical Industries, Ltd., Osaka, Japan)-treated spleen cells of BALB/c mice as antigen-presenting cells (APCs). The CD4+ fraction was prepared by panning methods as described previously (12, 35). The cultures were incubated in quadruplicate for 2 d in 96-well plates, and the culture supernatants were assayed for cytokines.
Anti-OVA IgE Assay
A 1:10 dilution of sera was applied to 96-well microtiter plates (Becton Dickinson, Oxnard, CA) coated with anti-IgE monoclonal antibody (5 µg/ml) (Experimental Immunology Unit, Brussels, Belgium). Bound IgE antibodies were incubated with biotinylated OVA, followed by peroxidase-labeled streptavidin (Vector Laboratories, Burlingame, CA) and tetramethylbenzidine reagent (Kierkegaard & Perry Laboratories, Gaithersburg, MD). Optical densities were determined at 450 nm, and converted to arbitrary units (U/ml) according to the standard curve obtained with serial dilutions of pooled serum from OVA-hyperimmunized BALB/c mice. The conjugation to OVA of biotin with aminocaproyl spacer (Sigma) was done in our laboratory.
Cytokine Assay
Cytokine concentrations in BALF, culture supernatant, or
serum were determined by using ELISA according to the
manufacturer's recommendations. Paired anti-IL-4, anti-
IL-5, anti-IFN-
, and anti-TNF-
monoclonal antibodies
were purchased from PharMingen (San Diego, CA). Standard recombinant mouse IL-4, IL-5, IFN-
, and TNF-
were purchased from Genzyme Co. (Cambridge, MA).
Airway Hyperresponsiveness
The OVA/alum-primed BALB/c mice were treated with either PBS or CpG plus OVA (0.1 µg) and then challenged with OVA (Figure 1, protocol 2). After 2 d of OVA challenge, airway responsiveness was assessed as a change in pulmonary resistance (RL) after injections of increasing doses of methacholine chloride (MCh) (Wako) (0.1 to 30 mg/kg), as described elsewhere (36). Mice were anesthetized by intraperitoneal injection of pentobarbital sodium (Wako) (50 mg/kg) and were tracheostomized. The airflow rate at the airway opening during spontaneous breathing was monitored by a pneumotachogram (8430B; Hans Rudolph, Kansas City, MO) combined with a differential pressure transducer (LCVR, 0 to 2 cm H2O; Celesco, Canoga Park, CA). The esophageal pressure monitored by a water-filled tube and a pressure transducer (Ohmeda, Singapore) was used as the transpulmonary pressure, because the pressure difference generated by the pneumotachogram connected to the tracheal tube was very small (< 1/100) compared with the amplitude of the esophageal pressure. RL was calculated by the subtraction method of Mead and Whittenberger (37). An average RL of three breaths at 3 min after each injection of MCh was calculated and expressed as a percentage of the baseline RL that was measured and calculated in the same way after the injection of saline used as a diluent of MCh. The provocative concentration of methacholine in milligrams per kilogram that caused a 200% increase in RL, designated PC200, was calculated by linear interpolation of the appropriate dose-response curves.
Statistics
Data are expressed as means ± standard error of the mean. For in vivo experiments, each group consisted of four or five mice. Each experiment was repeated at least twice. Student's t test was used in the analysis of the results.
| |
Results |
|---|
|
|
|---|
Inhibition of Th2 Cells and Airway Eosinophilia by Antigen Challenge with CpG through Airway Mucosa
We examined the transmucosal effects of CpG on airway eosinophilia. Airway eosinophilia was induced in OVA/ alum-primed BALB/c mice by challenging with two doses of OVA via an intratracheal route (Figure 1, protocol 1). A total of 10 µg of OVA as an optimal challenge dose was used on the basis of our previous experiments (14). The airway eosinophilia was inhibited by concurrent administration of CpG at the time of intratracheal antigen challenge (Figure 2A). This inhibition was specific for CpG inasmuch as the control ODN, which did not contain a CpG motif, failed to inhibit airway eosinophilia (Figure 2A). Histologic analysis of the trachea also showed that CpG treatment attenuated the eosinophilic inflammation in the trachea (Figure 3).
|
The extent of airway eosinophilia was in parallel with
the Th2 cytokine levels in the BALF. In comparison with
the control mice, which exhibited strong airway eosinophilia, those challenged with OVA plus CpG showed reduced levels of IL-4 (Figure 2B) or IL-5 (Figure 2C). In
contrast, the level of Th1 cytokine IFN-
was enhanced by
OVA plus CpG treatment (Figure 2D). The TNF-
level
in BALF was similarly increased (Figure 2E). The cytokine levels in BALF from the mice challenged with OVA
plus control ODN were comparable to those of the control
group (Figures 2B-2E).
The production of cytokines by regional LN cells was affected in a similar manner. Mediastinal LN cells from control OVA/alum-primed mice produced significant levels of
IL-4 (Figure 2F) or IL-5 (Figure 2G) in response to in vitro
antigen stimulation. The challenge with OVA concurrently
with CpG inhibited IL-4 (Figure 2F) and IL-5 (Figure 2G)
production from antigen-stimulated LN CD4+ T cells. No
IFN-
production from the LN cells was detected (data not
shown). Thus, intratracheal administration of CpG together with antigen challenge downregulated Th2 cells in
parallel with the inhibition of airway eosinophilia.
Inhibition of Airway Eosinophilia by Pretreatment with CpG plus Antigen in Sensitized Animals
We next examined whether pretreatment with OVA plus CpG in advance of antigen challenge could protect the OVA-sensitized mice from the elicitation of airway eosinophilia. As in the experiments in Figure 2, the BALB/c mice were sensitized with OVA/alum and instilled intratracheally with OVA alone or together with CpG. They were then challenged with OVA (Figure 1, protocol 2). In comparison with the corresponding control mice that were pretreated intratracheally with OVA, those that were pretreated with OVA plus CpG showed reduced levels of airway eosinophilia (Figure 4A). Mice pretreated with OVA plus control ODN showed levels of eosinophilia comparable to those of the control group.
|
In a separate experiment, we compared the preinoculation of CpG plus antigen with that of PBS (Figure 4B). In contrast to the PBS-pretreated control group, OVA treatment deteriorated the airway eosinophilia. This could reflect the booster effects by 10 µg of instilled OVA, the dose that was optimal for inducing airway eosinophilia (14). In spite of this upregulation, the same dose of antigen inhibited eosinophilia when instilled together with CpG. Thus, instillation of CpG alone had no inhibitory effects and instillation of antigen alone had deteriorating effects, whereas the combination of the two inhibited eosinophilia when given in advance of antigen challenge.
CpG Improved Airway Eosinophilia and Hyperresponsiveness upon Pretreatment with a Minimal Amount of OVA That Failed to Boost Eosinophils
From a therapeutic standpoint, it would be better to minimize the antigen dose introduced into the airway in order to avoid a possible deleterious boost. We examined the effects of CpG with lower doses of OVA (Figure 5A). Preinstillation of as little as 0.1 µg of OVA had no ability to boost eosinophilia. Pretreatment with CpG alone failed to inhibit eosinophilia. In contrast, simultaneous instillation of OVA and CpG reduced eosinophilia in response to subsequent OVA challenge. Control ODN plus OVA had no effect on eosinophilia. Thus, pretreatment of antigen-sensitized animals with minimal amounts of antigen and CpG had prophylactic effects against subsequent antigen-induced eosinophilia. The inhibition of eosinophilia was in parallel with the inhibition of Th2 cells of mediastinal LN (Figures 5B and 5C). Airway hyperresponsiveness was also improved by CpG plus OVA pretreatment; the concurrent pretreatment with OVA plus CpG reduced the methacholine reactivity of the airway in comparison with the control PBS treatment (Figure 5D).
|
Lack of Effects on Systemic Anti-OVA IgE Responses
We examined the effect of pretreatment with CpG on anti-OVA IgE responses. In spite of the reduced levels of tracheal eosinophilia in mice pretreated with CpG plus OVA (Figure 4B), anti-OVA IgE responses in sera were not inhibited (Figure 4C). Thus, CpG plus antigen inhibited eosinophilia in presensitized mice even under the condition in which systemic immune responses to the antigen were not yet affected.
| |
Discussion |
|---|
|
|
|---|
Downregulation of unfavorable immune responses against inhaled antigens is one of the possible approaches in immunotherapy for bronchial asthma. Two major components that play pivotal roles in the pathogenesis of bronchial asthma are elevated IgE and eosinophilic inflammation in the airways, both of which are orchestrated by cytokines elaborated by Th2 cells (3). Selective abrogation of Th2 cell-mediated responses specific for allergen with sparing of other immune functions is the most desirable immunotherapy for avoiding adverse effects such as a deterioration of the host defense ability, which is inevitable as long as antigen-nonspecific immunosuppressants are used. In an attempt to meet these requirements, in this study we adopted a novel approach to control Th2 cells and airway eosinophilia. We found that concomitant administration of CpG and antigen (as opposed to either one alone) through airway mucosa efficiently inhibited airway eosinophilia in parallel with the downregulation of Th2 cells in the regional lymph nodes.
CpG activates macrophages and dendritic cells to produce IL-12, which in turn induces Th1 cell development
(15). Because IL-12 secretion is induced independent
of the attendant antigen, immune responses against diversified antigens are likely to be biased toward a Th1-dominant phenotype. In fact, injection of CpG alone without
the accompanying antigen inhibited antigen-induced airway eosinophilia (25). Activation of Th1 cells in an antigen-nonspecific manner may lead to the potential danger
of envisaging autoreactive Th1 cells, which would otherwise remain unactivated. Autoreactive Th1 cells are considered to be prime pathogenic cells that deteriorate experimental autoimmune diseases (27). The toxicity of CpG
is another problem. Bacterial DNA was reported to increase the toxicity of LPS (31). Systemic administration of
CpG is also reported to increase mortality, owing in part
to an increase in the serum TNF-
level (32). Transmucosal administration of CpG solved these problems. Inhibition of airway eosinophilia was achieved with smaller
doses (5 µg) of CpG than those in other reports, where 30 to 100 µg of CpG were injected (25, 26). CpG alone had
no effects on eosinophilia (Figures 4 and 5), mirroring the absence of nonspecific Th1 skewing, which was in sharp
contrast to the use of higher doses of CpG (25). Surprisingly, such a minute amount of CpG exerted efficient antiallergic effects upon transmucosal coinoculation with antigen (Figures 4 and 5).
Then, were there any harmful effects of antigen inoculation into the trachea? Intratracheal instillation of OVA actually led to an enhancement of eosinophilic inflammation (Figure 4). This hazardous effect might reflect a boost of Th2 cells by 10 µg of OVA, which was an optimal dose for eosinophilic inflammation (14). The boost effect was circumvented by coadministration with CpG (Figure 4). More ideally, even a lower dose of antigen unveiled the anti-Th2 activity of CpG; as little as 0.1 µg of OVA inhibited eosinophilia upon combined intratracheal instillation with CpG, whereas the inoculation of this dose of antigen failed to elicit the boost (Figure 5). Thus, minute amounts of CpG and antigen were safe and efficient regulators of airway eosinophilia when used in combination but not separately. The synergism of CpG and antigen was critical for the transmucosal treatment.
We previously observed a similar synergism in the regulation of airway eosinophilia (12). We reported that both the antigen and M. tuberculosis bacilli, but not either one alone, were essential for the efficient induction of antigen-specific Th1 cells, and suggested that the copresentation of the antigen and M. tuberculosis bacilli would occur at the level of APC secretion of IL-12 (12). In the present report we could not clarify the precise mechanisms for the synergism. Inasmuch as CpG induced IL-12 secretion from dendritic cells (20, 21), targeting of Th2 cells to APCs that phagocytose both CpG and antigen and secrete IL-12 might be a critical step for the synergism.
The effects of transmucosally administered CpG were reported previously. Freimark and coworkers reported that CpG sequences present within the plasmid induced the Th1 cell-promoting cytokines after intratracheal administration of the plasmid/lipid complexes (38). CpG was found to be an enhancer of antibody responses against influenza virus or hepatitis B surface antigen that were administered intranasally with CpG (39, 40). In these two reports, the effects of CpG on T-cell functions were not examined. More recently, Broide and collaborators reported that intratracheal instillation of CpG (50 to 100 µg) without the accompanying antigen inhibited airway eosinophilia and hyperresponsiveness (25). Sur and coworkers reported that intratracheal administration of CpG induced long-term prevention of allergic lung inflammation (41). They also found that no suppression of lung inflammation was observed when CpG were coadministered with the allergen (41). These reports are in sharp contrast to our observations. We found that pretreatment with 5 µg (Figure 2) or even 50 µg (data not shown) of CpG alone did not inhibit eosinophilia. We showed that the administration of a smaller dose (5 µg) of CpG with antigen induces the antigen-specific Th2 inhibition in the mediastinal LN, which improves airway eosinophilia and hyperresponsiveness. We could not reconcile these discrepancies. However, additional evidence that supports our notion comes from our recent experiment using a direct conjugate of CpG to OVA. When the covalently linked CpG-OVA conjugate was instilled into the trachea, the conjugate inhibited airway eosinophilia and cytokine production at smaller doses than did a simple mixture of OVA plus CpG (submitted manuscript). These observations reinforce our view that efficient targeting of CpG effects to antigen-specific T cells would be facilitated when the CpG-phagocytosed APC presented the antigen after coadministration of CpG and the antigen.
In summary, we have described a novel approach to inoculate CpG to inhibit Th2 cells and airway eosinophilia. The important findings are as follows. Administration of CpG through the airway mucosa inhibited local Th2 responses, and the dose of CpG and adverse effects could be minimized. Concomitant transmucosal administration of CpG and antigen, but not either alone, was essential for the inhibition of airway eosinophilia. The amount of antigen could be reduced to avoid the induction of eosinophilia. These findings provide the experimental basis for a possible inhalation therapy of allergen plus CpG to patients with bronchial asthma.
| |
Footnotes |
|---|
Address correspondence to: Kunio Sano, 1st Dept. of Internal Medicine, Tohoku University School of Medicine, Seiryo-machi, Aoba-ku, Sendai 980-8574, Japan. E-mail: sano{at}int1.med.tohoku.ac.jp
(Received in original form April 20, 1999 and in revised form August 4, 1999).
Abbreviations: aluminum hydroxide, alum; antigen-presenting cell, APC; bronchoalveolar lavage fluid, BALF; oligodeoxynucleotides containing CpG motifs, CpG; enzyme-linked immunosorbent assay, ELISA; interferon, IFN; immunoglobulin, Ig; interleukin, IL; lymph node, LN; methacholine chloride, MCh; oligodeoxynucleotide, ODN; ovalbumin, OVA; phosphate-buffered saline, PBS; pulmonary resistance, RL; T-helper, Th; tumor necrosis factor, TNF.Acknowledgments: The authors gratefully acknowledge Mr. Brent K. Bell for critical reading of this manuscript. This work was supported by a Grant-in-Aid for Scientific Research from The Ministry of Education, Science, Sports and Culture, Japan.
| |
References |
|---|
|
|
|---|
1. Holt, P. G., and C. McMenamin. 1989. Defence against allergic sensitization in the healthy lung: the role of inhalation tolerance. Clin. Exp. Allergy 19: 255-262 [Medline].
2. Wheatley, L. M., and T. A. E. Platts-Mills. 1997. The role of allergens. In Asthma. P. J. Barnes, M. M. Grunstein, A. R. Leff, and A. J. Woolcock, editors. Lippincott-Raven Publishers, Philadelphia, PA. 1079-1087.
3. Hamid, Q., M. Azzawi, S. Ying, R. Moqbel, A. J. Wardlaw, C. J. Corrigan, B. Bradley, S. R. Durham, J. V. Collins, P. K. Jeffery, D. J. Quint, and A. B. Key. 1991. Expression of mRNA for IL-5 in mucosal bronchial biopsies from asthma. J. Clin. Invest. 87: 1541-1546 .
4. Walker, C., J. C. Virchow Jr., P. L. Bruijnzeel, and K. Blaser. 1991. T cell subsets and their soluble products regulate eosinophilia in allergic and nonallergic asthma. J. Immunol. 146: 1829-1835 [Abstract].
5. Bradley, B. L., M. Azzawi, M. Jacobson, B. Assoufi, J. V. Collins, A. M. Irani, L. B. Schwartz, S. R. Durham, P. K. Jeffery, and A. B. Kay. 1991. Eosinophils, T-lymphocytes, mast cells, neutrophils, and macrophages in bronchial biopsy specimens from atopic subjects with asthma: comparison with biopsy specimens from atopic subjects without asthma and normal control subjects and relationship to bronchial hyperresponsiveness. J. Allergy Clin. Immunol. 88: 661-674 [Medline].
6. Robinson, D. S., Q. Hamid, S. Ying, A. Tsicopoulos, J. Barkans, A. M. Bentley, C. Corrigan, S. R. Durham, and A. B. Kay. 1992. Predominant Th2-like bronchoalveolar T-lymphocyte population in atopic asthma. N. Engl. J. Med. 326: 298-304 [Abstract].
7. Walker, C., E. Bode, L. Boer, T. T. Hansel, K. Blaser, and J. C. Virchow Jr.. 1992. Allergic and nonallergic asthmatics have distinct patterns of T-cell activation and cytokine production in peripheral blood and bronchoalveolar lavage. Am. Rev. Respir. Dis. 145: 109-115 .
8. Robinson, D. S., S. Ying, A. M. Bentley, Q. Meng, J. North, S. R. Durham, A. B. Kay, and Q. Hamid. 1993. Relationships among numbers of bronchoalveolar lavage cells expressing messenger ribonucleic acid for cytokines, asthma symptoms, and airway methacholine responsiveness in atopic asthma. J. Allergy Clin. Immunol. 92: 397-403 [Medline].
9. Robinson, D., Q. Hamid, A. Bentley, S. Ying, A. B. Kay, and S. R. Durham. 1993. Activation of CD4+ T cells, increased Th2-type cytokine mRNA expression, and eosinophil recruitment in bronchoalveolar lavage after allergen inhalation challenge in patients with atopic asthma. J. Allergy Clin. Immunol. 92: 313-324 [Medline].
10. Mosmann, T. R., J. H. Schumacher, N. F. Street, R. Budd, A. O'Garra, T. A. T. Fong, M. W. Bond, K. W. M. Moore, A. Sher, and D. F. Fiorentino. 1991. Diversity of cytokine synthesis and function of mouse CD4+ T cells. Immunol. Rev. 123: 209-229 [Medline].
11.
Erb, K. J.,
J. W. Holloway,
A. Sobeck,
H. Moll, and
G. LeGros.
1998.
Infection of mice with Mycobacterium bovis-bacillus Calmette-Guérin (BCG)
suppresses allergen-induced airway eosinophilia.
J. Exp. Med.
187:
561-569
12.
Sano, K.,
K. Haneda,
G. Tamura, and
K. Shirato.
1999.
Ovalbumin (OVA)
and Mycobacterium tuberculosis bacilli cooperatively polarize anti-OVA
T-helper (Th) cells toward a Th1-dominant phenotype and ameliorate murine tracheal eosinophilia.
Am. J. Respir. Mol. Cell Biol.
20:
1260-1267
13.
Haneda, K.,
K. Sano,
G. Tamura,
T. Sato,
S. Habu, and
K. Shirato.
1997.
TGF-
induced by oral tolerance ameliorates experimental tracheal eosinophilia.
J. Immunol.
159:
4484-4490
[Abstract].
14.
Haneda, K.,
K. Sano,
G. Tamura,
H. Shirota,
Y. Ohkawara,
T. Sato,
S. Habu, and
K. Shirato.
1999.
Transforming growth factor-
secreted from CD4+ T
cells ameliorates antigen-induced eosinophilic inflammation: novel high-dose tolerance in the trachea.
Am. J. Respir. Cell Mol. Biol.
21:
268-274
15.
Klinman, D. M.,
A. K. Yi,
S. L. Beaucage,
J. Conover, and
A. M. Krieg.
1996.
CpG motifs present in bacteria DNA rapidly induce lymphocytes to
secrete IL-6, IL-12, and IFN-
.
Proc. Natl. Acad. Sci. USA
93:
2879-2883
16. Sato, Y., M. Roman, H. Tighe, D. Lee, M. Corr, M. D. Nguyen, G. J. Silverman, M. Lotz, D. A. Carson, and E. Raz. 1996. Immunostimulatory DNA sequences necessary for effective intradermal gene immunization. Science 273: 352-354 [Abstract].
17.
Chu, R. S.,
O. S. Targoni,
A. M. Krieg,
P. V. Lehmann, and
C. V. Harding.
1997.
CpG oligodeoxynucleotides act as adjuvants that switch on T helper
1 (Th1) immunity.
J. Exp. Med.
186:
1623-1631
18.
Chace, J. H.,
N. A. Hooker,
K. L. Mildenstein,
A. M. Krieg, and
J. S. Cowdery.
1997.
Bacterial DNA-induced NK cell IFN-
production is dependent on macrophage secretion of IL-12.
Clin. Immunol. Immunopathol.
84:
185-193
[Medline].
19. Lipford, G. B., M. Bauer, C. Blank, R. Reiter, H. Wagner, and K. Heeg. 1997. CpG-containing synthetic oligonucleotides promote B and cytotoxic T cell responses to protein antigen: a new class of vaccine adjuvants. Eur. J. Immunol. 27: 2340-2344 [Medline].
20.
Jakob, T.,
P. S. Walker,
A. M. Krieg,
M. C. Udey, and
J. C. Vogel.
1998.
Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: a role for dendritic cells in the augmentation of Th1 responses by
immunostimulatory DNA.
J. Immunol.
161:
3042-3049
21. Sparwasser, T., E. S. Koch, R. M. Vabulas, K. Heeg, G. B. Lipford, J. W. Ellwart, and H. Wagner. 1998. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur. J. Immunol. 28: 2045-2054 [Medline].
22.
Weiner, G. J.,
H. M. Liu,
J. E. Wooldridge,
C. E. Dahle, and
A. M. Krieg.
1997.
Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization.
Proc.
Natl. Acad. Sci. USA
94:
10833-10837
23.
Zimmermann, S.,
O. Egeter,
S. Hausmann,
G. B. Lipford,
M. Rocken,
H. Wagner, and
K. Heeg.
1998.
CpG oligodeoxynucleotides trigger protective
and curative Th1 responses in lethal murine leishmaniasis.
J. Immunol.
160:
3627-3630
24.
Sun, S.,
H. Kishimoto, and
J. Sprent.
1998.
DNA as an adjuvant: capacity of
insect DNA and synthetic oligodeoxynucleotides to augment T cell responses to specific antigen.
J. Exp. Med.
187:
1145-1150
25.
Broide, D.,
J. Schwarze,
H. Tighe,
T. Gifford,
M. Nguyen,
S. Malek,
J. V. Uden,
E. Martin-Orozco,
E. W. Gelfand, and
E. Raz.
1998.
Immunostimulatory DNA sequences inhibit IL-5, eosinophilic inflammation, and airway
hyperresponsiveness in mice.
J. Immunol.
161:
7054-7062
26.
Kline, J. N.,
T. J. Waldschmidt,
T. R. Businga,
J. E. Lemish,
J. V. Weinstock,
P. S. Thorne, and
A. M. Krieg.
1998.
Modulation of airway inflammation by CpG oligodeoxynucleotides in a murine model of asthma.
J. Immunol.
160:
2555-2559
27. Liblau, R. S., S. M. Singer, and H. O. McDevitt. 1995. Th1 and Th2 CD4+ T cells in the pathogenesis of organ-specific autoimmune diseases. Immunol. Today 16: 34-38 [Medline].
28.
Gilkeson, G. S.,
P. Ruiz,
A. M. M. Pippen,
A. L. Alexander,
J. B. Lefkowith, and
D. S. Pisetsky.
1996.
Modulation of renal disease in autoimmune NZB/
NZW mice by immunization with bacterial DNA.
J. Exp. Med.
183:
1389-1397
29. Mor, G., M. Singla, A. D. Steinberg, S. L. Hoffman, K. Okuda, and D. M. Klinman. 1997. Do DNA vaccines induce autoimmune disease? Hum. Gene Ther. 8: 293-300 [Medline].
30. Krieg, A. M.. 1995. CpG DNA: a pathogenic factor in systemic lupus erythematosus? J. Clin. Immunol. 15: 284-292 [Medline].
31.
Cowdery, J. S.,
J. H. Chace,
A. Yi, and
A. M. Krieg.
1996.
Bacterial DNA
induces NK cells to produce IFN-
in vivo and increases the toxicity of lipopolysaccharides.
J. Immunol.
156:
4570-4575
[Abstract].
32. Sarmiento, U. M., J. R. Perez, J. M. Becker, and R. Narayanan. 1994. In vivo toxicological effects of Rel A antisense phosphorothioates in CD-1 mice. Antisense Res. Dev. 4: 99-107 [Medline].
33. Sparwasser, T., T. Miethke, G. Lipford, K. Borschert, H. Häcker, K. Heeg, and H. Wagner. 1997. Bacterial DNA causes septic shock. Nature 386: 336-337 [Medline].
34.
Sparwasser, T.,
T. Miethke,
G. Lipford,
A. Erdmann,
H. Häcker,
K. Heeg, and
H. Wagner.
1997.
Macrophages sense pathogens via DNA motifs: induction of TNF-
-mediated shock.
Eur. J. Immunol.
27:
1671-1679
[Medline].
35.
Sano, K.,
I. Fujisawa,
R. Abe,
Y. Asano, and
T. Tada.
1987.
MHC-restricted
minimal regulatory circuit initiated by a class II-autoreactive T cell clone.
J. Exp. Med.
165:
1284-1295
36.
Kumagai, K.,
I. Ohno,
S. Okada,
Y. Ohkawara,
K Suzuki,
T. Shinya,
H. Nagase,
K. Iwata, and
K. Shirato.
1999.
Inhibition of matrix metalloproteinases prevents allergen-induced airway inflammation in a murine model of
asthma.
J. Immunol.
162:
4212-4219
37. Mead, J., and J. L. Whittenberger. 1953. Physical properties of human lungs measured during spontaneous respiration. J. Appl. Physiol. 5: 779-796 .
38.
Freimark, B. D.,
H. P. Blezinger,
V. J. Florack,
J. L. Nordstrom,
S. D. Long,
D. S. Deshpande,
S. Nochumson, and
K. L. Petrak.
1998.
Cationic lipids
enhance cytokine and cell influx levels in the lung following administration
of plasmid: cationic lipid complexes.
J. Immunol.
160:
4580-4586
39. Moldoveanu, Z., L. Love-Homan, W. Q. Huang, and A. M. Krieg. 1998. CpG DNA, a novel immune enhancer for systemic and mucosal immunization with influenza virus. Vaccine 16: 1216-1224 [Medline].
40.
McCluskie, M. J., and
H. L. Davis.
1998.
CpG DNA is a potent enhancer of
systemic and mucosal immune responses against hepatitis B surface antigen with intranasal administration to mice.
J. Immunol.
161:
4463-4466
41.
Sur, S.,
J. S. Wild,
B. K. Choudhury,
N. Sur,
R. Alam, and
D. M. Klinman.
1999.
Long term prevention of allergic lung inflammation in a mouse model
of asthma by CpG oligodeoxynucleotides.
J. Immunol.
162:
6284-6293
This article has been cited by other articles:
![]() |
J. N. Kline Eat Dirt: CpG DNA and Immunomodulation of Asthma Proceedings of the ATS, July 1, 2007; 4(3): 283 - 288. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Tayyari, T. C. Sutton, H. E. Manson, and R. G. Hegele CpG-oligodeoxynucleotides inhibit RSV-enhanced allergic sensitisation in guinea pigs Eur. Respir. J., February 1, 2005; 25(2): 295 - 302. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. V. Jain, T. R. Businga, K. Kitagaki, C. L. George, P. T. O'Shaughnessy, and J. N. Kline Mucosal immunotherapy with CpG oligodeoxynucleotides reverses a murine model of chronic asthma induced by repeated antigen exposure Am J Physiol Lung Cell Mol Physiol, November 1, 2003; 285(5): L1137 - L1146. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. Boushey New and Exploratory Therapies for Asthma Chest, March 1, 2003; 123(2007): 439S - 445S. [Full Text] [PDF] |
||||
![]() |
K. Kitagaki, V. V. Jain, T. R. Businga, I. Hussain, and J. N. Kline Immunomodulatory Effects of CpG Oligodeoxynucleotides on Established Th2 Responses Clin. Vaccine Immunol., November 1, 2002; 9(6): 1260 - 1269. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Hylkema, W. Timens, M. Luinge, N. van der Werf, and M. O. Hoekstra The Effect of Bacillus Calmette-Guerin Immunization Depends on the Genetic Predisposition to Th2-Type Responsiveness Am. J. Respir. Cell Mol. Biol., August 1, 2002; 27(2): 244 - 249. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shirota, K. Sano, N. Hirasawa, T. Terui, K. Ohuchi, T. Hattori, and G. Tamura B Cells Capturing Antigen Conjugated with CpG Oligodeoxynucleotides Induce Th1 Cells by Elaborating IL-12 J. Immunol., July 15, 2002; 169(2): 787 - 794. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Sabroe, C.M. Lloyd, M.K.B. Whyte, S.K. Dower, T.J. Williams, and J.E. Pease Chemokines, innate and adaptive immunity, and respiratory disease Eur. Respir. J., February 1, 2002; 19(2): 350 - 355. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shirota, K. Sano, N. Hirasawa, T. Terui, K. Ohuchi, T. Hattori, K. Shirato, and G. Tamura Novel Roles of CpG Oligodeoxynucleotides as a Leader for the Sampling and Presentation of CpG-Tagged Antigen by Dendritic Cells J. Immunol., July 1, 2001; 167(1): 66 - 74. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Serebrisky, A. A. Teper, C.-K. Huang, S.-Y. Lee, T.-F. Zhang, B. H. Schofield, M. Kattan, H. A. Sampson, and X.-M. Li CpG Oligodeoxynucleotides Can Reverse Th2-Associated Allergic Airway Responses and Alter the B7.1/B7.2 Expression in a Murine Model of Asthma J. Immunol., November 15, 2000; 165(10): 5906 - 5912. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shirota, K. Sano, T. Kikuchi, G. Tamura, and K. Shirato Regulation of Murine Airway Eosinophilia and Th2 Cells by Antigen-Conjugated CpG Oligodeoxynucleotides as a Novel Antigen-Specific Immunomodulator J. Immunol., June 1, 2000; 164(11): 5575 - 5582. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Crit. Care Med. |