Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

Endothelin (ET)-1, which is secreted from airway epithelial cells such as bronchial, tracheal, and alveolar cells (1), produces a variety of biologic effects in airway systems, including airway smooth muscle contraction, chemical mediator release, and mucus secretion, and mitogenic effects on airway smooth muscles (4). Specific binding sites for ETs and their receptor messenger RNAs (mRNAs) can be identified in the lung and in airway cells such as bronchial epithelial and smooth muscle cells (2, 5, 7, 8). In addition, ET-1 gene expression and release were reported to be increased in bronchial epithelial cells and bronchoalveolar fluid of asthmatics patients (9, 10). Thus, it is very likely that ET-1 plays an important role in the pathophysiologic process associated with bronchial asthma.

In airway smooth muscle cells, contractile agonists such as ET-1 have been shown to increase intracellular Ca²⁺ ([Ca²⁺]_i) (11, 12). The initial agonist-induced Ca²⁺ mobilization occurs via formation of inositol 1,4,5-triphosphate, which induces Ca²⁺ release from the sarcoplasmic reticulum (12). The subsequent agonist-induced Ca²⁺ entry appears to occur through voltage-dependent Ca⁺ channels and/or receptor-mediated Ca²⁺ channels (15, 16). In vascular smooth muscle cells, ET-1 has been reported to increase the activity of voltage-dependent L-type Ca²⁺ channels (17), indicating that the Ca²⁺ influx through voltage-dependent L-type Ca²⁺ channels is an important pathway for Ca²⁺ entry. However, despite the importance of ET-1 in the regulation of airway smooth muscle tone (4, 5, 18), the mechanisms by which ET-1 induces Ca²⁺ influx remain incompletely understood in airway smooth muscles and have not been investigated in human airway smooth muscle cells. In guinea pig tracheal myocytes, the other contractile agonists (acetylcholine, histamine, substance P, and neurokinin A) have been shown to induce Ca²⁺ release from Ca²⁺ storage sites, resulting in the activation of Ca²⁺-dependent K⁺ and Cl currents (19). In cultured tracheal epithelial cells, ET-1 stimulates chloride secretion (22). On the other hand, the effects of ET-1 on electrical activities and ionic currents have not been examined in human bronchial smooth muscle cells (HBSMC).

Therefore, to clarify the effects of ET-1 on HBSMC, the effects of ET-1 on [Ca²⁺]_i and electrophysiologic activities were investigated and compared with those of histamine, using Ca²⁺ measurements and the patch clamp techniques. Here, we report that ET-1 is a potent activator of nonselective cation channels in human airway smooth muscle cells and that the activation of nonselective cation channels might play an important role in ET-1-induced Ca²⁺ entry both directly and via openings of voltage-dependent Ca²⁺ channels in human airway smooth muscle.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

Cell Preparation

Primary culture cells of normal human bronchial smooth muscles were purchased from the Clonetics Corporation (San Diego, CA). The cells were cultured in 25-cm² flasks, in medium for HBSMCs supplemented with 5% fetal calf serum, human epidermal growth factor (0.5 µg/ml), insulin (5 mg/ml), human fibroblast growth factor (1 µg/ml), dexamethasone (0.39 µg/ml), gentamicin (50 µg/ ml), and amphotericin B (0.05 µg/ml) (SmGM-2 Buffer Kit; Clonetics) in an atmosphere of 5% CO₂ and 95% air at 35°C. When the cells became confluent, they were subcultured in the same medium. At confluence, cells obtained from the 25-cm² flasks were passaged using 0.25% trypsin in 0.02% ethylenediaminetetraacetic acid (EDTA). Medium was replaced twice weekly. Cells before confluence at passages 3 to 10 were detached from culture flasks with 0.25% trypsin in 0.02% EDTA and used for later experiments. The cells were identified as smooth muscle cells, by which the expression of -actin was confirmed by immunostaining with fluorescein-conjugated antibody as illustrated in Figure 1A. More than 95% of the cells subcultured to passages 3 to 10 contained -actin. All experiments were performed at 35 to 37°C. In experiments using pertussis toxin (PTX)-treated cells, the cells were incubated in PTX (5 µg/ml) for 24 h.

View larger version (70K): [in this window] [in a new window]   Figure 1.   Immunostaining with fluorescein-conjugated antibody to -actin and RT-PCR of ET-A and ET-B receptor mRNA in HBSMCs. (A) Immunostaining with fluorescein-conjugated antibody to -actin. Cells at passage 10 were immunostained with -actin. Note that the staining of -actin is found in the cytoskeleton, including the nucleus. (B) RT-PCR of ET receptor mRNA: marker (M); ET-A receptor mRNA, 299 bp; ET-B receptor mRNA, 428 bp.

Solutions and Drugs

The composition of the control extracellular Tyrode solution was as follows (in mM): NaCl 136.5, KCl 5.4, CaCl₂ 1.8, MgCl₂ 0.53, glucose 5.5, and N-2-hydroxyethylpiperazine-N'-ethane sulfonic acid (Hepes)-NaOH buffer 5.5 (pH 7.4). The Ca²⁺-free solution was the same as normal Tyrode solution with the exception that CaCl₂ was omitted and ethyleneglycol-bis-(-aminoethyl ether)- N,N'-tetraacetic acid (EGTA; 0.5 mM) was added. When the external ([Cl]_o) or internal concentration of Cl ([Cl]_i) was changed, NaCl in the Tyrode solution was replaced with equimolar sodium aspartate. The patch pipette contained (in mM): KCl 140, EGTA 0.01 or 10, MgCl₂ 2, Na₂ATP 3, guanosine-5'-triphosphate (GTP) (sodium salt, Sigma Chemical Co., St. Louis, MO) 0.1, and Hepes-KOH buffer 5 (pH 7.2). In experiments where K⁺ currents were blocked, the patch pipette contained Cs⁺ internal solution (in mM): CsCl 140, EGTA 0.01 or 10, MgCl₂ 2, Na₂ATP 3, GTP 0.1, and Hepes-CsOH 5 (pH 7.2). To chelate [Ca²⁺]_i, 10 mM EGTA was included in the patch pipette. In some experiments, heparin was added to the pipette solution. Histamine, 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid (DIDS), lantanum (La), ryanodine, caffeine, thapsigargin, nicardipine, PTX, and heparin were purchased from Sigma. ET-1 (human) and sarafotoxin S6c were obtained from Peptide Institute Inc. (Osaka, Japan). Nicardipine and nifedipine were dissolved into ethanol, and 10 mM stock solution was used. BQ-788, N-[N-[N-[(2,6-dimethyl-1-piperidinyl)carbonyl]-4-methyl-L-leucyl]-1-(methoxycarbonyl)-D-tryptophyl]-D-norleucine monosodium, was purchased from Calbiochem-Novabiochem Japan Ltd. (Tokyo, Japan). BQ-123, cyclo (D--aspartyl-L-prolyl-D-valyl-L-leucyl-D-tryptophyl), was a gift from Banyu Pharmaceutical Co. (Tsukuba, Japan).

Recording Technique and Data Analysis

Membrane potentials and currents were recorded with glass pipettes in the whole-cell clamp conditions (23, 24) using a patch-clamp amplifier (EPC-7; List Electronics, Darmstadt, Germany). Heat-polished patch pipettes, filled with the artificial internal solution (for composition, see previous section), had tip resistances of 3 to 6 M. Membrane potentials and currents were monitored with a high-gain storage osciloscope (COS 5020-ST; Kikusui Electronics, Tokyo, Japan). At the start of each experiment, the series resistance was compensated. The data were stored on videotapes using a pulse code modulation converter system (RP-880; NF electronic circuit design, Tokyo, Japan). On playback, the data were reproduced, low-pass filtered at 2 kHz (3 dB) with a Bessel filter (FV-665, NF, 48 dB/octave slope attenuation), sampled at 6 kHz, analyzed off-line on a computer using p-Clamp software (Axon Instruments, CA). Voltage ramp command pulses from 80 to +40 mV in 100 ms duration were used to generate quasi-steady-state current-voltage relationships. In experiments with ramp pulses, nicardipine (1 µM) was added to the bathing solution. The capacitance of single HBSMCs and the input resistance of the cell/pipette assembly (the sum of the input resistance and the seal resistance) were measured under voltage-clamp conditions, where small hyperpolarizing pulses were applied from the membrane potential held at the resting membrane potential. Data were expressed as the means ± standard deviation (SD). Student's t test was used for statistical analysis and P < 0.05 was considered to be significant.

Determination of [Ca²⁺] Concentration

[Ca²⁺]_i concentration was measured using the fura-2 fluorescence method as described previously (25). The Ca²⁺-free bathing solution was the same as the normal Tyrode's solution except that CaCl₂ was omitted and 0.5 mM EGTA was added to the solution (pH 7.4). Fura-2 acetoxymethylester (fura-2 AM) was obtained from Dojin Chemicals (Kumamoto, Japan). Cells were trypsinized, washed twice with the standard solution, adjusted to a cell density of 10⁶ cells/ml, and loaded with 1 µM fura-2 AM for 60 min in a 20°C shaking water bath. The Ca²⁺ fura-2 fluorescence of the suspended cells was measured by a spectrofluorometer (CAF-110; JASCO Co., Ltd., Tokyo, Japan). The excitation wavelengths were 340 and 380 nm, and emission was measured at 500 nm.

RNA Extraction and Reverse Transcriptase/Polymerase Chain Reaction

Total cellular RNA was extracted from cultured HBSMCs by a modified single-step acid-guanidine thiocyanate-phenol-chloroform method using ISOGEN (Nippon Gene, Tokyo, Japan). For reverse transcriptase/polymerase chain reaction (RT-PCR), complementary DNA (cDNA) was synthesized from 1 µg of total RNA with reverse transcriptase with random primers (Takara, Kyoto, Japan). The reaction mixture was then subjected to PCR amplification with specific forward and reverse oligonucleotide primers for 35 cycles consisting of heat denaturation (95°C for 2 min), annealing (ET-A receptor: 47°C for 30 s; ET-B receptor: 53°C for 30 s), and extension (72°C for 1.5 min). PCR products were size-fractionated on 2% agarose gels and visualized under ultraviolet light. PCR primers were selected from published ET-A and ET-B receptor cDNA sequences as previously described (26): ET-A receptor, 299 bp (forward, CCTTTTGATCACAATGACTTT; reverse, TTTGATGTGGCATTGAGCATACAG) and ET-B receptor, 428 bp (forward, ACTGGCCATTTGGAGCTGAGAT; reverse, CTGCATGCCACTTTTCTTTCTCAA). All 5'-primers covered splice junctions, thus excluding amplification of genomic DNA.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

Effects of ET-1 on [Ca²⁺]_i Concentration in HBSMCs

The effects of ET-1 on [Ca²⁺]_i in HBSMCs are shown in Figure 2. In the presence of extracellular Ca²⁺, ET-1 (100 nM) induced a biphasic increase of [Ca²⁺]_i (Figure 2A). ET-1 elicited an initial peak of [Ca²⁺]_i, which fell to a sustained plateau. When ET-1 was applied to the bath solution in the absence of extracellular Ca²⁺, only a transient increase of [Ca²⁺]_i was observed, and the sustained phase was abolished (Figure 2B). Addition of Ca²⁺ into the bath solution immediately increased [Ca²⁺]_i because of Ca²⁺ influx from the extracellular side. These results suggest that the transient increase of [Ca²⁺]_i elicited by ET-1 mainly resulted from Ca²⁺ release of [Ca²⁺]_i storage sites, and the persistent elevation of [Ca²⁺]_i could result from the influx of extracellular Ca²⁺. The application of histamine (100 µM; data not shown) also induced a similar [Ca²⁺]_i rise. Figure 2A also shows the effects of nicardipine and La³⁺ on an ET-1- induced sustained rise in [Ca²⁺]_i. After the [Ca²⁺]_i rises elicited by ET-1 reached a steady level, nicardipine (1 µM) and nifedipine (1 µM; data not shown) partly decreased the final sustained phase of [Ca²⁺]_i. Additionally, La³⁺ (0.5 mM) completely eliminated the sustained phase of [Ca²⁺]_i. Similar results were obtained in five different cells tested.

View larger version (12K): [in this window] [in a new window]   Figure 2.   Effects of ET-1 on [Ca2+]i concentration in HBSMCs. (A) Effects of nicardipine and La3+ on ET-1-induced Ca2+ mobilization in the presence of extracellular Ca2+. (B) Effects of extracellular Ca2+ on ET-1-induced Ca2+ mobilization. Note that the addition of extracellular Ca2+ into Ca2+-free bath solution elicited a [Ca2+]i rise due to Ca2+ entry. The drug protocols are illustrated in each trace.

The effects of selective ET receptor blockers on ET-1- induced [Ca²⁺]_i responses in HBSMCs are shown in Figure 3. The [Ca²⁺]_i responses to ET-1 (10 nM) were compared between control cells and cells pretreated with ET receptor blockers. Inclusion of BQ-123 (10 µM, Figure 3Ab), a pure ET-A receptor blocker, or BQ-788 (2 µM; Figure 3Ac), a pure ET-B receptor blocker, substantially attenuated the ET-1-induced [Ca²⁺]_i responses, as compared with control cells (Figure 3Aa), but each antagonist could not abolish the [Ca²⁺]_i rise induced by ET-1 (10 nM). On the other hand, simultaneous blockade of both receptors with BQ-123 and BQ-788 almost completely prevented [Ca²⁺]_i responses to ET-1 (10 nM; Figure 3Ad). Similar findings were obtained in four different experiments. In addition, sarafotoxin S6c (100 nM), a pure ET-B receptor agonist, also provoked an initial transient [Ca²⁺]_i increase followed by a sustained component (Figure 3Ba). The sarafotoxin S6c-induced [Ca²+]_i rise was markedly inhibited in the presence of BQ 788 (2 µM; Figure 3Bb), and additional application of ET-1 increased [Ca²⁺]_i, confirming that sarafotoxin S6c increased [Ca²⁺]_i via an ET-B receptor.

View larger version (24K): [in this window] [in a new window]   Figure 3.   Effects of ET receptor antagonists (BQ-123 and BQ-788) on ET-induced [Ca2+]i responses and sarafotoxin S6c on [Ca2+]i. (A) The [Ca2+]i responses to ET-1 (10 nM) were compared with between control cells (a) and cells pretreated with ET receptor blockers (b-d). BQ-123 (10 µM; b) or BQ-788 (2 µM; c) was applied before and after the application of ET-1 (10 nM). Note that simultaneous application of both agents almost completely prevented [Ca2+]i responses to ET-1 (10 nM; d). (B) Effects of sarafotoxin S6c (100 nM; a and b) on [Ca2+]i. (b), BQ-788 (2 µM) was applied before and after application of sarafotoxin and subsequently ET-1 (10 nM).

Expression of Both ET-A and ET-B Receptor mRNA in HBSMCs

We examined the expression of ET receptor (ET-A and ET-B) mRNA in HBSMCs. By RT-PCR, expression of both ET-A and ET-B receptors was observed (Figure 1B). The amplified 299-bp ET-A and 428-bp ET-B receptor PCR cDNA fragments were of predicted molecular size, identical to cDNA fragments amplified from reversely transcribed mRNA (27). Similar results were obtained from four different experiments.

Effects of ET-1 and Histamine on Membrane Potentials in HBSMCs

Isolated HBSMCs were round, and the cell capacitance was 48 ± 23 pF (n = 15). The input resistance measured under the voltage clamp condition was 1.7 ± 0.6 G (n = 13).

The effects of ET-1 and histamine on membrane potentials are shown in Figure 4. Under current clamp conditions with K⁺ internal solution, the membrane potential was 40 ± 5 mV (n = 10). The application of histamine (100 µM; Figures 4A-4C) or ET-1 (100 nM; Figures 4C-4D) rapidly depolarized the membrane, and then the membrane potential reached a steady-state level of approximately 20 mV during application of these agents. ET-1 (1, 10, and 100 nM) depolarized concentration-dependently the membrane potential from 43 ± 4 to 36 ± 5, 24 ± 6, and 15 ± 6 mV (n = 4), respectively. In some cases, the fade of ET-1- or histamine-induced depolarization was observed even in the presence of these agonists. Occasionally, the membrane potential oscillated during the application of histamine (Figure 4B) or ET-1. After washout of these agents, it gradually returned to a control level. A transient hyperpolarization was observed immediately after the application of ET-1 (Figure 4D) in six cases of 15 cells examined, and after that the membrane potential was markedly depolarized. Similar findings were observed in three of seven cells tested after the application of histamine.

View larger version (18K): [in this window] [in a new window]   Figure 4.   Effects of ET-1 and histamine on membrane potential in HBSMCs. Effects of histamine (100 µM; A, B, and C) and ET-1 (100 nM; C and D) on membrane potentials. (B) The membrane potential was oscillated during application of histamine. The drug sequences are illustrated in each trace. The zero potential level is indicated by dotted lines. The patch pipette contained 140 mM KCl internal solution and low EGTA (0.01 mM).

Ionic Basis of ET-1-  and Histamine-Induced Membrane Depolarization

To investigate the ionic basis of ET-1 and histamine effects on HBSMCs, the effects of these agents on membrane currents were investigated as shown in Figure 5. Under voltage clamp conditions with K⁺ internal solution and low EGTA in the patch pipette, both histamine (100 µM; Figure 5Aa) and ET-1 (100 nM; Figure 5Ab), but not caffeine (30 mM; Figure 5B), transiently increased the holding current in the outward direction at a holding potential of 0 mV. In contrast, at a holding potential of 40 mV, application of ET-1 (Figure 5Ca) and histamine (Figure 5Cb) first activated an outward current followed by a long-lasting inward current. These results suggest that the reversal potential of the long-lasting inward current was approximately 0 mV. When K⁺ in the patch pipette was totally replaced by Cs⁺, the outward current was completely abolished, consistent with a K⁺ current.

View larger version (23K): [in this window] [in a new window]   Figure 5.   Effects of ET-1 and histamine on membrane currents in HBSMCs. (A and B) Effects of histamine (100 µM; Aa), ET-1 (100 nM; Ab), and caffeine (30 mM; B) on membrane currents. The cells were held at 0 mV. The patch pipette contained 140 mM KCl and low EGTA. The drug protocols are illustrated in each trace in this and subsequent figures. Dotted lines denote zero current level. (C) Effects of ET-1 (100 nM; a) and histamine (100 µM; b) on membrane currents. The cell was held at 40 mV, and the patch pipette contained 140 mM KCl internal solution and low EGTA. (D) Effects of histamine on membrane currents under conditions with 140 mM CsCl internal solution and low EGTA in the patch pipette. (Db) The oscillatory inward current was observed during the application of histamine. Note that after the initial transient activation of the outward current (Ca and Cb) and the inward current (Da), an additional sustained inward current with a large noise level was observed in the presence of histamine and ET-1. (E) Effects of high EGTA in the patch pipette on histamine- and ET-1-induced current changes. The patch pipette contained 140 mM KCl internal solution and 10 mM EGTA, and the cell was held at 0 mV.

Under the conditions with Cs⁺ internal solution and low EGTA in the patch pipette, a transient inward current was elicited immediately after the application of histamine (100 µM; Figure 5Da) at a holding potential of 40 mV in five cases of 12 cells examined, then followed by a sustained inward current. Similarly, a transient inward current was activated by ET-1 (100 nM) in four cases of 10 cells. In rare cases, the oscillatory inward currents were observed during application of these agents (Figure 5Db). The amplitude of the transient inward current reached 450 ± 200 pA (n = 5) at a holding potential of 40 mV. The current density of the inward current was 9.3 ± 4.2 pA/pF (n = 5). This current was markedly inhibited by DIDS (1 mM), a Cl channel blocker (data not shown), suggesting that the inward current was carried by Cl as previously reported in guinea pig tracheal smooth muscle cells (19). When the concentration of EGTA in the patch pipette was increased from 0.01 to 10 mM, neither ET-1 nor histamine elicited the transient outward current (Figure 5E) at a holding potential of 0 mV or the transient inward current at a holding potential of 40 mV. In addition, heparin (1 mg/ml), an IP₃ receptor antagonist (28), in the patch pipette abolished the activation of the K⁺ and Cl currents induced by ET-1 and histamine (data not shown). However, the sustained inward current elicited by ET-1 and histamine was still observed even when concentrations of EGTA in the Cs⁺ internal solution were increased from 0.01 to 10 mM (Figure 6A and 7). Furthermore, heparin (1 mg/ml) in the patch pipette did not inhibit the activation of the long-lasting inward current (Figure 7B). The amplitude of the ET-1-induced sustained inward current was 85 ± 40 pA (n = 15), and the current density was 1.7 ± 0.8 pA/pF (n = 15). The current-voltage relationships of the sustained inward current were examined with the ramp voltage steps. With 140 mM Na⁺ in the bath solution, the current-voltage relationships of the ET-1-induced current reversed at 3 ± 3 mV (n = 9; Figure 6B). Similarly, the reversal potential of the histamine-induced current was 2 ± 3 mV (n = 4). The reversal potential of the ET-1-induced current was unaffected by decreasing [Cl]_o from 140 to 10 mM or by reducing [Cl]_i from 140 to 20 mM as shown in Table 1.

View larger version (21K): [in this window] [in a new window]   Figure 6.   Activation of a sustained inward current by ET-1 and the effects of thapsigargin on [Ca2+]i and membrane currents in HBSMCs. (A) The cell was held at 40 mV. The patch pipette contained 140 mM CsCl internal solution and 10 mM EGTA. Ramp voltage pulses from 80 to 40 mV (100 ms in duration) were applied before (a) and during application of ET-1 (100 nM; b). Dotted lines denote zero current level. The current-voltage relationships of the subtraction from b to a of the ramp voltage pulses are shown in B (right panel). Note that the reversal potential of the ET-1-induced sustained current was 3 mV in this cell. (C) Effects of thapsigargin (1 µM) on [Ca2+]i. (D) Effects of thapsigargin (1 µM) on membrane currents. The patch pipette contained 140 mM CsCl with EGTA (10 mM). The cell was held at 40 mV. Results are representative of four independent experiments.

View larger version (33K): [in this window] [in a new window]   Figure 7.   Activation of a nonselective cation current by ET-1 and histamine. The cells were held at 40 mV. The patch pipette contained 140 mM CsCl internal solution and high EGTA. (A) Activation of a nonselective cation current by histamine (100 µM). (B) Heparin (1 mg/ml) in the patch pipette had no effect on ET-1-induced nonselective cation current. (C) Effects of PTX on the activation of nonselective cation currents by ET-1. The cell was pretreated with PTX (5 µg/ml) for 24 h. (D-G) Effects of La3+ (1 mM), Cd2+ (1 mM), and nifedipine (10 µM) on histamine- and ET-1-induced nonselective cation currents. The zero current level is shown by dotted lines. Note that nifedipine has basically no effect on the inward current. Results are representative of four to five similar experiments.

The effects of PTX on the activation of nonselective cation current by ET-1 are illustrated in Figure 7C. In cells pretreated with PTX (5 µg/ml for 24 h), ET-1 still activated the nonselective cation current. The effects of La³⁺ and nifedipine on ET-1 and histamine-induced nonselective cation currents are shown in Figures 7C-7G. La³⁺ (1 mM; Figures 7C, 7D, 7F, and 7G) and Cd²⁺ (1 mM; Figure 7E) completely abolished both histamine and ET-1-induced nonselective cation currents. On the other hand, nifedipine (10 µM; Figures 7F and 7G) or nicardipine (10 µM; data not shown) failed to inhibit it.

Comparative Effects of ET-1 and Histamine on the Activation of Nonselective Cation Currents

The previous results indicate that both ET-1 and histamine activate nonselective cation currents in HBSMCs. The relationships between the concentrations of ET-1 or histamine and the amplitude of the activation of nonselective cation currents are shown in Figures 8A-8C and 9. Histamine (1 to 300 µM; Figure 8A) and ET-1 (1 to 100 nM; Figure 8B) activated nonselective cation currents in a concentration-dependent manner. The half-maximal effective concentration was 12 nM for ET-1 and 11 µM for histamine as shown in Figure 9. Furthermore, after ET-1 (100 nM) activated nonselective cation current maximally (Figure 8C), the additional application of histamine (100 µM) did not activate it any further. Similar results were obtained in four independent experiments.

View larger version (37K): [in this window] [in a new window]   Figure 8.   (A-C) Concentration-dependent activation of nonselective cation currents by ET-1 and histamine in HBSMCs. The cells were held at 40 mV, and the patch pipette contained 140 mM CsCl internal solution and high EGTA. The pharmacologic protocols are shown in each trace. Note that in C, after ET-1 (100 nM) activated nonselective cation currents, the additional application of histamine (100 µM) failed to activate it any further. (D-F) Effects of sarafotoxin S6c on membrane currents, and BQ-788 (Db) and BQ-123 (E) on the activation of nonselective cation currents by ET-1. Note that combined treatment with BQ-123 (10 µM) and BQ-788 (2 µM) almost completely prevented the activation of nonselective cation currents by ET-1 (10 nM; F).

View larger version (11K): [in this window] [in a new window]   Figure 9.   Concentration-response relationships of ET-1 and histamine on the activation of nonselective cation currents. The cells were held at 40 mV. The maximal activation of nonselective cation currents by histamine or ET-1 was considered as 1.0. The relative current amplitude activated by histamine or ET-1 was plotted against each concentration. Data are shown as mean ± SD (n = 5) in each agonist.

The effects of thapsigargin (1 µM), an inhibitor of sarcoplasmic reticulum Ca²⁺-ATPase on [Ca²⁺]_i are shown in Figure 6C. The application of thapsigargin induced a transient peak of [Ca²⁺]_i, followed by a sustained phase. However, under conditions with high EGTA (10 mM) and CsCl in the patch pipette, thapsigargin failed to activate any significant inward current (Figure 6D). Similar findings were obtained in four independent experiments.

Effects of Sarafotoxin, BQ-123, and BQ 788 on Nonselective Cation Current

The effects of sarafotoxin S6c, BQ 123, and BQ 788 on the nonselective cation currents are shown in Figures 8D-8F. Sarafotoxin S6c (100 nM; Figure 8Da), an ET-B receptor agonist, activated nonselective cation currents as did ET-1. However, in the presence of BQ 788 (2 µM; Figure 8Db) or BQ-123 (10 µM; Figure 8E), ET-1 (10 nM) could still activate nonselective cation currents. In contrast, the simultaneous block of both receptors almost completely prevented the activation of nonselective cation currents by ET-1 (10 nM; Figure 8F).

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

The major findings of the present study are: (1) ET-1 was a potent activator of nonselective cation currents via both ET-A and ET-B receptors in HBSMCs; (2) ET-1 induced a sustained depolarization by activating nonselective cation currents; and (3) nifedipine and nicardipine poorly inhibited an ET-1-induced sustained rise in [Ca²⁺]_i, but La³⁺ completely inhibited it. From these results, it is likely that the activation of nonselective cation currents may play an important role in ET-1-induced Ca²⁺ entry in HBSMCs.

Our data show that ET-1, a most potent contractile agent for airway smooth muscle (4, 5, 18), and histamine each produced a sustained depolarization of the membrane potential in HBSMCs. The ionic mechanisms of the ET-1- induced depolarization were first due to the transient activation of Ca²⁺-dependent Cl currents and subsequently by activation of nonselective cation currents. The previous studies using guinea pig tracheal smooth muscle cells (19- 21) showed that neurokinin A, substance P, histamine, and acetylcholine induced a transient Cl current because of the Ca²⁺ release from the Ca²⁺ storage sites. A similar mechanism seemed to be involved in the activation of a Cl current by ET-1 and histamine in HBSMCs. ET-1 and histamine increased [Ca²⁺]_i due to Ca²⁺ release from the storage sites through an IP₃ pathway, which transiently activated a Ca²⁺-dependent Cl current as shown in Figure 5. In these cultured cells, caffeine (30 mM) failed to increase [Ca²⁺]_i significantly and activate Ca²⁺-dependent K⁺ currents (Figure 5). Also, the pretreatment of ryanodine (10 µM; data not shown) did not affect [Ca²⁺]_i responses to ET-1. Thus, it is likely that ET-1 induced Ca²⁺ release mainly from IP₃-sensitive Ca²⁺ storage sites but not from ryanodine-sensitive [Ca²⁺]_i stores in cultured HBSMCs. Nonetheless, the sustained depolarization induced by ET-1 could not be explained by the activation of a Ca²⁺-dependent Cl current. The present study showed that ET-1 induced a sustained membrane depolarization, probably owing to the activation of nonselective cation currents. In canine gastric and tracheal smooth muscle cells, it has been reported that acetylcholine activated a nonselective cation channel, possibly mediated by the increase of [Ca²⁺]_i (19, 29) because caffeine or injection of Ca²⁺ induced a similar current. However, in the present study, the activation of Ca²⁺-dependent K⁺ and Cl currents was abolished by high EGTA in the patch pipette as shown in Figure 5E, whereas high EGTA in the patch pipette could not prevent the activation of nonselective cation currents. Furthermore, inclusion of heparin, an IP₃ receptor antagonist (28), in the pipette inhibited the activation of Ca²⁺-dependent K⁺ and Cl currents induced by ET-1 and histamine but failed to inhibit the activation of nonselective cation currents. These observations suggest that a dominant role of an increase in [Ca²⁺]_i is unlikely in the activation of a nonselective cation current induced by ET-1 and histamine in HBSMCs. Similar Ca²⁺-independent nonselective cation currents have been reported in cases of ET-1 and vasopressin in rat aortic smooth muscle cells (30), and in cases of noradrenaline and acetylcholine in vascular smooth muscle cells isolated from the rabbit (34, 35). The half-maximal effective concentration for ET-1 to activate nonselective cation currents was approximately 12 nM in HBSMCs, which was much lower than that of histamine, as shown in Figure 9. In addition, because histamine activated a Cl current but failed to activate nonselective cation currents in guinea pig tracheal myocytes (20), the species difference may exist in activating nonselective cation currents. Thus, it is very likely that ET-1 seemed to be a potent activator of nonselective cation channels in HBSMCs.

In guinea pig ileal smooth muscle cells (36), PTX-sensitive GTP binding proteins are involved in the activation of nonselective cation currents by acetylcholine. However, PTX-resistant GTP binding proteins may be involved in the activation of nonselective cation currents by ET-1 and histamine in HBSMCs.

As shown in Figure 2, ET-1 increased [Ca²⁺]_i due to both Ca²⁺ release from storage sites and subsequent Ca²⁺ influx. Because ET-1 has been reported to increase voltage-dependent L-type Ca²⁺ channel activity in smooth muscle cells (17), the ET-1-induced Ca²⁺ influx might be due to the activation of voltage-dependent L-type Ca²⁺ channels. In addition, because ET-1 induced a sustained depolarization in HBSMCs as shown in the present study, ET-1 may activate voltage-dependent L-type Ca²⁺ channels indirectly by depolarizing the membrane potential. Actually, nicardipine and nifedipine partly inhibited the sustained rise in [Ca²+]_i induced by ET-1 (Figure 2). A dependency of the ET-1-induced bronchoconstriction on the opening of dihydropyridine-sensitive Ca²⁺ channels has been suggested from previous studies using airway smooth muscles (4, 18, 37). However, in comparison to the effects of nicardipine and nifedipine, La³⁺ and Cd²⁺ completely abolished the sustained rise of [Ca²⁺]_i induced by ET-1. These observations suggest that ET-1 also induces Ca²⁺ influx via a nifedipine-insensitive, but La³⁺-sensitive, mechanism in HBSMCs. These findings were compatible with a previous study using Ca²⁺ measurements in cultured canine tracheal smooth muscle cells (11). The basic mechanisms of ET-1- induced Ca²⁺ entry remain to be clarified. One such pathway, which is activated via depletion of [Ca²⁺]_i stores, has been termed the capacitative Ca²⁺ entry pathways and identified in many cell types (38). In HBSMCs, depletion of [Ca²⁺]_i stores with thapsigargin evoked a sustained increase in [Ca²⁺]_i, reflecting activation of a capacitative Ca²⁺ entry (Figure 6C). Evidence for a membrane current activated by store depletion (I_CRAC) has been provided by Hoth and Penner (39), but using conventional whole-cell current measurements, we failed to detect measurable I_CRAC (Figure 6E). Therefore, the size of I_CRAC may be estimated as less than 1 to 5 pA/cell, a figure also reported for other cell types (41, 42), which is very different from that of nonselective cation currents. Taken into the value of I_CRAC (~ 1 pA) and the input resistance of the cultured cells (~ 1 G), we could estimate the resulting effect on the cell membrane potential (~ 1 mV), suggesting that the depolarizing effects of ET-1 were not due to the activation of I_CRAC but to that of nonselective cation currents. Alternatively, the activation of nonselective cation channels may also play an important role in the ET-1-induced Ca²⁺ entry as previously described in vascular smooth muscle cells (30). Thus, it is likely that nonselective cation channels and I_CRAC as well as voltage-dependent L-type Ca²⁺ channels may play an important role in regulation of airway contractility induced by ET-1. However, as previously reported in cases of ET-1 in vascular smooth muscle cells (43), nonselective cation channels rather than I_CRAC might also play a major role in receptor-operated Ca²⁺ entry induced by low concentrations of ET-1 in HBSMCs.

The present study also showed that ET-1 increased [Ca²⁺]_i and activated nonselective cation currents via both ET-A and ET-B receptors in HBSMCs. Sarafotoxin S6c, a pure ET-B receptor agonist, as well as ET-1 increased [Ca²⁺]_i and activated nonselective cation currents. In addition, combined treatment with BQ-123 and BQ-788 effectively prevented the ET effects, whereas BQ-123 alone or BQ-788 alone could not. These observations are compatible with previous studies that used tension measurement and that showed, both ET-A and ET-B receptors are involved in ET-1-induced contraction in human bronchi (44). By RT-PCR, the expression of both ET-A and ET-B receptor mRNA was identified in these cells, as shown in Figure 1B. Thus, the combined blockade of ET-A and ET-B receptors may be necessary to antagonize the effects of ET-1 on human bronchi.

ET-1, which is secreted from airway epithelial cells (1- 3), is a potent constrictor of the airways. In addition, ET-1 gene expression and release were reported to increase in bronchial epithelial cells and bronchoalveolar fluid of asthmatic patients (9, 10). Thus, ET-1 may play an important role in pathophysiologic conditions such as bronchial asthma. The present study indicates that ET-1 is a potent activator of nonselective cation currents via both ET-A and ET-B receptors, and the activation of the channels may play an important role in ET-1-induced Ca²⁺ entry both directly and via depolarization by opening voltage-dependent L-type Ca²⁺ channels in HBSMCs. Therefore, it is very likely that ET-1-induced Ca²⁺ entry and then membrane depolarization by activating nonselective cation channels may contribute to the ET-1-induced contraction in human airways under various pathophysiologic conditions such as bronchial asthma.