Analysis of the Effects of Cystic Fibrosis Transmembrane Conductance Regulator Dysfunction and Bacterial Virulence Factors |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
Abstract |
|---|
|
|
|---|
Airway epithelial cells can respond to infection by activating
several signaling pathways. We examined the induction of apoptosis in response to Pseudomonas aeruginosa PAO1 in normal
cells and several cystic fibrosis (CF) and corrected cell lines. Epithelial cells in monolayers with tight junctions, confirmed by
apical ZO-1 staining demonstrated by confocal microscopy,
were entirely resistant to PAO1-induced apoptosis. In contrast,
cell lines such as 9HTEo
cells that do not form tight junctions
were susceptible, with 50% of the population apoptotic after
6 h of exposure to PAO1. CF transmembrane conductance regulator (CFTR) dysfunction caused by different mechanisms (trafficking mutations, overexpression of the regulatory domain or
antisense constructs) did not alter rates of apoptosis, nor were
differences apparent in terminal deoxyribonucleotidyl transferase-mediated deoxyuridine triphosphate-biotin nick-end
labeling detection of apoptotic airway cells from PAO1 infected cftr
/
or control mice. Bacterial expression of specific adhesins, complete lipopolysaccharide, and a functional type
III secretion system were all necessary to evoke apoptosis even
in susceptible epithelial cells. Unlike other mucosal surfaces,
the airway epithelium is highly resistant to apoptosis, and this
response is activated only when the appropriate epithelial conditions are present as well as fully virulent P. aeruginosa capable of coordinately expressing both adhesins and cytotoxins.
| |
Introduction |
|---|
|
|
|---|
Airway epithelial cells perform many important functions,
serving as an interface between environmental stimuli and
the lung parenchyma. Normally the lower airways are pristine, free of bacterial flora or inflammatory cells, and are
well protected by several layers of defenses including antimicrobial peptides, mucin, and ciliary action. There is a
brisk epithelial response to airway injury caused by many
different mechanisms (1, 2). Bacterial penetration of airway defenses and binding to epithelial receptors promptly
results in epithelial cytokine expression (3). An alternative
response may be the expression of the signaling cascade leading to apoptosis (programmed cell death). Activation
of epithelial proinflammatory signaling cascades is mediated by nuclear factor (NF)-
B, a transcriptional activator,
which, in addition to its effects in promoting inflammation,
is also known to have major antiapoptotic effects (4). Infection of mucosal surfaces can have significant effects on
the turnover of epithelial cells. Whereas viral infections of
the respiratory tract, notably those caused by Epstein-
Barr virus, have a major antiapoptotic effect attributed to
the need for ongoing host cell replication for efficient viral
infection, effects of bacterial infection on the induction of
apoptosis in airway cells are less well characterized. At
other mucosal sites, a progression from epithelial cytokine
activation to apoptosis, degeneration, and cell replacement has been described for the lumenal cells that interact
with potential pathogens (7). However, there appears to
be relatively little ongoing cell turnover and apoptosis in
cells lining the airways in the absence of injury (8). Apoptosis
of airway epithelial cells as a general response to bacterial
infection has not been examined in detail.
The response of the airway epithelium to excessive bacterial stimuli is reflected in the pathology associated with
cystic fibrosis (CF) lung disease. Through recognition of
asialoGM1 receptors on airway epithelial cells, pathogens
such as Pseudomonas aeruginosa stimulate translocation
of NF-
B and transcription of interleukin (IL)-8, the major
polymorphonuclear leukocyte (PMN) chemokine, to eliminate bacteria, a process that is upregulated in cells with
CF transmembrane conductance regulator (CFTR) mutations (2, 9). Inasmuch as NF-
B is a key transcriptional activator, the association between increased NF-
B activity
and excessive inflammation in CF airways is of potential
clinical significance. In normal airways this process is usually self-limited, but in CF it appears to be exaggerated
(10). Although NF-
B-dependent IL-8 expression has a
critical role in eliciting a PMN response to infection, activation of apoptosis may be a mechanism for regulating inflammation, either by eliminating the cells which persist in
signaling or by inhibiting NF-
B (11). Activation of NF-
B
not only initiates an inflammatory response but also can
block the activation of cell signaling pathways that promote apoptosis in other cell types (12).
There is extensive literature examining the consequences of specific proinflammatory cytokines, particularly tumor necrosis factor (TNF)-
, on the induction of
apoptosis. An important biologic effect of TNF-
is the induction of apoptosis through its interaction with its receptor, TNFR. However, the same TNF-TNFR ligand-receptor interaction can also activate NF-
B (5). Activation of
the Fas ligand is another major signaling pathway that
leads to apoptosis. In bronchial epithelial cells, ligation of
Fas stimulates both apoptosis and expression of IL-8 (13).
Thus, the activation of proinflammatory signaling pathways can elicit apoptotic responses as well as the expression of cytokines. The response of the normal airway epithelial cell to bacterial infection may consist of activation of both apoptotic and proinflammatory cascades (5, 6).
However, in diseases such as CF, in which there appears to
be an excessive inflammatory response, the balance between the activation and suppression of these potentially
opposing pathways may be abnormal.
The effects of CFTR dysfunction on apoptosis have
been studied both in vitro and in clinical specimens. Bronchial and intestinal biopsy specimens from CF patients had
more apoptotic cells detected by terminal deoxyribonucleotidyl transferase-mediated deoxyuridine triphosphate
(dUTP)-biotin nick-end labeling (TUNEL) assay as compared with controls, and apoptosis was particularly pronounced in areas with high CFTR expression, such as the
submucosal cells (14). However, a mouse mammary epithelial cell line (C127) transfected with mutant CFTR was
found to be resistant to apoptosis, as compared with cells
expressing the wild-type gene (15). The difference in rates
of apoptosis was suggested to be due to consequences of
Cl
channel dysfunction and lack of acidification in the cytoplasmic compartments required for caspase function and
proteolytic activity. Although these studies may provide
insights into the contribution of CFTR channel activity to
apoptosis, murine mammary cells stimulated with cycloheximide may not be an appropriate model to reflect the
responses of more highly differentiated, polarized cells that are also activated to express proinflammatory cytokines.
In this report, the effects of P. aeruginosa on the induction of apoptosis in airway epithelial cells were studied. We
were especially interested in determining what effects
CFTR dysfunction might have on the induction of apoptosis, whether the postulated effects of CFTR mutation on
apoptotic pathways are a consequence of a general lack of
Cl
channel activity or due to the effects of specific types of
CFTR mutation, such as accumulation of the
F508 mistrafficked CFTR in the endoplasmic reticulum (ER) and
subsequent endogenous activation of NF-
B. In addition,
because bacterial interactions with airway cells are fundamental to the pathogenesis of CF lung disease, we compared several well characterized P. aeruginosa mutants for their ability to induce apoptosis to determine whether the
same virulence factors associated with the induction of inflammation are also required to stimulate apoptosis.
| |
Materials and Methods |
|---|
|
|
|---|
Cell Culture
9HTEo
cells, a human tracheal epithelial cell line, were grown
in Dulbecco's modified Eagle's medium (DMEM) supplemented
with 10% fetal bovine serum and were stably transfected with either pCep (a control vector) or pCep-R (providing constitutive
expression of the regulatory domain [R-domain] of CFTR),
which results in typical CF-like physiology, i.e., failure of Cl
secretion in response to cyclic adenosine monophosphate (cAMP) (16) and altered superficial sialylation (9). IB-3 cells (
F508/
W1282X), a human bronchial epithelial cell line, and C-38 cells,
the corrected line which expresses an episomal copy of a truncated form of CFTR and exhibits normal physiology but lacks the
first extracellular domain of CFTR (17), were obtained from P. Zeitlin (Johns Hopkins University, Baltimore, MD). The IB-3 cells used in these studies contain the empty vector. CFT1-LCFSN cells and the CFT1-LC3 cells were obtained from James
Yankaskas (University of North Carolina, Chapel Hill, NC).
They were grown in serum-free Ham's F-12 media with supplements. CFT1 is a homozygous
F508 cell line transformed with a
retrovirus vector encoding a full-length wild-type CFTR (LCFSN)
or the empty vector (LC3) (18). Human nasal polyp epithelial
cells (NHNP) from normal persons were isolated using the protease method and grown in primary culture as described previously (3). Reagents were obtained from Sigma Chemical Co. (St.
Louis, MO) unless otherwise specified.
Construction of 16HBE-14o
Cells, Sense, and Antisense
Cell Lines
16HBE-14o
cells (16HBE), a human bronchial epithelial cell
line, was provided by D. Gruenert (University of California San Francisco, San Francisco, CA). These cells form tight junctions when grown on vitrogen-coated wells (19). The first 131 nucleotides of human CFTR were isolated by polymerase chain reaction (PCR) and cloned into the pBK-cytomegalovirus vector in
the sense and antisense orientations, as confirmed by restriction
enzyme analysis and DNA sequencing. 16HBE cells were transfected with these plasmids by calcium phosphate coprecipitation
and selected using G418. Colonies were screened for the presence of the vector using the sense primers TTGTAATACGACTCACTATAGGGC and GGCTTTTCCAGAGGCGACCTCTG (fragment 157 base pairs [bp]) and antisense TTGTAATACGACTCACTATAGGGC and AGAGGTCGCCTCTGGAAAAGGCC
(fragment 211 bp). PCR-positive clones were tested for the presence of transfected DNA by Southern hybridization of extracted
DNA cleaved with PvuII. Clones selected for further expansion
had 1 to 10 copies of the plasmid per cell. Transfected cells were
subjected to [36Cl] efflux assays, with and without reagents to
stimulate cAMP production (1 mM theophylline plus 10 µM forskolin), and monitored for 400 s. Cells transfected with the sense
construct had a significant cAMP-stimulated increase in [36Cl] efflux, whereas the cells transfected with antisense did not. Monolayers of antisense cells studied in an Ussing chamber did not display chloride secretion in response to amiloride followed by
forskolin (data not shown).
Bacterial Strains and Culture Conditions
P. aeruginosa strains PAO1 (wild-type); PAO/NP (Pil
); PAO/
NPfliA (Pil
Fla
) (20); PAO1exsA
, lacking a type III secretion
system (21); and PAO1algC, a mutant lacking lipopolysaccharide
(LPS) side chains and a fully glycosylated core (20), were used.
PAO1/GFP which constitutively expresses green fluorescent protein (GFP), was constructed by cloning a DNA fragment expressing enhanced GFP (Clontech, Palo Alto, CA) into the polylinker
of the P. aeruginosa vector pUCP19 and electroporating PAO1
with the resulting plasmid. Bacteria were grown in luria broth
overnight at 37°C with aeration. Aliquots were resuspended in
phosphate-buffered saline (PBS) and diluted to give a concentration of 1 × 106 colony-forming units (cfu)/ml to stimulate the epithelial monolayers.
Apoptosis Assays
Confluent epithelial cell monolayers were incubated with 1 × 106 cfu/ml of PAO1 for 1 to 8 h, washed with PBS, and further incubated for 12 to 18 h in the presence of gentamicin (100 to 200 µg/ml). Epithelial cells were then treated with commercially obtained fluorescent markers of apoptosis (22) as indicated, and analyzed with a Becton Dickinson Flow Activated Cell Sorter (FACS Calibur) equipped with a 15-mW, 488-nm, air-cooled argon laser using Cell Quest software.
Effects of the protease inhibitors, N-
-p-tosyl-L-lysine chloromethyl ketone (TLCK) (10 µM) or N-tosylamido-L-phenylalanine chloromethyl ketone (TPCK) (10 µM) in dimethyl sulfoxide
were assayed by preincubating confluent monolayers for 60 min
before the addition of PAO1 (1 × 106 cfu/ml).
The effects of ethyleneglycol-bis-(
-aminoethyl ether)-N,N'-tetraacetic acid (EGTA) were tested by incubating the monolayers with 50 µM EGTA in Ca2+-free epithelial Ringer's solution, pH 7.4, for 1 h before the addition of PAO1 and continuing incubation with
bacteria in the presence of EGTA for increasing periods of time.
TUNEL Assay
DNA strand breaks were detected by in situ terminal deoxynucleotidyl transferase (TdT) assay and TUNEL assay (Promega, Madison, WI). After incubation with bacteria, epithelial cells were fixed in 1% paraformaldehyde for 20 min on ice, washed with 1% bovine serum albumin in PBS, and resuspended in 0.1% Triton for 20 min. The cells were then incubated in a mixture containing TdT and dUTP conjugated to fluorescein isothiocyanate for 1 h at 37°C and analyzed by flow cytometry.
Mitochondrial Permeability
Altered mitochondrial membrane permeability was detected using ApoAlert Mitochondrial Membrane Sensor (Clontech), following the manufacturer's instructions. In healthy cells, MitoSensor dye taken up by mitochondria forms aggregates that exhibit red fluorescence. In apoptotic cells, MitoSensor dye remains cytoplasmic and the monomeric form produces green fluorescence. Washed monolayers were trypsinized, suspended in 500 µl of DMEM/F12 plus 5 µg/ml of the mitosensor reagent, incubated at 37°C in 5% CO2 for 20 min, and analyzed by flow cytometry as described earlier.
Statistical analysis of the results was performed by analyzing
the data expressed as a mean ± standard deviation (SD) of the treatment or control groups and using either an unpaired t test with Welch correction or a
-square analysis. A two-tailed P value was obtained using Graphpad InStat software, version 3.0.
Confocal and Fluorescence Microscopy
Cells were grown to confluence in a polarized fashion at an air-liquid interface on transwells (Costar, Corning, NY). Media was changed to DMEM/F12 plus 10% fetal calf serum with no antibiotics before stimulation with PAO/GFP (1 × 108 cfu/ml) for 3 h followed by PBS washes. Adherent bacteria were labeled with rabbit antisera to PAO1 outer membrane proteins which were visualized with a secondary goat antirabbit immunoglobulin (Ig) G F(ab')2 conjugated with Texas Red (1:40). The cells were washed with PBS, fixed with 2% paraformaldehyde, and permeabilized in 0.1% Triton in 5% donkey serum. Tight junctions were labeled with rabbit anti- ZO-1 (1:200) (Zymed, South San Francisco, CA) in 5% donkey serum for 1 h at room temperature, washed, and then incubated with donkey antirabbit IgG conjugated to Cy-5 or Texas Red (Jackson ImmunoResearch, West Grove, PA) (1:100) (23, 24). Cell membranes were also labeled with mouse antifodrin (1:200) (Chemicon, Temecula, CA) for 1 h at room temperature, washed, and incubated with donkey antimouse IgG conjugated to Cy-5 (1:100). Control 16HBE monolayers were compared with monolayers treated with 50 µM EGTA in Ca2+-free epithelial Ringers solution, pH 7.4, for 1 h before infection and throughout the incubation period.
Immunohistochemistry
Mice homozygous for the CFTR S489X (null) mutation or wild-type littermate controls (cftr
/
and +/+) were inoculated with P. aeruginosa impregnated in agar beads as previously described (10). Lungs were harvested under sterile conditions 3 d after inoculation and frozen immediately in liquid nitrogen. Paraffin-embedded 5-µm sections were obtained and treated as described
earlier to detect TUNEL-positive cells.
| |
Results |
|---|
|
|
|---|
Detection of PAO1-Induced Apoptosis in 9HTEo
Cells
Apoptotic 9HTEo
cells in confluent monolayers after exposure to PAO1 were identified by labeling with fluorescent markers for cellular events that occur during apoptosis. By flow cytometric analysis, similar populations of cells
were identified by the mitochondrial permeability marker
after either ultraviolet (UV) irradiation for 60 min or exposure to PAO1 for 6 h (Figure 1A). The apoptotic cells
differed in size and complexity from either a control population of normal cells or frankly necrotic cells. The apoptotic
cells were unable to exclude propidium iodide but had evidence of nuclear condensation and fragmentation, which differentiated them from the necrotic cell population. Apoptotic cells were also readily visualized by TUNEL labeling and fluorescence microscopy (Figure 1B).
|
Susceptibility to Apoptosis and the Presence of Tight Junctions
The number of apoptotic 9HTEo
cells, a transformed cell
line, or NHNP cells, growing in primary culture, were quantified using the TUNEL assay after exposure to PAO1 for
increasing periods of time. Although more than 50% of the
9HTEo
cells were TUNEL-positive after 8 h of exposure
to PAO1, less than 10% of the cells in primary culture had
evidence of apoptotic changes (Figure 2). We postulated
that the presence of tight junctions, an expected property of
the NHNP cells but not the 9HTEo
cells, may provide a
barrier that prevents bacterial access to epithelial receptors
that mediate the apoptotic response. Using confocal microscopy, we assessed the barrier function provided by confluent monolayers of the 9HTEo
cells and the NHNP cells,
grown in a polarized fashion on semipermeable membranes
and exposed to identical inocula of PAO1 (Figure 3A). Significantly greater numbers of bacteria were associated with the 9HTEo
monolayer, penetrating below the apical surface and intercalating between adjacent cells, as seen in a
confocal image of a section 8 µm below the apical surface of
the monolayer. Bacteria were virtually excluded from the
NHNP monolayers. ZO-1 was localized along the plasma
membrane of the NHNP cells consistent with the presence
of tight junctions, whereas the distribution of this marker in
the 9HTEo
cells was diffuse (23, 24) (Figure 3B).
|
|
To further establish that tight junctions are associated with resistance to apoptosis, we tested the susceptibility of 16HBE cells, which have tight junctions when grown in polarized monolayers on vitrogen-coated supports (19). These cells were resistant to PAO1-induced apoptosis, similar to the NHNP cells, under control conditions. However, upon disruption of their tight junctions with 50 µM EGTA, up to 35% of the 16HBE cells were apoptotic in comparison with less than 10% of the cells exposed to the bacteria alone for 6 h (Figure 4A). Loss of tight junctions that accompanied the EGTA treatment was demonstrated by the diffuse pattern of ZO-1 reactivity as compared with the localization of ZO-1 at the apical borders of cells not exposed to EGTA (Figure 4B).
|
Inhibition of NF-
B Translocation Increases
Susceptibility to Apoptosis
Epithelial cell monolayers, with or without tight junctions,
are readily stimulated by a number of P. aeruginosa gene
products to activate NF-
B and transcribe proinflammatory
cytokines. Because the activation of NF-
B inhibits apoptosis in other cell types, we tested this effect in respiratory epithelial cells. For NF-
B translocation to occur, proteins of
the I
B family must be phosphorylated and proteolytically
degraded in the proteosome. The protease inhibitors TLCK
and TPCK act as inhibitors of NF-
B translocation by
blocking the breakdown of I
B in the proteosome, an effect
we previously demonstrated in these airway epithelial cells
(3). The effects of TPCK and TLCK on the induction of apoptosis in epithelial cells stimulated with PAO1 were tested
(Figure 5). TLCK and TPCK at 10 µM increased the number of apoptotic cells to 28 and 15% of the population, respectively, as compared with the 5.5% that were apoptotic
in the absence of the protease inhibitors. These findings are
consistent with data from other cell types, suggesting that inhibition of NF-
B increases apoptosis.
|
Susceptibility to Apoptosis Is Equivalent in Matched Cell Lines with and without CFTR Dysfunction
CFTR mutations have been postulated to confer antiapoptotic effects by increasing pH in specific cell compartments impairing the nucleolytic activity of caspases (15).
Indirect effects of CFTR mutations associated with increased
expression of proinflammatory cytokines and activated
NF-
B may also diminish apoptosis. To directly test the effects of CFTR mutations on apoptosis, several matched
cell lines with well characterized defects in CFTR function were assayed after PAO1 exposure (Figure 6). 9HTEo
cells, transfected with a control pCep vector, or pCep-R
constitutively expressing the CFTR R-domain which causes a
CF-like phenotype (lack of Cl
secretion in response to
cAMP stimulation), had equivalent rates of apoptosis, approximately 70% of the 10,000 cells screened by flow cytometry using the mitochondrial permeability assay. IB-3 (CF) and C-38 cells corrected with a functional truncated
copy of CFTR were similar, with approximately 60% of
the cells apoptotic after 3 h of PAO1 exposure. Over 70%
of the CFT1 cells, whether complemented with a full-length functional CFTR or with the vector, were apoptotic
after 3 h of PAO1 exposure and almost 90% were apoptotic
after 6 h of incubation with bacteria. In contrast, 16HBE
cells (which form tight junctions) transfected with plasmids expressing CFTR antisense complementary DNA
(cDNA) or the control cDNA in the "sense" orientation
were resistant to apoptosis, with less than 10% of the population labeled with the fluorescent marker, reflecting loss
of mitochondrial permeability. The electrophysiologic properties of these cells reflected the absence of CFTR
Cl
transport after forskolin stimulation, as compared with
the cells transfected with the "sense" control (Figure 7). An
NHNP control with similarly negligible rates of apoptosis
is shown for comparison. Thus, cells with CFTR dysfunction,
whether due to the
F508/W1282X or homozygous
F508
mutations expected to accumulate in the ER, Cl
channel
dysfunction due to overexpression of the R-domain with normal CFTR localization on the cell surface, or lack of
CFTR expression, were all similarly susceptible to the induction of apoptosis and did not differ significantly from control
strains with normal CFTR activity. The 16HBE cells were
uniformly resistant to PAO1 induction of apoptosis whether
or not CFTR was expressed.
|
|
Apoptosis in cftr
/
and +/+ Murine Lungs
To determine whether the results obtained with cell lines
correlate with an in vivo situation, we compared lung histology in cftr
/
and control mice infected with PAO1 in
agar beads. TUNEL-positive cells in comparable sections
of lung were detected by in situ immunocytochemistry
(Figure 8). A positive control, a section of normal lung
treated with deoxyribonuclease (DNase) to produce fragmented DNA, is shown to indicate the sensitivity of the
immunofluorescent antibody used and illustrate the normal architecture of the lung. The TUNEL-positive columnar epithelial cells lining the bronchi were well delineated
in the longitudinal section (Figure 8A). In infected mice,
patchy areas of inflammation were evident in the lungs of
both wild-type and cftr
/
lungs. Inflammatory material
in the airway lumen and alveolar spaces was diffusely
TUNEL-positive, presumably due to the fragmented DNA
of degrading PMNs. The columnar epithelial lining of the
airways seen in longitudinal section was notably free of
TUNEL-positive cells (Figure 8B). We detected TUNEL-positive mucus in the infected normal control mice, but
this was limited chiefly to the bronchus and not the alveolar spaces (Figure 8C). Bronchial epithelial cells were not
TUNEL-positive. Equivalent amounts of TUNEL-positive lymphoid cells were evident in sections of the spleens
of all the animals studied (data not shown). Although
more inflammatory material was evident in the airways of
the cftr
/
mice, there were few, if any, apoptotic cells
lining the airways visualized.
|
Expression of Multiple Virulence Factors Is Required to Induce Apoptosis
Having found that susceptibility to apoptosis is related to
the resistance of the monolayers to bacterial penetration,
we postulated that the expression of specific P. aeruginosa
virulence factors, particularly those important in invasion,
may induce apoptosis. 9HTEo
cells were exposed for 6 h
to standardized inocula of PAO1 mutants that lack expression of specific virulence factors involved in the pathogenesis of airway infection (20), and were assayed for markers
of apoptosis 18 h later (Figure 9). A nonpiliated mutant
(PAO/NP) caused apoptosis in less than 10% of the cells, as compared with 50% of the cells which were apoptotic by
either TUNEL or the mitochondrial permeability marker
after exposure to wild-type PAO1. Lack of a functional
type III secretion system (PAOexsA), or lack of mature
LPS (PAOalgC) resulted in minimal rates of apoptosis
equivalent to control cells not exposed to bacteria. A superficial stimulus which elicits NF-
B translocation, antibody
to asialoGM1, did not induce apoptosis by 18 h, nor did TNF-
. The secreted extracellular products (culture supernatant) of PAO1 and each of the mutant strains accumulated
after 18 h of growth were insufficient to stimulate apoptosis
(data not shown).
|
| |
Discussion |
|---|
|
|
|---|
Mucosal epithelial cells can respond to bacteria by several different mechanisms (25, 26). Airway epithelial cells have been characterized extensively for their proinflammatory response to specific bacterial virulence factors, and necrosis of epithelial cells as a consequence of bacterial toxins is also well established (27). The ability of P. aeruginosa to induce apoptosis in airway epithelial cells was found to be dependent upon properties of both host epithelial cells and the bacteria. Normal polarized airway epithelial cells in primary culture were resistant to apoptosis, even after prolonged (6 h) exposure to bacteria. This may reflect the inherent properties of the airway epithelium, which is a stable mucosal surface with relatively low rates of cell proliferation under normal conditions (8). Human airway epithelial cells are capable of proliferation after damage, and regeneration occurs promptly, usually within 48 h (26). However, exposure of airway epithelial cells to an inoculum of P. aeruginosa sufficient to activate proinflammatory cytokine expression did not activate apoptosis in cells that form confluent monolayers with tight junctions.
Airway epithelial cells appear to differ in this respect from the epithelial cells lining other mucosal surfaces, such as the genitourinary (28) or gastrointestinal (GI) epithelium. The gut mucosa is regularly regenerated through an orderly progression of cell differentiation from basal cells deep within crypts to the fully differentiated cells at the tips of the villi which are shed and replaced (7). Although many pathogenic bacteria trigger apoptosis in GI cells (25), this process seems much more limited in the lung. This may reflect the normal functions of these respective mucosae, as GI epithelial cells are constantly exposed to solid lumenal contents whereas the airway cells line an empty conduit for gas exchange. Apoptosis may be a normal component of gut regeneration but represent a pathologic response in the lung.
The susceptibility of respiratory epithelial cells to apoptosis was at least partially dependent upon the integrity
of tight junctions. The 9HTEo
cells that lack tight junctions were readily susceptible to apoptosis after exposure
to wild-type P. aeruginosa PAO1. In contrast, 16HBE cells
and the NHNP airway cells, which retain tight junctions, were highly resistant to apoptosis unless these junctions were disrupted. Confocal images of the bacterial-epithelial interaction suggest that many more organisms gain access to
the relevant epithelial binding sites on 9HTEo
cells and
interact with basolateral as well as apical receptors. Other
investigators have demonstrated significantly increased P. aeruginosa-epithelial interactions in cell culture systems that do not form tight junctions (29).
The resistance of airway epithelial cells to apoptosis may
be due, in part, to the stimulation of NF-
B by adherent
P. aeruginosa. NF-
B is an important transcriptional activator that, in addition to initiating transcription of proinflammatory cytokines, also regulates expression of genes
that inhibit cell death (4, 5, 11, 13). NF-
B appears to have
an antiapoptotic effect in respiratory cells. By blocking
proteolytic degradation of I
Bs in the proteosome, the
rate of apoptosis in the 9HTEo
cells was increased. Inasmuch as apical stimulation of airway cells with several different P. aeruginosa ligands is sufficient to activate the
NF-
B response (3), this is likely to have an antiapoptotic
effect in respiratory epithelial cells. This is teleologically
appealing as airway cells express cytokines to induce a
PMN response to eradicate bacteria. Induction of apoptosis would limit further PMN signaling, and loss of these
barrier cells would expose basolateral surfaces of the epithelium and increase the risk of bacterial invasion. An alternative consequence of epithelial cytokine production
would be the activation of apoptosis through an autocrine
circuit. However, TNF-
, the cytokine often associated
with apoptotic responses and present in the milieu of infected airways, did not stimulate apoptosis, suggesting that pulmonary epithelial cells have a highly selective response
to cytokine signals.
Several lines of experimental evidence imply that CFTR
mutations should prevent apoptosis. Activation of NF-
B,
which is antiapoptotic, is a common characteristic of cells
with CFTR mutation attributed to both exogenous stimulation by adherent bacteria and to cell stress, perhaps associated with the accumulation of mutant CFTR in the ER
(2). In addition, Gottlieb and Dosanjh suggested that Cl
channel dysfunction and impaired acidification inhibit
caspase activity and protect mammary epithelial cells with
CFTR dysfunction from apoptosis (15). Moreover, the induction of apoptosis in GI cells is dependent upon expression of nitric oxide (7), which is impaired in cells with
CFTR mutations (30); all factors which might inhibit apoptosis in CF cells. The few clinical studies of apoptosis in
biopsies from patients with CF are descriptive and lack
matched normal controls, making it difficult to sort out effects of chronic infection, inflammation, and epithelial destruction from those due to mutant CFTR (14, 31). However, our studies using respiratory epithelial cell lines with
CFTR dysfunction due to several different mechanisms
did not indicate differences in apoptosis in CF cells as
compared with normal controls. Mistrafficking of
F508/
W1282X or
F508 CFTR did not prevent apoptosis after
PAO1 infection, suggesting that localization of normal
CFTR on the cell surface (32) is not involved in the induction of apoptosis. Lack of CFTR Cl
channel function due
to overexpression of the R-domain in 9HTEo
cells which
otherwise have normal trafficking of CFTR and the expected "CF-like" properties, including increased bacterial
adherence and IL-8 expression (9), did not affect rates of
apoptosis as compared with controls. Although the
9HTEo
, CFT1, IB-3, and C-38 cells had sufficient rates of
apoptosis to detect a protective effect conferred by CFTR
mutation, the 16HBE cell lines were so resistant to apoptosis that any protection associated with CFTR would be
negligible. Data obtained from infected cftr
/
and +/+
mice, while not quantitative, was consistent with the in
vitro studies; few apoptotic cells were detected in the airway epithelia, and no appreciable differences were found between the cftr
/
and +/+ mice. Overall, our studies
suggest that factors other than CFTR mutation predominate in determining what cellular events are activated after bacterial infection.
Airway epithelial cells are clearly capable of undergoing apoptosis when sufficiently stimulated by P. aeruginosa, and our data suggest that exposure of basolateral
surfaces of the airway epithelial cell to bacteria is involved
in this response. Cell dissociation is a potent stimulus for
apoptosis inasmuch as the loss of anchoring to cell matrix
components or interruption of cell-cell contact are important signals to regulate cell proliferation (33). In end-stage
CF lung disease, epithelial integrity is disrupted and there
are likely to be significant numbers of apoptotic cells, as
found in CF lungs examined at the time of lung transplant (31). However, even cells that lack tight junctions but still maintain close cell-to-cell contacts are still relatively resistant to apoptosis. To induce apoptosis in 9HTEo
monolayers, intact bacteria expressing pili, flagella, and mature LPS were required. In addition, as has been shown for the
intracellular pathogens Yersenia and Shigella, the products
of the P. aeruginosa type III secretion system were also
necessary to initiate apoptosis. The P. aeruginosa exoenzymes S and T are delivered into eukaryotic cells by the
type III apparatus after pilin-dependent binding (33). These
cytotoxins are bifunctional adenosine diphosphate ribosylating enzymes that interact with small molecular weight guanidine triphosphatases such as Rho, Rac, and Cdc-42
(34), which are important in the maintenance of cytoskeletal
components and tight junctions in polarized epithelia.
Loss of cell-cell anchoring or contact with matrix elements
is a major stimulus for apoptosis preventing metastatic
growth of dissociated cells. The ability of these P. aeruginosa
toxins to disrupt actin polymerization and dissociate cell-cell
contacts is a likely cause of apoptosis (35). PAO1 culture
supernatant, despite the presence of potent exoenzymes,
was insufficient to activate apoptosis. The experimental data
are consistent with a requirement for the type III secreted toxins and intimate bacterial-epithelial contact to initiate
an apoptotic response to bacterial infection. Apoptosis is
not simply a result of exoproduct toxicity.
P. aeruginosa induction of apoptosis in the airway epithelium appears to be a highly regulated process activated
only by the coincidence of specific epithelial and bacterial
factors. Fundamental properties of the respiratory tract,
the maintenance of unobstructed airways to facilitate the
gas exchange, mitigate against the routine sloughing of airway cells as a general response to lumenal bacteria. Unlike
other mucosal barriers that activate proinflammatory signaling cascades and apoptotic pathways immediately after
exposure to bacterial pathogens, airway cells are infrequently shed in response to P. aeruginosa infection. It remains to be established what role, if any, apoptosis may
play in regulating NF-
B-dependent activation of cytokine
expression early in the course of infection. Instead, our data
suggest that apoptosis occurs only after significant loss of
epithelial integrity, and even with loss of tight junctions requires the additional insult of bacterial toxins that further disrupt the normal cytoskeletal architecture.
| |
Footnotes |
|---|
Address correspondence to: Alice Prince, Columbia University, 650 W. 168th St., New York, NY 10032. E-mail: asp7{at}columbia.edu
(Received in original form January 20, 2000 and in revised form April 26, 2000).
Abbreviations: cyclic adenosine monophosphate, cAMP; cystic fibrosis, CF; CF transmembrane conductance regulator, CFTR; colony-forming units, cfu; Dulbecco's modified Eagle's medium, DMEM; ethyleneglycol-bis- (
-aminoethyl ether)-N,N'-tetraacetic acid, EGTA; endoplasmic reticulum, ER; green fluorescent protein, GFP; gastrointestinal, GI; 16HBE-14o
cells, 16HBE; interleukin, IL; lipopolysaccharide, LPS; nuclear factor, NF; human nasal polyp epithelial cells, NHNP; phosphate-buffered saline, PBS; polymorphonuclear leukocyte, PMN; N-
-p-tosyl-L-lysine chloromethyl ketone, TLCK; tumor necrosis factor, TNF; N-tosylamido-L-phenylalanine chloromethyl ketone, TPCK; terminal deoxyribonucleotidyl
transferase-mediated deoxyuridine triphosphate (dUTP)-biotin nick-end
labeling, TUNEL.
Acknowledgments: Confocal microscopy was done at the Confocal Microscopy Facility, a part of the Herbert Irving Cancer Center at Columbia University and supported by the National Institutes of Health (NIH). This work was supported by NIH grants DK39693 to one author (A.P.) and DK27651 and HL/DK49003 to one author (P.D.), and a Cystic Fibrosis Foundation postdoctoral fellowship to one author (S.R.).
| |
References |
|---|
|
|
|---|
1. Rennard, S. I.. 1996. Repair mechanisms in asthma. Allergy Clin. Immunol. 98: S278-S286 [Medline].
2.
DiMango, E.,
A. J. Ratner,
R. Bryan,
S. Tabibi, and
A. Prince.
1998.
Activation of NF-
B by adherent Pseudomonas aeruginosa in normal and cystic
fibrosis respiratory epithelial cells.
J. Clin. Invest.
101:
2598-2606
[Medline].
3. DiMango, E., H. J. Zar, R. Bryan, and A. Prince. 1995. Diverse Pseudomonas aeruginosa gene products stimulate respiratory epithelial cells to produce interleukin-8. J. Clin. Invest. 96: 2204-2210 .
4.
Wang, C.-Y.,
M. W. Mayo,
R. G. Korneluk,
D. V. Goeddel, and
A. S. Baldwin.
1998.
NF-
B antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c-IAP2 to suppress caspase-8 activation.
Science
281:
1680-1683
5.
Hu, W.-H.,
H. Johnson, and
H.-B. Shu.
1999.
Tumor necrosis factor-related
apoptosis-inducing ligand receptors signal through NF-
B and JNK activation and apoptosis through distinct pathways.
J. Biol. Chem.
274:
30603-30610
6.
Van Antwerp, D. J.,
S. J. Martin,
T. Kafri,
D. R. Green, and
I. M. Verma.
1996.
Suppression of TNF-
-induced apoptosis by NF-
B.
Science
274:
787-789
7. Kim, J. M., L. Eckmann, T. C. Savidge, D. C. Lowe, T. Witthoft, and M. E. Kagnoff. 1998. Apoptosis of human intestinal epithelial cells after bacterial invasion. J. Clin. Invest. 102: 1815-1823 [Medline].
8. Bowden, D. H.. 1983. Cell turnover in the lung. Am. Rev. Respir. Dis. 128 (Suppl.): S46-S48 [Medline].
9.
Bryan, R.,
A. Perez,
D. Kube,
P. Davis, and
A. Prince.
1998.
Overproduction of the CFTR R-domain leads to increased levels of asialoGM1 and increased Pseudomonas aeruginosa binding by epithelial cells.
Am. J. Respir.
Cell Mol. Biol.
19:
269-277
10. Van Heeckeren, A., R. Walenga, M. W. Konstan, T. Bonfield, P. B. Davis, and T. Ferkol. 1997. Excessive inflammatory response of cystic fibrosis mice to bronchopulmonary infection with Pseudomonas aeruginosa. J. Clin. Invest. 100: 2810-2815 [Medline].
11.
Reuther, J. Y., and
A. S. Baldwin Jr..
1999.
Apoptosis promotes a caspase-induced amino-terminal truncation of I
B
that functions as a stable inhibitor of NF-
B.
J. Biol. Chem.
274:
20664-20670
12.
Clifton, D. R.,
R. A. Goss,
S. K. Sahni,
D. Van Antwerp,
R. B. Baggs,
V. J. Marder,
D. J. Silverman, and
L. A. Sporn.
1998.
NF-
B dependent inhibition of apoptosis is essential for host cell survival during Rickettsia rickettsii infection.
Proc. Natl. Acad. Sci. USA
95:
4646-4651
13.
Hagimoto, N.,
K. Kuwano,
M. Kawasaki,
M. Yoshimi,
Y. Kaneko,
R.J. Kunitake,
T. Maeyama,
T. Tanaka, and
N. Hara.
1999.
Induction of interleukin-8 secretion and apoptosis in bronchial epithelial cells by Fas ligation.
Am. J. Respir. Cell Mol. Biol.
21:
436-445
14. Maiuri, L., V. Raia, G. De Marco, S. Coletta, G. de Ritis, M. Londei, and S. Auricchio. 1997. DNA fragmentation is a feature of cystic fibrosis epithelial cells: a disease with inappropriate apoptosis. FEBS Lett. 408: 225-231 [Medline].
15.
Gottlieb, R. A., and
A. Dosanjh.
1996.
Mutant cystic fibrosis transmembrane conductance regulator inhibits acidification and apoptosis in C127
cells: possible relevance to cystic fibrosis.
Proc. Natl. Acad. Sci. USA
93:
3587-3591
16.
Perez, A.,
K. A. Risma,
E. A. Eckman, and
P. B. Davis.
1996.
Overexpression of R domain reduces basal chloride conductance and eliminates
cAMP stimulated chloride secretion in 9/HTEo
cells in culture.
Am. J. Physiol.
271:
L85-L92
17. Zeitlin, P. I., L. Lu, G. Cutting, G. Stetten, K. A Kieffer, R. Craig, and W. B. Guggino. 1991. A cystic fibrosis bronchial epithelial cell line: immortalization by adeno-12-SV40 infection. Am J. Respir. Cell Mol. Biol. 4: 313-319 .
18. Olsen, J. C., J. L. G. Johnson, M. J. Stutts, B. Sarkadi, J. R. Sarkadi, J. R. Yankaskas, R. Swanstrom, and R. C. Boucher. 1992. Correction of the apical membrane chloride channel defect in polarized cystic fibrosis airway epithelia following retroviral-mediated gene transfer. Hum. Gene Ther. 3: 253-266 [Medline].
19.
Plotkowski, M. C.,
S. deBentzmann,
S. H. M. Pereira,
J.-M. Zahm,
O. Bajolet-Laudinat,
P. Roger, and
E. Puchelle.
1999.
Pseudomonas aeruginosa internalization by human epithelial respiratory cells depends on cell differentiation, polarity, and junctional complex integrity.
Am. J. Respir. Cell
Mol. Biol.
20:
880-890
20. Tang, H. B., E. DiMango, R. Bryan, M. Gambello, B. H. Iglewski, J. B. Goldberg, and A. Prince. 1996. Contribution of specific Pseudomonas aeruginosa virulence factors to pathogenesis of pneumonia in a neonatal mouse model of infection. Infect. Immun. 64: 37-43 [Abstract].
21.
Frank, D. W.,
G. Nair, and
H. P. Schweizer.
1994.
Construction and characterization of chromosomal insertional mutations of the Pseudomonas
aeruginosa exoenzyme S transregulatory locus.
Infect. Immun.
62:
554-563
22. Walsh, G. M., G. Dewson, A. J. Wardlaw, F. Levi-Schaffer, and R. Moqbel. 1998. A comparative study of different methods for the assessment of apoptosis and necrosis in human eosinophils. J. Immunol. Methods 217: 153-163 [Medline].
23.
Fanning, A. S.,
B. J. Jameson,
L. A. Jesaitis, and
J. M. Anderson.
1998.
The
tight junction protein ZO-1 establishes a link between the transmembrane
protein occludin and the actin cytoskeleton.
J. Biol. Chem.
273:
29745-29753
24. Mitic, L. L., and J. M. Anderson. 1998. Molecular architecture of tight junctions. Annu. Rev. Physiol. 60: 121-142 [Medline].
25. Zylchinsky, A., and P. Sansonetti. 1997. Perspectives series: host/pathogen interactions. Apoptosis in bacterial pathogenesis. J. Clin. Invest. 100: 493-495 [Medline].
26. Herard, A.-L., J.-M. Zahm, D. Pierrot, J. Hinnrasky, C. Fuchey, and E. Puchelle. 1996. Epithelial barrier integrity during in vitro wound repair of the airway epithelium. Am. J. Respir. Cell Mol. Biol. 15: 624-632 [Abstract].
27. Sawa, T., M. Ohara, K. Kurahashi, S. S. Twining, D. W. Frank, D. B. Doroques, T. Long, M. A. Gropper, and J. P. Wiener-Kronish. 1998. In vitro cellular toxicity predicts Pseudomonas aeruginosa virulence in lung infections. Infect. Immun. 66: 3243-3249 .
28.
Mulvey, M. A.,
Y. S. Lopez-Boado,
C. L. Wilson,
R. Roth,
W. C. Parks,
J. Heuser, and
S. J. Hultgren.
1998.
Induction and evasion of host defenses
by type 1-piliated uropathogenic Escherichia coli.
Science
282:
1494-1497
29. Lee, A., D. Chow, B. Haus, W. Tseng, D. Evans, S. Fleiszig, G. Chandy, and T. Machen. 1999. Airway epithelial tight junctions and binding and cytotoxicity of Pseudomonas aeruginosa. Am. J. Physiol.(Lung Cell. Mol. Physiol.) 21: L204-L217 .
30. Kelley, T. J., and M. Drumm. 1998. Inducible nitric oxide is reduced in cystic fibrosis murine and human airway epithelial cells. J. Clin. Invest. 102: 1200-1207 [Medline].
31. Leigh, M. W., J. E. Kylander, J. R. Yankaskas, and R. C. Boucher. 1995. Cell proliferation in bronchial epithelium and submucosal glands of cystic fibrosis patients. Am. J. Respir. Cell Mol. Biol. 12: 605-612 [Abstract].
32.
Pier, G. B.,
M. Grout, and
T. S. Zaidi.
1997.
Cystic fibrosis transmembrane
conductance regulator is an epithelial cell receptor for clearance of Pseudo-monas aeruginosa from the lung.
Proc. Natl. Acad. Sci. USA
94:
12088-12093
33.
Comolli, J. C.,
A. R. Hauser,
L. Waite,
C. B. Whitchurch,
J. S. Mattick, and
J. N. Engel.
1999.
Pseudomonas aeruginosa gene products PilT and PilU
are required for cytotoxicity in vitro and virulence in a mouse model of
acute pneumonia.
Infect. Immun.
67:
3625-3630
34. Pederson, K. J., A. J. Vallis, K. Aktories, D. W. Frank, and J. T. Barbieri. 1999. The amino-terminal domain of P. aeruginosa ExoS disrupts actin filaments via small-molecular weight GTP-binding proteins. Mol. Microbiol. 32: 393-401 [Medline].
35. Aktories, K.. 1997. Bacterial toxins that target Rho proteins. J. Clin. Invest. 99: 827-829 [Medline].
This article has been cited by other articles:
![]() |
D. P. Nichols, A. G. Ziady, S. L. Shank, J. F. Eastman, and P. B. Davis The triterpenoid CDDO limits inflammation in preclinical models of cystic fibrosis lung disease Am J Physiol Lung Cell Mol Physiol, November 1, 2009; 297(5): L828 - L836. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Grumbach, N. V. T. Quynh, R. Chiron, and V. Urbach LXA4 stimulates ZO-1 expression and transepithelial electrical resistance in human airway epithelial (16HBE14o-) cells Am J Physiol Lung Cell Mol Physiol, January 1, 2009; 296(1): L101 - L108. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Firth, V.-J. Uitto, and E. E. Putnins Mechanical Induction of an Epithelial Cell Chymase Associated with Wound Edge Migration J. Biol. Chem., December 12, 2008; 283(50): 34983 - 34993. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Al-Turkmani, C. Andersson, R. Alturkmani, W. Katrangi, J. E. Cluette-Brown, S. D. Freedman, and M. Laposata A mechanism accounting for the low cellular level of linoleic acid in cystic fibrosis and its reversal by DHA J. Lipid Res., September 1, 2008; 49(9): 1946 - 1954. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. D. Kiely, J. O'Callaghan, A. Abbas, and F. O'Gara Genetic analysis of genes involved in dipeptide metabolism and cytotoxicity in Pseudomonas aeruginosa PAO1 Microbiology, August 1, 2008; 154(8): 2209 - 2218. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Andersson, M. R. Al-Turkmani, J. E. Savaille, R. Alturkmani, W. Katrangi, J. E. Cluette-Brown, M. M. Zaman, M. Laposata, and S. D. Freedman Cell culture models demonstrate that CFTR dysfunction leads to defective fatty acid composition and metabolism J. Lipid Res., August 1, 2008; 49(8): 1692 - 1700. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Perez, A. M. van Heeckeren, D. Nichols, S. Gupta, J. F. Eastman, and P. B. Davis Peroxisome proliferator-activated receptor-{gamma} in cystic fibrosis lung epithelium Am J Physiol Lung Cell Mol Physiol, August 1, 2008; 295(2): L303 - L313. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Soong, D. Parker, M. Magargee, and A. S. Prince The Type III Toxins of Pseudomonas aeruginosa Disrupt Epithelial Barrier Function J. Bacteriol., April 15, 2008; 190(8): 2814 - 2821. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Abusriwil and R. A. Stockley The Interaction of Host and Pathogen Factors in Chronic Obstructive Pulmonary Disease Exacerbations and Their Role in Tissue Damage Proceedings of the ATS, December 1, 2007; 4(8): 611 - 617. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cigana, B. M. Assael, and P. Melotti Azithromycin Selectively Reduces Tumor Necrosis Factor Alpha Levels in Cystic Fibrosis Airway Epithelial Cells Antimicrob. Agents Chemother., March 1, 2007; 51(3): 975 - 981. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Perez, A. C. Issler, C. U. Cotton, T. J. Kelley, A. S. Verkman, and P. B. Davis CFTR inhibition mimics the cystic fibrosis inflammatory profile Am J Physiol Lung Cell Mol Physiol, February 1, 2007; 292(2): L383 - L395. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jia, Y. Wang, L. Zhou, and S. Jin Expression of Pseudomonas aeruginosa Toxin ExoS Effectively Induces Apoptosis in Host Cells Infect. Immun., December 1, 2006; 74(12): 6557 - 6570. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Jenkins, A. Swiatoniowski, M. R. Power, and T.-J. Lin Pseudomonas aeruginosa-Induced Human Mast Cell Apoptosis Is Associated with Up-Regulation of Endogenous Bcl-xS and Down-Regulation of Bcl-xL J. Immunol., December 1, 2006; 177(11): 8000 - 8007. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Gomez, M. O'Seaghdha, M. Magargee, T. J. Foster, and A. S. Prince Staphylococcus aureus Protein A Activates TNFR1 Signaling through Conserved IgG Binding Domains J. Biol. Chem., July 21, 2006; 281(29): 20190 - 20196. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chun and A. Prince Activation of Ca2+-Dependent Signaling by TLR2 J. Immunol., July 15, 2006; 177(2): 1330 - 1337. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Borchers, N. L. Harris, S. C. Wesselkamper, S. Zhang, Y. Chen, L. Young, and G. W. Lau The NKG2D-Activating Receptor Mediates Pulmonary Clearance of Pseudomonas aeruginosa. Infect. Immun., May 1, 2006; 74(5): 2578 - 2586. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Mulcahy, J. O'Callaghan, E. P. O'Grady, C. Adams, and F. O'Gara The Posttranscriptional Regulator RsmA Plays a Role in the Interaction between Pseudomonas aeruginosa and Human Airway Epithelial Cells by Positively Regulating the Type III Secretion System. Infect. Immun., May 1, 2006; 74(5): 3012 - 3015. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Tesfaigzi Roles of Apoptosis in Airway Epithelia Am. J. Respir. Cell Mol. Biol., May 1, 2006; 34(5): 537 - 547. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kirschnek and E. Gulbins Phospholipase A2 Functions in Pseudomonas aeruginosa- Induced Apoptosis Infect. Immun., February 1, 2006; 74(2): 850 - 860. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Wagner, G. Soong, S. Sokol, L. Saiman, and A. Prince Effects of Azithromycin on Clinical Isolates of Pseudomonas aeruginosa From Cystic Fibrosis Patients Chest, August 1, 2005; 128(2): 912 - 919. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Gomez, S. H. Sokol, A. B. Muir, G. Soong, J. Bastien, and A. S. Prince Bacterial Induction of TNF-{alpha} Converting Enzyme Expression and IL-6 Receptor {alpha} Shedding Regulates Airway Inflammatory Signaling J. Immunol., August 1, 2005; 175(3): 1930 - 1936. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Sadikot, T. S. Blackwell, J. W. Christman, and A. S. Prince Pathogen-Host Interactions in Pseudomonas aeruginosa Pneumonia Am. J. Respir. Crit. Care Med., June 1, 2005; 171(11): 1209 - 1223. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Arita, A. Joseph, H.-C. Koo, Y. Li, T. A. Palaia, J. M. Davis, and J. A. Kazzaz Superoxide dismutase moderates basal and induced bacterial adherence and interleukin-8 expression in airway epithelial cells Am J Physiol Lung Cell Mol Physiol, December 1, 2004; 287(6): L1199 - L1206. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Cobb, J. C. Mychaleckyj, D. J. Wozniak, and Y. S. Lopez-Boado Pseudomonas aeruginosa Flagellin and Alginate Elicit Very Distinct Gene Expression Patterns in Airway Epithelial Cells: Implications for Cystic Fibrosis Disease J. Immunol., November 1, 2004; 173(9): 5659 - 5670. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhou, F. Lu, C. Latham, D. S. Zander, and G. A. Visner Heme Oxygenase-1 Expression in Human Lungs with Cystic Fibrosis and Cytoprotective Effects against Pseudomonas Aeruginosa In Vitro Am. J. Respir. Crit. Care Med., September 15, 2004; 170(6): 633 - 640. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Schmeck, R. Gross, P. D. N'Guessan, A. C. Hocke, S. Hammerschmidt, T. J. Mitchell, S. Rosseau, N. Suttorp, and S. Hippenstiel Streptococcus pneumoniae-Induced Caspase 6-Dependent Apoptosis in Lung Epithelium Infect. Immun., September 1, 2004; 72(9): 4940 - 4947. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Muir, G. Soong, S. Sokol, B. Reddy, M. I. Gomez, A. van Heeckeren, and A. Prince Toll-Like Receptors in Normal and Cystic Fibrosis Airway Epithelial Cells Am. J. Respir. Cell Mol. Biol., June 1, 2004; 30(6): 777 - 783. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Coraux, C. Kileztky, M. Polette, J. Hinnrasky, J.-M. Zahm, P. Devillier, S. de Bentzmann, and E. Puchelle Airway Epithelial Integrity Is Protected by a Long-Acting {beta}2-Adrenergic Receptor Agonist Am. J. Respir. Cell Mol. Biol., May 1, 2004; 30(5): 605 - 612. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Cannon, M. P. Kowalski, K. S. Stopak, and G. B. Pier Pseudomonas aeruginosa-Induced Apoptosis Is Defective in Respiratory Epithelial Cells Expressing Mutant Cystic Fibrosis Transmembrane Conductance Regulator Am. J. Respir. Cell Mol. Biol., August 1, 2003; 29(2): 188 - 197. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jia, M. Alaoui-El-Azher, M. Chow, T. C. Chambers, H. Baker, and S. Jin c-Jun NH2-Terminal Kinase-Mediated Signaling Is Essential for Pseudomonas aeruginosa ExoS-Induced Apoptosis Infect. Immun., June 1, 2003; 71(6): 3361 - 3370. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Jendrossek, S. Fillon, C. Belka, I. Muller, B. Puttkammer, and F. Lang Apoptotic Response of Chang Cells to Infection with Pseudomonas aeruginosa Strains PAK and PAO-I: Molecular Ordering of the Apoptosis Signaling Cascade and Role of Type IV Pili Infect. Immun., May 1, 2003; 71(5): 2665 - 2673. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-C. Plotkowski, H. C. C. Povoa, J.-M. Zahm, G. Lizard, G. M. B. Pereira, J.-M. Tournier, and E. Puchelle Early Mitochondrial Dysfunction, Superoxide Anion Production, and DNA Degradation Are Associated with Non-Apoptotic Death of Human Airway Epithelial Cells Induced by Pseudomonas aeruginosa Exotoxin A Am. J. Respir. Cell Mol. Biol., May 1, 2002; 26(5): 617 - 626. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lory and J. K. Ichikawa Pseudomonas-Epithelial Cell Interactions Dissected With DNA Microarrays Chest, March 1, 2002; 121 (2009): 36S - 40S. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Heyer, S. Saba, R. Adamo, W. Rush, G. Soong, A. Cheung, and A. Prince Staphylococcus aureusagr and sarA Functions Are Required for Invasive Infection but Not Inflammatory Responses in the Lung Infect. Immun., January 1, 2002; 70(1): 127 - 133. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Hotchkiss, W. M. Dunne, P. E. Swanson, C. G. Davis, K. W. Tinsley, K. C. Chang, T. G. Buchman, I. E. Karl, H. Grassme, S. Kirschnek, et al. Role of Apoptosis in Pseudomonas aeruginosa Pneumonia Science, November 30, 2001; 294(5548): 1783a - 1783. [Full Text] [PDF] |
||||
![]() |
A. J. Weber, G. Soong, R. Bryan, S. Saba, and A. Prince Activation of NF-{kappa}B in airway epithelial cells is dependent on CFTR trafficking and Cl{-} channel function Am J Physiol Lung Cell Mol Physiol, July 1, 2001; 281(1): L71 - L78. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kube, U. Sontich, D. Fletcher, and P. B. Davis Proinflammatory cytokine responses to P. aeruginosa infection in human airway epithelial cell lines Am J Physiol Lung Cell Mol Physiol, March 1, 2001; 280(3): L493 - L502. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Ratner, R. Bryan, A. Weber, S. Nguyen, D. Barnes, A. Pitt, S. Gelber, A. Cheung, and A. Prince Cystic Fibrosis Pathogens Activate Ca2+-dependent Mitogen-activated Protein Kinase Signaling Pathways in Airway Epithelial Cells J. Biol. Chem., May 25, 2001; 276(22): 19267 - 19275. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Crit. Care Med. |