help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamamoto, H.
Right arrow Articles by Busse, W. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamamoto, H.
Right arrow Articles by Busse, W. W.
Am. J. Respir. Cell Mol. Biol., Volume 23, Number 3, September 2000 379-388

The Effect of Transendothelial Migration on Eosinophil Function

Hideaki Yamamoto, Julie B. Sedgwick, Rose F. Vrtis, and William W. Busse

Pulmonary Division, Second Department of Internal Medicine, Saitama Medical School, Saitama, Japan; and Section of Allergy and Clinical Immunology, Department of Medicine, University of Wisconsin, Madison, Wisconsin


    Abstract
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

In bronchial asthma, eosinophils found in the airways have an enhanced inflammatory capacity. We hypothesized that, at least in part, changes in functional phenotype are due to the effect of transendothelial migration. To model in vivo eosinophil trafficking to the lung, we cultured human pulmonary microvascular endothelial cell (HPMEC) monolayers on Transwell filters. The HPMECs were activated with interleukin (IL)-1beta to increase cell expression of intercellular adhesion molecule (ICAM)-1 and, hence, eosinophil transmigration. Peripheral blood eosinophils from allergic patients were added to HPMEC-covered Transwell filters and incubated for 3 h at 37°C. The eosinophils were collected from below (migrated cells) and above (nonmigrated cells) the HPMEC monolayer to determine surface receptor expression, in vitro survival, and oxidative burst. Eosinophils never exposed to HPMECs were used as controls. Eosinophil cell surface expression of CD69, human leukocyte-associated antigen-DR (HLA-DR), and CD54 (ICAM-1) was significantly increased after transendothelial migration through IL-1beta -treated HPMECs compared with control cells (CD69: P < 0.0005; HLA-DR and CD54: P < 0.05) and nonmigrated eosinophils (CD69 and HLA-DR: P < 0.05). Moreover, the percent in vitro survival (48 h) of migrated eosinophils was also significantly greater (P < 0.0001 by trypan blue exclusion, P < 0.05 by flow cytometry) than that of control or nonmigrated eosinophils. Prolonged survival of migrated eosinophils was inhibited by addition of anti-granulocyte macrophage colony-stimulating factor (GM-CSF) antibodies (P < 0.05) to the 48-h survival culture, suggesting that autocrine production of GM-CSF was, at least partially, responsible for increased eosinophil survival. Although GM-CSF protein was not measurable in survival culture supernates, GM-CSF messenger RNA (mRNA) was expressed in both nonmigrated and migrated eosinophils but not in control cells. Similarly, the eosinophils' oxidative burst induced by platelet-activating factor, formylmethionyl leucylphenylalanine, or phorbol myristate acetate was equally, and significantly, increased in both nonmigrated and migrated eosinophils (P < 0.05 versus control). Therefore, whereas exposure of eosinophils to cytokine-activated HPMECs can increase surface receptor expression, in vitro survival, GM-CSF mRNA, and the respiratory burst, transendothelial migration can further potentiate receptor expression and survival in migrated cells. These results suggest that the process of transendothelial migration selectively participates in determining the eventual phenotype of airway eosinophils.


    Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Eosinophils are important effector cells in asthma (1, 2). Compared with blood eosinophils, airway eosinophils have increased inflammatory function, e.g., increased in vitro survival, superoxide anion (O2-) generation, surface expression of CD11b, and adherence (3). Finally, airway eosinophils, but not blood eosinophils, express greater amounts of activation markers CD69, human leukocyte-associated antigen-DR (HLA-DR), and CD54 (3, 5, 6). The factors, however, that determine the eventual airway eosinophil phenotype have yet to be fully defined.

For eosinophils to move from the circulation to the lung, they must first adhere to and then transmigrate across the pulmonary microvasculature. Under inflammatory conditions, endothelial cells are exposed to cytokines, such as interleukin (IL)-1beta , IL-4, and tumor necrosis factor (TNF)-alpha , which can then increase expression of intercellular adhesion molecule (ICAM)-1 and vascular cell adhesion molecule (VCAM)-1 (7) and thus serve as counterligands for eosinophil beta 2-integrins: lymphocyte function-associated antigen-1 (CD11a/CD18: alpha Lbeta 2) and Mac-1 (CD11b/CD18: alpha Mbeta 2), and alpha 4-integrins: very late antigen (VLA)-4 (CD49d/ CD29: alpha 4beta 1) and alpha 4beta 7 (13, 14).

Endothelial cells not only direct eosinophil migration but also contribute to the eventual eosinophil function through the adhesion of these two inflammatory cells. For example, eosinophil adhesion to recombinant human ICAM-1 or VCAM-1 induces cell degranulation and O2- generation via signaling through Mac-1 or VLA-4 (15). Firm adhesion to endothelial cells is then followed by transendothelial migration, a critical step for eosinophil migration into the tissues (19, 20). Previous studies suggest that eosinophil CD11b expression and zymosan-induced O2- generation is increased after migration across cytokine-treated human umbilical vein endothelial cells (HUVECs) (12, 21). Given these observations, we hypothesized that transmigration is an important factor in determining the eventual phenotype and function of airway eosinophils. To test this hypothesis, human pulmonary microvascular endothelial cell (HPMEC) monolayers were grown on 3-µm-pore Transwell filters and served as an in vitro model of transendothelial migration. We then determined the effect of transendothelial migration on selected eosinophil functions, including surface receptor expression, in vitro cell survival, and oxidative metabolism.

    Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Reagents and Cytokines

Percoll was purchased from Pharmacia (Uppsala, Sweden). Hanks' balanced salt solution (HBSS), RPMI 1640, phosphate-buffered saline (PBS), newborn calf serum (NCS), fetal calf serum (FCS), trypsin-ethylenediaminetetraacetic acid (EDTA), L-glutamine, penicillin-streptomycin, and trypan blue were obtained from Life Technologies (Grand Island, NY). Plasma fibronectin was obtained from Armour Pharmaceutical Co. (Tuckahoe, NY). Recombinant human IL-1beta , IL-4, TNF-alpha , and regulated on activation, normal T cells expressed and secreted (RANTES) were purchased from R&D Systems (Minneapolis, MN). Other reagents were purchased from Sigma Chemical Co.(St. Louis, MO) unless otherwise stated.

Cell Culture

HPMECs cryopreserved as tertiary or quaternary cultures were purchased from Clonetics (San Diego, CA) (22). HPMECs were characterized as endothelial cells by Clonetics for acetylated low-density lipoprotein uptake, factor VIII-related antigen expression, and positive staining for platelet endothelial cell adhesion molecule 1 (PECAM-1) (CD31) and Matrigel. Endothelial cell growth medium (EGM-MV) supplemented with 10 ng/ml human recombinant epidermal growth factor, 1 µg/ml hydrocortisone, 50 µg/ml gentamicin, 50 ng/ml amphotericin-B, 12 µg/ml bovine brain extract, and 5% fetal bovine serum was obtained from Clonetics. To promote HPMEC attachment and growth, all culture surfaces were precoated with 10 µg/ml plasma fibronectin for 1 h at 37°C. HPMEC were passaged before they reached confluence. Endothelial cells, derived from two different donors, were used at passages 5 through 9 and found to give equivalent results.

Human Subjects

Eosinophils were isolated from the peripheral blood of subjects with allergic airway disease such as allergic rhinitis and mild asthma. Subjects ranged in age from 20 to 52 yr and gender distribution was equal. Immediate hypersensitivity was confirmed by at least one positive skin reaction (> 3 mm) by the prick-puncture technique to extracts of common allergens, including ragweed, house dust mite, grass pollen, cat dander, and dog dander. Except for as-needed inhaled beta 2-agonists, subjects were taking no medications at the time of study. Informed, written consent was obtained before participation in the study and the study was approved by the University of Wisconsin Human Subjects Committee.

Eosinophil Separation

Eosinophils were isolated using negative immunomagnetic bead selection as previously described (23). Briefly, heparinized blood was diluted with HBSS (without Ca2+) and centrifuged for 20 min at 700 × g over 1.090 g/ml Percoll. The red blood cells in the cell pellet were lysed by hypotonic shock and the resulting granulocytes were washed in HBSS supplemented with 2% NCS. The granulocytes were then incubated with magnetic beads conjugated to mouse anti-human CD16 monoclonal antibody (mAb) (Miltenyi Biotec, Auburn, CA). After incubation for 40 min at 4°C, eosinophils were negatively selected in a magnetic field (MACS System, Miltenyi Biotec). CD16-negative eosinophils (> 98% purity and > 99% viability) were collected and resuspended in culture medium (RPMI 1640 supplemented with 10% FCS, 2 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin).

Transendothelial Migration of Eosinophils

HPMECs (2.5 × 105 cells/ml) were cultured on plasma fibronectin (10 µg/ml)-coated Transwell inserts (12 or 24 mm diameter polycarbonate membrane with 3-µm pores; Costar, Cambridge, MA). EGM-MV was added to the upper compartment only to inhibit the formation of an HPMEC bilayer. HPMEC monolayers formed within 2 d and were confirmed for confluence (albumin permeability) and cobblestone appearance by Diff-Quik staining (Baxter Scientific Products, McGaw Park, IL). Confluent monolayers were stimulated with IL-1beta (100 pM, 4 h) to induce ICAM-1 expression on HPMECs (23). After cytokine treatment, both upper and lower compartments of the Transwell chamber were washed three times with 37°C HBSS. Eosinophils (3.5 to 5 × 106 cells/ml) in culture medium were then added to the upper compartment, and culture medium alone was added to the lower compartment. After a 3-h incubation in 5% CO2 at 37°C, the 24-well plates were gently vibrated to dislodge any migrated eosinophils that adhered to the bottom of the filters. Eosinophils were collected from the upper wells above the monolayer (nonmigrated cells) and from the bottom wells (migrated cells). Eosinophils that had been incubated in culture medium only were used as controls. Percent eosinophil migration was determined as: (number of migrated eosinophils counted by hemacytometer)/ (total eosinophils added into upper compartment) × 100 (%).

Endothelial Cell Surface Markers

Phycoerythrin (PE)-conjugated or fluorescein isothiocyanate-conjugated mAbs for CD54 (ICAM-1, clone: LB-2, immunoglobulin [Ig] G2b; Becton Dickinson, San Jose, CA), CD62P (P-selectin, clone AC1.2; Becton Dickinson), CD62E (E-selectin, clone 1.2B6; Southern Biotechnology Assoc., Birmingham, AL), CD102 (ICAM-2, clone CBR-IC2/2; Biosource International, Camarillo, CA), and CD106 (VCAM-1, clone 1.61b1; Southern Biotechnology) were purchased for HPMEC adhesion receptor labeling. HPMEC monolayers were incubated with EDTA (10 mM in 25 mM N-2-hydroxyethylpiperazine-N'-ethane sulfonic acid-buffered PBS) for 40 min, collected, washed once with HBSS, and then centrifuged 10 min at 400 × g and 4°C. The cell pellet was resuspended at 1 × 106/ml in fluorescence-activated cell sorter (FACS) buffer (PBS supplemented with 2% bovine serum albumin [BSA] and 0.2% sodium azide). The cells (1 × 105/100 µl) were then incubated on ice with mouse antihuman mAbs for 30 min. Subclass-matched mouse IgGs (Becton Dickinson) were used as isotype controls. After another wash for 10 min at 4°C, 0.5 ml of 4°C FACS buffer was added. The relative mean fluorescence (RMF) was measured on 10,000 cells using a FACScan cytometer and Cell Quest software (Becton Dickinson), and was determined by subtraction of RMF values for the subclass-matched IgG isotype control.

Eosinophil Surface Receptors

Eosinophil surface expression of activation markers CD69, HLA-DR, and CD54 was also determined by flow cytometry. Control, nonmigrated, and migrated eosinophils were collected after the 3-h migration assay and resuspended in 4°C FACS buffer. The cells (1 × 105/100 µl) were then incubated on ice with PE-conjugated mouse antihuman CD69 mAb (clone: L78, IgG1; Becton Dickinson), anti-HLA-DR mAb (clone: L243, IgG2a; Becton Dickinson), or anti-CD54 mAb (clone: LB-2, IgG2b; Becton Dickinson) in the dark for 30 min. PE-conjugated/subclass-matched mouse IgGs (Becton Dickinson) were used as isotype controls. Cells were then washed and resuspended in 4°C FACS buffer, and RMF was measured.

Eosinophil Survival Assay

After the 3-h transmigration incubation, nonmigrated and migrated eosinophils were collected from the upper and lower Transwell compartments, respectively. Eosinophils concurrently incubated for 3 h in culture wells without HPMEC were used as controls. Control, nonmigrated, and migrated eosinophils were washed twice and resuspended (1 to 1.5 × 106/ml) in survival medium (RPMI 1640 supplemented with 1% FCS, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM glutamine). Cells were aliquoted into 96-well flat-bottomed tissue culture plates (Corning, Corning, NY) in triplicate (100 µl/well) and were incubated for 48 h in 5% CO2 at 37°C. Percent in vitro eosinophil survival was determined by dividing the number of viable eosinophils at 48 h by the original number of viable cells placed into the well as measured by trypan blue dye exclusion (3). The negative control consisted of control eosinophils cultured in medium alone, whereas the positive controls had the same cells incubated with 0.1 ng/ml IL-5 or granulocyte macrophage colony-stimulating factor (GM-CSF).

Flow cytometric analysis was also used to determine live, dead, and apoptotic eosinophil populations (24, 25). After a 48-h incubation, control, nonmigrated, and migrated eosinophils were stained with 1 µg/ml Hoechst 33342 (Molecular Probes, Eugene, OR) for 10 min at 37°C. The cells were centrifuged at 400 × g for 5 min and resuspended in PBS with 0.1% BSA to prevent further uptake of the dye. Samples were kept on ice in the dark and were analyzed on a FACStar cytometer (Becton Dickinson) after propidium iodide (PI) staining (2.5 µg/ml; Sigma). The eosinophils were excited using the 352-nm ultraviolet line of a krypton laser and the resultant blue (Hoechst 33342) and red (PI) fluorescence were recorded (10,000 cells). Initial gating was done to exclude cell debris, and the percent population for live, dead, and apoptotic cells was determined on a Hoechst 33342 versus PI contour plot.

Effect of Anticytokine Antibodies on Eosinophil Survival

The possible involvement of known eosinophil survival-enhancing cytokines in the prolonged survival of migrated eosinophils was assessed with anticytokine antibodies. Polyclonal anti-GM-CSF antibody (20 µg/ml, clone: AT02; R&D Systems) and/or anti-IL-5 antibody (20 µg/ml, clone: CP08; R&D Systems) were incubated for 48 h with eosinophils that had migrated across IL-1beta -pretreated HPMECs, and percent survival was determined by trypan blue exclusion. Mouse IgG (Becton Dickinson) was used as an isotype control.

Detection of GM-CSF Messenger RNA by Reverse Transcriptase/Polymerase Chain Reaction

GM-CSF and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) messenger RNA (mRNA) were assessed using a semiquantitative reverse transcriptase/polymerase chain reaction (RT-PCR) as previously described (26). After the 3-h migration assay, migrated, nonmigrated, and control eosinophils were collected. Total eosinophil RNA was extracted from each of these cell pellets (2 × 106 cells for each condition) using a one-step phenol/chloroform extraction reagent (Tri Reagent; Sigma) and reverse transcribed to first-strand complementary DNA (cDNA) using 0.5 mM deoxynucleotide triphosphates (dNTPs), 40 U ribonuclease inhibitor (Life Technologies), 0.5 µg/ml random hexamer primer (Promega, Madison, WI), and 200 U RT (Superscript II; Life Technologies) in a total volume of 100 µl. Transcribed cDNA was amplified by PCR using the following primers (upstream, downstream; Clontech Laboratories Inc., Palo Alto, CA): G3PDH: TGAAGGTCGGAGTCAACGGATTTGGT,CATGTGGGCC ATGAGG-TCCACCAC; GM-CSF: ATGTGGCTGCAGAGCCTGCTGC,CTGGCTCCCAGCAGTCAAAGGG. The first-strand cDNA solution was mixed with 10× reaction buffer, 2.5 mM dNTPs, 25 mM MgCl2, and 2 U Taq polymerase (Promega), and PCR was performed using the following parameters: 94°C denaturation for 45 s, 60°C primer annealing for 45 s, and 72°C primer extension for 2 min. The number of cycles of PCR (24 to 30) was chosen to maintain a linear relationship between mRNA and the PCR products so that quantitative comparisons of PCR products could be obtained (27). The number of PCR cycles was 35 for GM-CSF and 28 for G3PDH. PCR controls included samples containing reagents with no cells, cDNA from a highly positive sample (eosinophils incubated with 1 µM ionomycin), and samples that had not been reverse transcribed. After PCR, 13 µl of the products were resolved on a 1.5% agarose electrophoresis gel and were then transferred to a nylon membrane (Schleicher & Schuell, Keene, NH). Probes were synthesized by amplifying cytokine cDNA with specific primers. After removing primers with spin columns (Millipore, Bedford, MA), Southern blotting was performed using a commercial kit (ECL system; Amersham, Arlington Heights, IL) to verify the identity of PCR products. Because it was difficult to ensure that all samples contained the same amount of RNA, G3PDH mRNA, a housekeeping gene, was measured simultaneously.

Eosinophil Intracellular Oxidative Burst

The oxidative burst of eosinophils as determined by intracellular generation of H2O2 was measured by flow cytometry as previously described (28, 29). Control, nonmigrated, and migrated eosinophils were collected and resuspended in HBSS plus Ca2+. The cells (2 to 2.5 × 105/250 µl) were preincubated with dihydrorhodamine 123 (1 µM; Molecular Probes) for 5 min and then stimulated with either platelet-activating factor (PAF) (0.1 µM), formylmethionyl leucylphenylalanine (FMLP) (0.1 µM), or phorbol myristate acetate (PMA) (1 ng/ml) for 30 min at 37°C. Samples were set on ice while awaiting analysis by FACScan. The eosinophils were excited by an argon laser at 488 nm and emission was measured at 525 nm (FL-1; green fluorescence, 10,000 events). The RMF was determined by subtraction of values for nonstimulated control eosinophils.

Statistics

Data are presented as means ± standard error of the mean, and the groups were analyzed by analysis of variance with repeated measures and Scheffe's constants (AbStat; Anderson-Bell, Corp., Parker, CO). P < 0.05 was considered significant.

    Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Endothelial Cell-Surface Markers

To confirm and expand our previously reported observations on cytokine-stimulated expression of cell surface markers (23), HPMEC monolayers were detached from the tissue culture flasks by EDTA. The cells were stained with mAbs and flow cytometry was used to identify adhesion receptor expression after cytokine treatment (Figure 1). IL-1beta was the strongest inducer of ICAM-1 expression by 4 h, followed by TNF-alpha at 24 h. ICAM-2 had very high expression for both control (no cytokine incubation) and cytokine conditions. Although E-selectin increased modestly with 4 h IL-1beta or TNF-alpha , it was barely present at any other condition. No condition resulted in P-selectin expression. Finally, only incubation for 24 h with TNF-alpha resulted in high levels of VCAM-1 expression on HPMECs.


View larger version (31K):
[in this window]
[in a new window]
  		Figure 1.   The effect of cytokine incubation on HPMEC surface receptor expression. HPMECs were cultured with various cytokines for the noted times. The cells were detached using 10 mM EDTA and then incubated with mAbs to assess cell surface markers (n = 4).

Eosinophil Transendothelial Migration

When HPMEC monolayers were not pretreated with cytokines, only 3.0 ± 0.7% of eosinophils underwent transendothelial migration. In contrast, and similar to our previous reported observations (23), pretreatment of HPMECs with IL-1beta (100 pM, 4 h) significantly increased eosinophil transendothelial migration (IL-1beta : 18.1 ± 2.9% migration, P < 0.005 versus non-cytokine activated HPMECs, n = 7). Pretreatment with TNF-alpha or TNF-alpha plus IL-4 resulted in much lower levels of eosinophil transmigration and were not used in subsequent experiments (data not shown).

Effect of Transendothelial Migration on Eosinophil Surface Receptor Expression

In previous studies and in contrast to peripheral blood eosinophils, sputum and bronchoalveolar lavage (BAL) eosinophils have been shown to express increased levels of activation markers CD69, HLA-DR, and CD54 (3, 5, 6). To determine the effect of transendothelial migration on these surface receptors, nonmigrated and migrated eosinophils were collected from the upper and lower compartments of cytokine-pretreated HPMEC monolayers after the 3-h transmigration incubation. Control cells were not exposed to HPMEC monolayers but were incubated in a test tube for the same time at 37°C. The cells were washed, resuspended in FACS buffer, and labeled for cell surface markers. CD69 expression on migrated eosinophils (53.3 ± 6.6 RMF) was significantly greater than that of nonmigrated eosinophils (33.0 ± 6.2 RMF, P < 0.05, Figure 2A) which, in turn, was higher than control cells (3.5 ± 2.2 RMF, P < 0.0005 versus migrated and P < 0.005 versus nonmigrated eosinophils). Although the values were small, migrated eosinophils (10.3 ± 5.2 RMF) also expressed significantly more HLA-DR than did either control (5.1 ± 5.3 RMF, P < 0.05) or nonmigrated (4.9 ± 5.2 RMF, P < 0.05) eosinophils. Finally, CD54 expression was greater on migrated eosinophils (6.7 ± 2.4 RMF) when compared with control cells (not detected, P < 0.05). A representative FACS histogram of the difference between control and migrated eosinophils for CD69 expression is given in Figure 2B.


View larger version (28K):
[in this window]
[in a new window]
 

View larger version (15K):
[in this window]
[in a new window]
  		Figure 2.   Effect of transendothelial migration on eosinophil surface receptor expression. (A) Nonmigrated, migrated (IL-1beta - treated HPMECs), and control eosinophils were collected after a 3-h migration incubation. Cells were washed and incubated with PE-conjugated mouse antihuman CD69, HLA-DR, or CD54 mAb for 30 min before analysis by flow cytometry. RMF was determined by subtraction of values for subclass-matched IgG control (n = 7). #P < 0.0005, *P < 0.005, +P < 0.05 versus control. (B) Representative histogram of control and migrated eosinophil expression of CD69.

It was possible that the increase in CD69 expression on transmigrated eosinophils was due to the simple exposure to, and crossing of, the Transwell membrane. To determine whether this was a valid possibility, eosinophil chemotaxis through uncoated Transwell membranes when stimulated by 10 nM PAF or RANTES, in the bottom well, was assessed (Figure 3). Similarly, incubation of eosinophils for 3 h with either PAF or RANTES had no effect on surface receptor expression (data not shown). Finally, it is possible that addition of a chemotactic factor to the transmigration assay may have an additional effect on the expression of these surface markers. Therefore, at the initiation of transmigration, 10 nM PAF or RANTES was added to the bottom reaction well. Again, these chemotactic agonists had no effect on eosinophil expression of CD69, CD54, or HLA-DR (Figure 4).


View larger version (26K):
[in this window]
[in a new window]
  		Figure 3.   The effect of chemotaxis on eosinophil surface receptor expression. Eosinophils were added to uncoated Transwell filters and chemotactic PAF or RANTES (10 nM) was added to the bottom well. The plates were incubated for 1 h at 37°C and 5% CO2. The migrated, nonmigrated, and control eosinophils were then assessed by flow cytometry to determine the expression of cell surface receptors (n = 2).


View larger version (22K):
[in this window]
[in a new window]
  		Figure 4.   The effect of chemotactic agonists, present during transmigration, on eosinophil surface receptor expression. Eosinophils were added to confluent monolayers of HPMEC on Transwell filters, and PAF or RANTES (10 nM) was added to the bottom well. After a 3-h incubation, control, nonmigrated, and migrated eosinophils were assessed for expression of cell surface receptors (n = 2).

Effect of Transendothelial Migration on Eosinophil Survival

On the basis of trypan blue dye exclusion, 13.8 ± 1.1% of control eosinophils (not exposed to HPMECs) were viable at 48 h when these cells were incubated in medium alone. As positive controls, the same cells, when cultured for 48 h with either IL-5 or GM-CSF (0.1 ng/ml), had 63.1 ± 4.9% and 67.3 ± 5.7% survival, respectively.

Nonmigrated and migrated eosinophils were collected from the upper and lower compartments of IL-1beta -pretreated HPMEC monolayers after the 3-h migration incubation. The cells were washed, placed into survival medium, and cultured for 48 h. The absence of HPMEC contamination in the eosinophil populations was confirmed by Diff-Quik staining of cytospin preparations. After 48 h, in vitro survival of migrated eosinophils was significantly increased over their corresponding nonmigrated and control eosinophils (Figure 5; for IL-1beta -pretreated HPMEC: 36.9 ± 2.3% survival for migrated eosinophils, P < 0.001 versus control and nonmigrated cells; 22.4 ± 2.3% for nonmigrated cells, P < 0.005 versus control and migrated cells). Similar results were observed when HPMEC monolayers were grown on collagen- rather than fibronectin-coated Transwell filters, suggesting that enhanced survival was not fibronectin-dependent (data not shown).


View larger version (41K):
[in this window]
[in a new window]
  		Figure 5.   Effect of transendothelial migration on 48-h in vitro eosinophil survival. IL-1beta -pretreated HPMEC monolayers were washed and then eosinophils were put in the upper compartment. After a 3-h transmigration incubation, control, nonmigrated, and migrated eosinophils were collected. Cells were washed and cultured and the percent 48-h eosinophil survival was determined by trypan blue dye exclusion (n = 7). *P < 0.0001 versus control and nonmigrated eosinophils; #P < 0.005 versus control.

To confirm these observations, flow cytometric analysis was used to determine the proportion of viable, dead, and apoptotic eosinophils after culture for 48 h after transendothelial migration. After a 3-h incubation with IL-1beta - activated HPMECs, nonmigrated, migrated, and control eosinophils were collected, washed, and incubated in survival medium for 48 h. Cells were then stained with PI and Hoechst 33342 to discriminate dead (PI-positive, Hoechst-negative), apoptotic (PI-negative, bright Hoechst-positive), and viable cells (PI-negative, dim Hoechst-positive; Figure 6A), and confirmed with negative (medium alone) and positive (0.1 ng/ml IL-5 or GM-CSF added to the culture; data not shown) control eosinophil cultures. The percent of viable cells was significantly greater in migrated eosinophils compared with control and nonmigrated cells (5.7 ± 1.1% viable of control, 16.3 ± 3.2% of nonmigrated, and 38.7 ± 8.3% of migrated cells; P < 0.05 for migrated versus control and nonmigrated eosinophils; Figure 6B). The converse relationship was reflected in the populations of dead eosinophils (control: 80.1 ± 4.2% nonviable; nonmigrated: 68.4 ± 3.8%; migrated: 45.1 ± 6.1%; P < 0.05, migrated versus control and nonmigrated). However, there were no significant differences with respect to the level of apoptotic cells among the three eosinophil populations.


View larger version (38K):
[in this window]
[in a new window]
  		Figure 6.   The 48-h eosinophil survival as determined by flow cytometry. After the 3-h migration assay, nonmigrated, migrated (IL-1beta -pretreated HPMECs), and control eosinophils were washed and incubated for 48 h in survival medium. (A) Cells were then stained with Hoechst 33342 (blue fluorescence) and PI (red fluorescence) to identify viable, dead, and apoptotic cell populations (representative of four experiments). (B) Percent eosinophil populations of viable, dead, and apoptotic cells were determined in control, nonmigrated, and migrated eosinophils (n = 4). *P < 0.05 versus control and nonmigrated eosinophils.

Eosinophils have enhanced survival when cocultured with conditioned medium from cytokine-stimulated endothelial cells (30, 31). To determine whether soluble factors released from cytokine-pretreated HPMECs during our migration assay were the mechanism of increased 48-h eosinophil survival, freshly isolated eosinophils were incubated for 3 h in the lower Transwell chamber, separated from the IL-1beta -treated HPMEC monolayer by the 3-µm filter. The eosinophils were then collected and cultured for an additional 48 h in survival medium. Viability was determined for these cells by Hoechst 33342/PI staining and flow cytometry. Under these conditions, the percentage of viable eosinophils (19.3 ± 1.9%, n = 3) was equivalent to that of nonmigrated cells (16.3 ± 3.2%) cultured above the HPMEC layer, suggesting that whereas soluble factors from cytokine-activated HPMECs can prolong eosinophil viability, additional mediators such as cell-cell interaction via transmigration may be necessary for the increased survival of migrated eosinophils.

Effect of Anticytokine Antibodies on Survival of Migrated Eosinophils

To assess the possible involvement of eosinophil survival- enhancing cytokines IL-5 and GM-CSF (32) in prolonging survival of migrated eosinophils, we determined the effect of anti-GM-CSF and/or anti-IL-5 antibodies added to either the 3-h transmigration or the 48-h survival assay. Addition of either or both cytokine antibodies to the 3-h migration assay had no effect on subsequent eosinophil survival (data not shown). The increased survival of migrated eosinophils was inhibited (to the level of nonmigrated cell survival) only when anti-GM-CSF was included in the 48-h survival culture (P < 0.05 for anti-GM-CSF versus no antibody or IgG control; Figure 7). In contrast, addition of anti-IL-5 had no effect on 48-h migrated eosinophil survival. Further, adding both anti-IL-5 and anti-GM-CSF had no further inhibitory effect on the survival of migrated eosinophils than did anti-GM-CSF alone.


View larger version (34K):
[in this window]
[in a new window]
  		Figure 7.   Effect of cytokine antibodies on prolonged survival of migrated eosinophils. After a 3-h migration across IL-1beta -pretreated HPMECs, eosinophils were washed and incubated for 48 h with anti-GM-CSF and/or anti-IL-5 mAb in survival medium; mouse IgG was used as an isotype control. The percent eosinophil survival was determined by trypan blue dye exclusion (n = 5). *P < 0.05 versus no antibody or IgG control.

mRNA for GM-CSF

Although a specific enzyme immunoassay (EIA) was used to determine the levels of GM-CSF protein in the 48-h survival culture supernates, the results were below our assay's level of detection, 3 pg/ml. Therefore, as an alternate assessment of GM-CSF, we measured eosinophil expression of GM-CSF mRNA to assess the possible role of autocrine generation of this cytokine in prolonged survival of migrated eosinophils. Nonmigrated, migrated (across IL-1beta - treated HPMEC), and control eosinophils were collected after a 3-h transmigration incubation; total mRNA was immediately extracted and underwent RT-PCR using GM-CSF primers. In control eosinophils, GM-CSF mRNA was not expressed in any of the three eosinophil subjects studied (Figure 8). In contrast, GM-CSF mRNA was expressed in the nonmigrated eosinophils in three out of three subjects and in migrated eosinophils in two out of three subjects (Subjects 1 and 2). G3PDH mRNA, a housekeeping gene, was expressed to a similar degree in all samples.


View larger version (42K):
[in this window]
[in a new window]
  		Figure 8.   GM-CSF mRNA expression was determined by RT-PCR. Total cellular RNA was extracted from nonmigrated, migrated (across IL-1beta -treated HPMECs), and control eosinophils immediately after the 3-h transmigration assay. RNA was reverse transcribed to the first-strand cDNA, and PCR was performed using GM-CSF primers. PCR products were processed by Southern blotting and the blot was hybridized and developed using a chemiluminescence detection kit. G3PDH mRNA levels were similar for all cell preparations.

GM-CSF has been reported to increase the expression of CD69 and HLA-DR on eosinophils (6, 35). To eliminate the possibility that our observations of elevated cell surface receptors on nonmigrated and migrated eosinophils were the result of eosinophil/HPMEC-secreted GM-CSF, eosinophils were incubated 3 h (the same time frame as the transmigration assay) with varying concentrations of GM-CSF, followed by measurement of cell markers. Although increasing concentrations of GM-CSF did increase the expression of CD69, the levels reached after a 3-h incubation required high concentrations of GM-CSF and even then did not result in increased CD69 levels as observed with transmigrated eosinophils (Figure 9). GM-CSF incubation under these conditions had no effect on CD54 and HLA-DR.


View larger version (12K):
[in this window]
[in a new window]
  		Figure 9.   The effect of GM-CSF on eosinophil surface receptor expression. Eosinophils were incubated with increasing concentrations of GM-CSF for 3 h at 37°C and 5% CO2. The cells were then labeled for flow cytometry to determine expression of cell surface receptors.

Effect of Transendothelial Migration on Eosinophil Oxidative Burst

Eosinophil adhesion to endothelial cells has been proposed to be one of the mechanisms by which eosinophils are primed for increased O2- generation (16, 36). To extend this finding, we determined the effect of transendothelial migration on the eosinophil's intracellular oxidative burst using flow cytometry. This assay required smaller numbers of cells than the conventional superoxide dismutase-inhabitable cytochrome C reduction assay (37) but resulted in the same relative activation (Yamamoto, unpublished results). Nonmigrated, migrated (through IL-1beta -treated HPMEC), and control eosinophils were collected and then stimulated with PAF (0.1 µM), FMLP (0.1 µM), or PMA (1 ng/ml) for 30 min. The eosinophil oxidative burst induced by these agonists, determined as intracellular generation of H2O2, was significantly increased in both nonmigrated and migrated eosinophils compared with control cells (P < 0.05, Figure 10). However, no significant difference in eosinophil intracellular oxidative burst between nonmigrated and migrated cells was detected.


View larger version (34K):
[in this window]
[in a new window]
  		Figure 10.   Effect of transendothelial migration on eosinophil intracellular oxidative burst. Nonmigrated, migrated (IL-1beta -treated HPMECs), and control eosinophils were collected after migration. The cells were preincubated for 5 min with dihydrorhodamine 123 and then stimulated by 0.1 µM PAF, 0.1 µM FMLP, or 1 ng/ ml PMA for 30 min. Intracellular generation of H2O2 (green fluorescence) was measured by flow cytometry. Fluorescence for nonstimulated control eosinophils were subtracted from all samples and results are expressed as RMF (n = 5). *P < 0.05 versus control.

    Discussion
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Using confluent HPMEC monolayers as a model of in vivo pulmonary vasculature, we determined the effect of transendothelial migration on several eosinophil functions: cell surface marker expression, in vitro survival, and oxidative burst. Interaction with, versus migration through, IL-1beta - activated HPMECs resulted in selective alteration of eosinophil function. Although the HPMECs used in these experiments are not primary pulmonary, small-vessel endothelial cells, they are classified as microvascular pulmonary endothelial cells, and thus have more relevance to this study than if HUVECs were used. The ability to obtain a consistent supply of unpassaged pulmonary endothelial cells is currently possible in a bovine model, but these studies have primarily used bovine pulmonary artery endothelial cells (38). Moreover, these cells have demonstrated species-specific differences from human cells (42). Therefore, the Clonetics low-passaged HPMECs provide the best current cell source for these endothelial cell studies.

Expression of cytokine-activated endothelial cell surface receptors vary with the type and source of the vascular endothelium (43). HPMECs are a relatively new type of endothelial cells available for culture and activation in vitro. Therefore, we expanded our previous study on cytokine-activated HPMEC cell surface adhesion molecules (23). No expression of P-selectin was observed with any of the cytokine treatments of HPMECs, whereas high levels of ICAM-2 were present under all conditions. E-selectin expression was stimulated by 4-h activation with IL-1beta or TNF-alpha but had returned to baseline levels by 24 h. Maximal expression of ICAM-1 followed HPMEC incubation for 4 h with 100 pM IL-1beta or 24 h with TNF-alpha . In contrast, only 24-h activation of HPMECs with TNF-alpha resulted in high expression of VCAM-1. As previously reported, eosinophil-VCAM-1 interaction (HPMECs plus TNF-alpha plus IL-4) resulted in high cell adhesion whereas interaction with ICAM-1 (HPMECs plus IL-1beta ) yielded increased transendothelial migration (23). In the current studies, TNF-alpha activation of HPMECs resulted in much smaller changes in eosinophil cell surface expression of markers, as well as lower survival and oxidant production (data not shown).

Changes in eosinophil surface receptors may have important effects on this cell's role in asthma and allergic disease. Airway eosinophils collected by BAL 48 h after segmental bronchoprovacation with allergen have significant increases in CD69, CD54 and HLA-DR (3). It has also been proposed that airway eosinophils have the capacity to interact with other leukocytes, specifically lymphocytes, as antigen-presenting cells via their expression of ICAM-1 (CD54) and HLA-DR (44). Walsh and colleagues (45) have reported that ligation of CD69 promotes cell apoptosis. Therefore, the increase in these cell receptors may be very important to the activation and regulation of eosinophils in airway inflammation. Our study reveals that transendothelial migration across IL-1beta -pretreated HPMECs stimulates the expression of CD69, HLA-DR, and CD54 on eosinophils. This may be one mechanism for the change of the eosinophil phenotype as the cell migrates from blood to airway cells. In contrast to our observations, Walker and associates (21) failed to find HLA-DR and CD54 expression on eosinophils that had migrated across IL-1beta -treated HUVECs. One possible explanation for this discrepancy is the different source of endothelial cells. For example, HUVECs, macrovascular endothelial cells, are different from pulmonary microvascular endothelial cells with respect to kinetics of adhesion molecule expression and other biologic properties (46, 47).

The increased expression of CD69, CD54, and HLA-DR on transmigrated eosinophils was not due to the mechanical passage of the eosinophils through the Transwell membrane. Using chemotactic factors PAF and RANTES, with no HPMEC monolayer on the filter, eosinophils showed no increase in any of the examined surface receptors on either the nonmigrated or migrated cells. These same chemotactic factors also did not effect the levels of CD54, HLA-DR, or CD69 when they were included in the transendothelial migration assay. Finally, separating the eosinophils from the HPMEC monolayers by a filter failed to alter eosinophil surface markers. This strongly suggests that the markers are first increased by cell-cell interaction with IL-1beta -pretreated HPMECs and further increased by the process of transmigration. Therefore, the process of eosinophils migrating through the inflammatory vascular endothelium into the interstial matrix may be one mechanism to increase these important cell markers. It is very likely that other in vivo inflammatory mediators participate in the generation of airway eosinophils.

As another measure of eosinophil function, we examined 48-h in vitro survival of eosinophils that had migrated across cytokine-pretreated HPMEC monolayers compared with nonmigrated and control cells. Assessment of survival by both trypan blue dye exclusion and flow cytometry revealed that eosinophils survived significantly longer after transendothelial migration. Interestingly, interaction of eosinophils with IL-1beta -activated HPMECs also resulted in a significant increase in survival of nonmigrated eosinophils over control cells, but not as great as that observed for migrated cells. Similar to our findings for increased expression of CD69, it also appears that interaction of eosinophils with IL-1beta -pretreated HPMECs resulted in functional changes in both nonmigrated and migrated eosinophils; however, transmigrated cells were again further enhanced.

It has been reported that activated eosinophils and endothelial cells synthesize and secrete a wide array of inflammatory cytokines (48); among these cytokines, GM-CSF (potentially produced by both eosinophils and endothelial cells) and IL-5 (by eosinophils) are established to promote eosinophil survival (32). Moreover, coculture of eosinophils with conditioned medium from endothelial cells prolongs the viability of eosinophils through endothelial generation of GM-CSF (30, 31, 51). Therefore, to clarify the possible involvement of eosinophil-active cytokines in prolonged survival of migrated eosinophils, the effect of anticytokine antibodies was examined in this response. First, anti-GM-CSF or anti-IL-5 was added to the 3-h migration culture, the eosinophils were collected and washed, and eosinophil survival was determined 48 h later. Neither antibody affected the increase in survival of either migrated or nonmigrated eosinophils, suggesting that the production and/or the release of these cytokines during the migration assay were not involved in the later cell survival (data not shown). Second, these antibodies were added to the migrated eosinophils in the 48-h survival incubation. Under these conditions, addition of anti-GM-CSF but not anti-IL-5 reduced survival of migrated eosinophils to the level of nonmigrated cells (Figure 4). Although the participation of other cytokines, such as IL-3, remain to be defined, our results suggest that at least GM-CSF is involved in the prolonged survival of migrated eosinophils and is required during the 48-h survival culture. HPMECs were concluded not to be the cell source of GM-CSF during the 48-h culture because they were absent from the migrated eosinophil population as confirmed by cytocentrifuge slides prepared of the transmigrated cells after the 3-h migration.

To confirm that GM-CSF was being generated by the migrated eosinophils during the 48-h culture, we attempted to measure levels of released GM-CSF protein by enzyme-linked imunosorbent assay; however, the experimental values fell below the assay's detection level (3 pg/ml). Therefore, we measured eosinophil expression of GM-CSF mRNA using RT-PCR. GM-CSF mRNA was expressed in migrated eosinophils, but not in control eosinophils, for two out of three study subjects. This finding is consistent with a report by Sullivan and Broide (52) in which eosinophil GM-CSF mRNA expression was compartmentalized to the lungs, as opposed to blood. Unexpectedly, GM-CSF mRNA was also expressed by nonmigrated eosinophils from all three subjects. This contradicts our hypothesis that transmigration of eosinophils results in the autoproduction of GM-CSF which then prolongs cell survival. However, expression of GM-CSF mRNA does not necessarily reflect the production and/or release of this cytokine. It is possible that only transmigrated eosinophils are capable of generating bioactive GM-CSF protein whereas nonmigrated eosinophils can produce only the mRNA. The stability of the eosinophil's GM-CSF mRNA, its transcription, and the translation and release of the protein may be sufficient only after transendothelial migration.

The enhancement of in vitro survival by migrated eosinophils was modest when compared with previous reports; eosinophils retrieved from airways or nasal polyps survived three or four times longer than blood eosinophils (3, 53). However, in contrast to our in vitro model, eosinophils which migrate across the in vivo microvasculature are also exposed to multiple extracellular matrix proteins and a wide array of inflammatory cytokines and cells during recruitment to airway lumen. Extracellular matrix proteins such as cellular fibronectin and laminin have been shown to prolong eosinophil survival through the autocrine generation of GM-CSF, IL-5, and IL-3 (54). Epithelial cells also have the capacity to generate GM-CSF (58). Further, eosinophil survival-promoting cytokines released by inflammatory cells such as T lymphocytes and mast cells are detected in the airways of allergic patients (59). Thus, after in vivo transendothelial migration, eosinophils may survive even longer in the airways due to the effects of multiple factors, including transmigration.

Autocrine generation of GM-CSF also could be a factor not only in eosinophil survival but also in the increased expression of CD69 and HLA-DR. Incubation of eosinophils with GM-CSF has been reported to increase the cell's expression of CD69 and HLA-DR; however, longer incubation times than the 3-h transmigration in our experiments were required (6, 35). To test this possibility, increasing concentrations of GM-CSF (1 to 1,000 pg/ml) were incubated for 3 h with eosinophils and then levels of CD69, HLA-DR, and CD54 were measured. Although high concentrations of GM-CSF (30 to 1,000 pg/ml) slightly increased CD69 expression, the increase was still less than that observed with transmigration and well within the detectable range of the GM-CSF EIA. Therefore, the increase in eosinophil expression of CD69, CD54, and HLA-DR appears to be due to the cells' interaction with and migration through HPMEC monolayers rather than to the generation of autocrine GM-CSF.

Eosinophil adhesion to endothelial cell adhesion proteins increases eosinophil generation of O2- and other potent oxygen metabolites (16, 17, 36, 62). To extend this finding, we also assessed the effect of transendothelial migration on the eosinophil's oxidative burst. Due to the limited number of migrated eosinophils, flow cytometric analysis of intracellular H2O2 was used instead of the more conventional measurement of extracellular O2- by the superoxide dismutase-inhibitable reduction of cytochrome C (3). The eosinophil oxidative burst induced by PAF, FMLP, and PMA, as determined by intracellular generation of H2O2, was significantly and equivalently increased in both nonmigrated and migrated eosinophils, suggesting that transmigration had no additional effect. Similarly, Walker and coworkers (21) reported that the zymosan-induced eosinophil extracellular oxidative burst was increased in both nonmigrated and migrated eosinophils after transmigration across IL-1beta -pretreated HUVECs. Therefore, even using different endothelial cell types and eosinophil agonists, both studies found that the exposure of eosinophils to IL-1beta -activated endothelial cells was sufficient to upregulate the cell's oxidative activity.

In conclusion, this study suggests that eosinophils undergo an upregulation in specific functions during recruitment through the endothelial microvasculture. However, it does not appear that transmigration across IL-1beta -activated endothelial cell monolayers is necessary for all of the changes in eosinophil function. Direct interaction of eosinophils with cytokine-activated HPMECs increased the cells' oxidative metabolism and, at least partially, increased CD69 expression and in vitro survival. In contrast, transendothelial migration further enhanced HPMECs' effects on cell marker expression and survival leading to the upregulation and prolongation of these eosinophil function. Therefore, our results suggest that the eosinophil phenotype is determined not only by cell adhesion to but also by transmigration across pulmonary microvasculature. The upregulation of these eosinophil functions may have physiologic importance in the eosinophils' accumulation and participation in inflammation in the airways of diseases such as asthma.

    Footnotes

Abbreviations: complementary DNA, cDNA; ethylenediaminetetraacetic acid, EDTA; fluorescence-activated cell sorter, FACS; glyceraldehyde-3-phosphate dehydrogenase, G3PDH; granulocyte macrophage colony-stimulating factor, GM-CSF; Hanks' balanced salt solution, HBSS; human leukocyte-associated antigen-DR, HLA-DR; human pulmonary microvascular endothelial cell, HPMEC; human umbilical vein endothelial cell, HUVEC; intercellular adhesion molecule, ICAM; immunoglobulin, Ig; interleukin, IL; monoclonal antibody, mAb; messenger RNA, mRNA; superoxide anion, O2-; platelet-activating factor, PAF; phosphate-buffered saline, PBS; phycoerythrin, PE; propidium iodide, PI; phorbol myristate acetate, PMA; regulated on activation, normal T cells expressed and secreted, RANTES; relative mean fluorescence, RMF; reverse transcriptase/polymerase chain reaction, RT-PCR; tumor necrosis factor, TNF; vascular cell adhesion molecule, VCAM.

(Received in original form February 22, 1999 and in revised form April 28, 2000).

Acknowledgments: This work was supported by NIH AI23181.
    References
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Beasley, R., W. R. Roche, J. A. Roberts, and S. T. Holgate. 1989. Cellular events in the bronchi in mild asthma and after bronchial provocation. Am. Rev. Respir. Dis. 139: 806-817 [Medline].

2. Bousquet, J., P. Chanez, J. Y. Lacoste, G. Barnéon, N. Ghavanian, I. Enander, P. Venge, S. Ahlstedt, J. Simony-Lafontaine, P. Godard, and F. B. Michel. 1990. Eosinophilic inflammation in asthma. N. Engl. J. Med. 323: 1033-1039 [Abstract].

3. Sedgwick, J. B., W. J. Calhoun, R. F. Vrtis, M. B. Bates, P. K. McAllister, and W. W. Busse. 1992. Comparison of airway and blood eosinophil function after in vivo antigen challenge. J. Immunol. 149: 3710-3718 [Abstract].

4. Georas, S. N., M. C. Liu, W. Newman, L. D. Beall, B. A. Stealy, and B. S. Bochner. 1992. Altered adhesion molecule expression and endothelial cell activation accompany the recruitment of human granulocytes to the lung after segmental antigen challenge. Am. J. Respir. Cell Mol. Biol. 7: 261-269 .

5. Mengelers, H. J., T. Maikoe, L. Brinkman, B. Hooibrink, J. J. Lammers, and L. Koenderman. 1994. Immunophenotyping of eosinophils recovered from blood and BAL of allergic asthmatic. Am. J. Respir. Crit. Care Med. 149: 345-351 [Abstract].

6. Hartnell, A., D. S. Robinson, A. B. Kay, and A. J. Wardlaw. 1993. CD69 is expressed by human eosinophils activated in vivo in asthma and in vitro by cytokines. Immunology 80: 281-286 [Medline].

7. Dobrina, A., R. Menegazzi, T. M. Carlos, E. Nardon, R. Cramer, T. Zacchi, J. M. Harlan, and P. Patriarca. 1991. Mechanisms of eosinophil adherence to cultured vascular endothelial cells: eosinophils bind to the cytokine-induced ligand vascular cell adhesion molecule-1 via the very late activation antigen-4 integrin receptor. J. Clin. Invest. 88: 20-26 .

8. Walsh, G. M., J. J. Mermod, A. Hartnell, A. B. Kay, and A. J. Wardlaw. 1991. Human eosinophil, but not neutrophil, adherence to IL-1-stimulated human umbilical vascular endothelial cells is alpha 4 beta 1 (very late antigen-4) dependent. J. Immunol. 146: 3419-3423 [Abstract].

9. Bochner, B. S., F. W. Luscinskas, M. A. Gimbrone Jr., W. Newman, S. A. Sterbinsky, C. P. Derse-Anthony, D. Klunk, and R. P. Schleimer. 1991. Adhesion of human basophils, eosinophils, and neutrophils to interleukin 1-activated human vascular endothelial cells: contribution of endothelial cells adhesion molecules. J. Exp. Med. 173: 1553-1556 [Abstract/Free Full Text].

10. Weller, P. F., T. H. Rand, S. E. Goelz, G. Chi-Rosso, and R. R. Lobb. 1991. Human eosinophil adherence to vascular endothelium mediated by binding to vascular cell adhesion molecule 1 and endothelial leukocyte adhesion molecule 1.  Proc. Natl. Acad. Sci. USA 88: 7430-7433 [Abstract/Free Full Text].

11. Mosher, R., J. Fehr, L. Olgiati, and P. L. Bruijnzeel. 1992. Migration of primed human eosinophils across cytokine-activated endothelial cell monolayers. Blood 79: 2937-2945 [Abstract/Free Full Text].

12. Ebisawa, M., B. S. Bochner, S. N. Georas, and R. P. Schleimer. 1992. Eosinophil transendothelial migration induced by cytokines: I. Role of endothelial and eosinophil adhesion molecules in IL-1 beta-induced transendothelial migration. J. Immunol. 149: 4021-4028 [Abstract].

13. Carlos, T. M., and J. M. Harlan. 1994. Leukocyte-endothelial adhesion molecules. Blood 84: 2068-2101 [Abstract/Free Full Text].

14. Walsh, G. M., F. A. Symon, A. I. Lazarovits, and A. J. Wardlaw. 1996. Integrin alpha 4beta 7 mediates human eosinophil interaction with MAdCAM-1, VCAM-1 and fibronectin. Immunology 89: 112-119 [Medline].

15. Horie, S., and H. Kita. 1994. CD11b/CD18 (Mac-1) is required for degranulation of human eosinophils induced by human recombinant granulocyte-macrophage colony-stimulating factor and platelet activating factor. J. Immunol. 152: 5457-5467 [Abstract].

16. Nagata, M., J. B. Sedgwick, M. E. Bates, H. Kita, and W. W. Busse. 1995. Eosinophil adhesion to VCAM-1 activates superoxide anion generation. J. Immunol. 155: 2194-2202 [Abstract].

17. Chihara, J., T. Kakazu, I. Higashimoto, T. Yamamoto, D. Kurachi, and S. Nakajima. 1995. Increased eosinophil oxidative metabolism by treatment with soluble intercellular adhesion molecule-1. Int. Arch. Allergy Immunol. 108: 45-47 .

18. Chihara, J., T. Yamamoto, D. Kurachi, T. Kakazu, I. Higashimoto, and S. Nakajima. 1995. Possible release of eosinophil granule proteins in response to signaling from intercellular adhesion molecule-1 and its ligands. Int. Arch. Allergy Immunol. 108: 52-54 .

19. Adams, D. H., and S. Shaw. 1994. Leucocyte-endothelial interactions and regulation of leucocyte migration. Lancet 343: 831-836 [Medline].

20. Djukanovic, R., J. W. Wilson, K. M. Britten, S. J. Wilson, A. F. Walls, W. R. Roche, P. H. Howarth, and S. T. Holgate. 1990. Quantitation of mast cells and eosinophils in the bronchial mucosa of symptomatic atopic asthmatics and healthy control subjects using immunohistochemistry. Am. Rev. Respir. Dis. 142: 863-871 [Medline].

21. Walker, C., S. Rihs, R. K. Braun, S. Betz, and P. L. Bruijnzeel. 1993. Increased expression of CD11b and functional changes in eosinophils after migration across endothelial cell monolayers. J. Immunol. 150: 4061-4071 [Abstract].

22. Shen, J., R. G. Ham, and S. Karmiol. 1998. Expression of adhesion molecules in cultured human pulmonary microvascular endothelial cells. Microvas. Res. 50: 360-372 .

23. Yamamoto, H., J. B. Sedgwick, and W. W. Busse. 1998. Differential regulation of eosinophil adhesion and transmigration by pulmonary microvascular endothelial cells. J. Immunol. 161: 971-977 [Abstract/Free Full Text].

24. Dive, C., C. D. Gregory, D. J. Phipps, D. L. Evans, A. E. Milner, and A. H. Wyllie. 1992. Analysis and discrimination of necrosis and apoptosis (programmed cell death) by multiparameter flow cytometry. Biochim. Biophys. Acta 1133: 275-285 [Medline].

25. Sun, X. M., R. T. Snowden, D. N. Skilleter, D. Dinsdale, M. G. Ormerod, and G. M. Cohen. 1992. A flow-cytometric method for the separation and quantitation of normal and apoptotic thymocytes. Anal. Biochem. 204: 351-356 [Medline].

26. Gern, J. E., R. Vrtis, E. A. Kelly, E. C. Dick, and W. W. Busse. 1996. Rhinovirus produces nonspecific activation of lymphocytes through a monocyte-dependent mechanism. J. Immunol. 157: 1605-1612 [Abstract].

27. Wynn, T. A., I. P. Oswald, I. A. Eltoum, P. Caspar, C. J. Lowenstein, F. A. Lewis, S. P. James, and A. L. Sher. 1994. Elevated expression of Th1 cytokines and nitric oxide synthase in the lungs of vaccinated mice after challenge with Shistosoma mansoni. J. Immunol. 153: 5200-5209 [Abstract].

28. Rothe, G., A. Emmendorffer, A. Oser, J. Roesler, and G. Valet. 1991. Flow cytometric measurement of the respiratory burst activity of phagocytes using dihydrorhodamine. J. Immunol. Meth. 138: 133-135 [Medline].

29. Elsner, J., S. Dichmann, and A. Kapp. 1995. Activation of the respiratory burst in human eosinophils by chemotaxins requires intracellular calcium fluxes. J. Invest. Dermatol. 105: 231-236 [Medline].

30. Lamas, A. M., G. S. Marcotte, and R. P. Schleimer. 1989. Human endothelial cells prolong eosinophil survival: regulation by cytokines and glucocorticoids. J. Immunol. 142: 3978-3984 [Abstract].

31. Rothenberg, M. E., W. F. Owen, D. S. Silberstein, R. J. Soberman, K. F. Austen, and R. L. Stevens. 1987. Eosinophils cocultured with endothelial cells have increased survival and functional properties. Science 237: 645-647 [Abstract/Free Full Text].

32. Owen, W. F. Jr., M. E. Rothenberg, D. S. Silberstein, J. C. Gasson, R. L. Stevens, K. F. Austen, and R. J. Soberman. 1987. Regulation of human eosinophil viability, density, and function by granulocyte/macrophage colony-stimulating factor in the presence of 3T3 fibroblasts. J. Exp. Med. 166: 129-141 [Abstract/Free Full Text].

33. Lopez, A. F., C. J. Sanderson, J. R. Gamble, H. D. Campbell, I. G. Young, and M. A. Vadas. 1988. Recombinant human interleukin 5 is a selective activator of human eosinophil function. J. Exp. Med. 167: 219-224 [Abstract/Free Full Text].

34. Rothenberg, M. E., W. F. Owen Jr., D. S. Silberstein, J. Woods, R. J. Soberman, K. F. Austen, and R. L. Stevens. 1988. Human eosinophils have prolonged survival, enhanced functional properties, and become hypodense when exposed to human interleukin 3.  J. Clin. Invest. 81: 1986-1992 .

35. Luttmann, W., P. Franz, S. Schmidt, J. Barth, H. Matthys, and C. Virchow. 1998. Inhibition of HLA-DR expression on activated human eosinophils by transforming growth factor-beta1. Scand. J. Immunol. 48: 667-671 [Medline].

36. Nagata, M., J. B. Sedgwick, R. Vrtis, and W. W. Busse. 1998. Endothelial cells upregulate eosinophil superoxide generation via VCAM-1 expression. Clin. Exp. Allergy 29: 550-561 .

37. Sedgwick, J. B., R. F. Vrtis, M. F. Gourley, and W. W. Busse. 1988. Stimulus-dependent differences in superoxide anion generation by normal human eosinophils and neutrophils. J. Allergy Clin. Immunol. 81: 876-883 [Medline].

38. Garcia, J. G. N., A. D. Verin, M. Herenyiova, and D. English. 1998. Adherent neutrophils activate endothelial myosin light chain kinase: role in transendothelial migration. J. Appl. Physiol. 84: 1817-1821 [Abstract/Free Full Text].

39. Zhao, Y., and H. W. Davis. 1998. Hydrogen peroxide-induced cytoskeletal rearrangment in cultured pulmonary endothelial cells. J. Cell. Physiol. 174: 370-379 [Medline].

40. Garcia, J. G., K. L. Schaphorst, A. D. Verin, C. M. Hart, K. S. Callahan, and C. E. Patterson. 1997. Mechanisms of ionomycin-induced endothelial cell barrier dysfunction. Am. J. Physiol. 273: L172-L184 [Abstract/Free Full Text].

41. Kiguchi, T., K. Takahashi, Y. Uwabe, H. Nakamura, K. Kashiwabara, H. Yagyu, and T. Matsuoka. 1997. Subthreshold hyperoxia potentiates TNF-alpha-induced ICAM-1 expression on cultured pulmonary microvascular endothelial cells. Exp. Lung Res. 23: 191-204 [Medline].

42. Weidermann, C. J., P. Schratzberger, S. Dunzendorfer, S. Kiechi, N. Reinsch, C. M. Kahler, and J. Willeit. 1997. Human and bovine endothelial cell monolayers are differentially activated for neutrophil transmigration by human plasma. Ann. NY Acad. Sci. 832: 135-146 [Abstract/Free Full Text].

43. Kanda, K., G. T. Hayman, M. D. Silverman, and P. I. Lelkes. 1998. Comparison of ICAM-1 and VCAM-1 expression in various human endothelial cell types and smooth muscle cells. Endothelium 6: 33-44 [Medline].

44. Hansel, T. T., J. B. Braunstein, C. Walker, K. Blaser, P. L. Bruijnzeel, J. C. Virchow Jr., and C. Virchow. 1991. Sputum eosinophils from asthmatics express ICAM-1 and HLA-DR. Clin. Exp. Immunol. 86: 271-277 [Medline].

45. Walsh, G. M., M. L. Williamson, F. A. Symon, G. B. Willars, and A. J. Wardlaw. 1996. Ligation of CD69 induces apoptosis and cell death in human eosinophils cultured with granulocyte-macrophage colony-stimulating factor. Blood 87: 2815-2821 [Abstract/Free Full Text].

46. Swerlick, R. A., K. H. Lee, L. J. Li, N. T. Sepp, S. W. Caughman, and T. J. Lawley. 1992. Regulation of vascular cell adhesion molecule 1 on human dermal microvascular endothelial cells. J. Immunol. 149: 698-705 [Abstract].

47. Carley, W. W., M. J. Niedbala, and M. E. Gerritsen. 1992. Isolation, cultivation, and partial characterization of microvascular endothelium derived from human lung. Am. J. Respir. Cell Mol. Biol. 7: 620-630 .

48. Moqbel, R., Q. Hamid, S. Ying, J. Barkans, A. Hartnell, A. Tsicopoulos, A. J. Wardlaw, and A. B. Kay. 1991. Expression of mRNA and immunoreactivity for the granulocyte/macrophage colony-stimulating factor in activated human eosinophils. J. Exp. Med. 174: 749-752 [Abstract/Free Full Text].

49. Broide, D. H., M. M. Paine, and G. S. Firestein. 1992. Eosinophils express interleukin 5 and granulocyte macrophage-colony stimulating factor mRNA at sites of allergic inflammation in asthmatics. J. Clin. Invest. 90: 1414-1424 .

50. Kita, H.. 1996. The eosinophil: a cytokine-producing cell. J. Allergy Clin. Immunol. 97: 889-892 [Medline].

51. Sieff, C. A., S. Tsai, and D. S. Faller. 1987. Interleukin 1 induces cultured human endothelial cell production of granulocyte-macrophage colony-stimulating factor. J. Clin. Invest. 79: 48-51 .

52. Sullivan, S., and D. H. Broide. 1996. Compartmentalization of eosinophil granulocyte-macrophage colony-stimulating factor expression in patients with asthma. J. Allergy Clin. Immunol. 97: 966-976 [Medline].

53. Ramis, I., S. Finotto, J. Dolovich, J. Marshall, and M. Jordana. 1995. Increased survival of nasal polyp eosinophils. Immunol. Lett. 45: 219-221 [Medline].

54. Anwar, A. R., R. Moqbel, G. M. Walsh, A. B. Kay, and A. J. Wardlaw. 1993. Adhesion to fibronectin prolongs eosinophil survival. J. Exp. Med. 177: 839-843 [Abstract/Free Full Text].

55. Anwar, A. R., G. M. Walsh, O. Cromwell, A. B. Kay, and A. J. Wardlaw. 1994. Adhesion to fibronectin primes eosinophils via a4beta 1 (VLA-4). Immunology 82: 222-228 [Medline].

56. Walsh, G. M., F. A. Symon, and A. J. Wardlaw. 1995. Human eosinophils preferentially survive on tissue fibronectin compared with plasma fibronectin. Clin. Exp. Allergy 25: 1128-1136 [Medline].

57. Tourkin, A., T. Anderson, E. C. LeRoy, and S. Hoffman. 1993. Eosinophil adhesion and maturation is modulated by laminin. Cell Adhes. Commun. 1: 161-176 [Medline].

58. Soloperto, M., S. L. Mattoso, A. Fasoli, and S. Mattoli. 1991. A bronchial epithelial cell-derived factor in asthma that promotes eosinophil activation and survival as GM-CSF. Am. J. Physiol. 260: L530-L538 [Abstract/Free Full Text].

59. Sedgwick, J. B., W. J. Calhoun, R. F. Vrtis, M. E. Bates, P. K. McAllister, and W. W. Busse. 1991. Comparison of airway and blood eosinophil function after in vivo antigen challenge. J. Immunol. 149: 3710-3718 .

60. Broide, D. H., and G. S. Firestein. 1991. Endobronchial allergen challenge in asthma: demonstration of cellular source of granulocyte macrophage colony-stimulating factor by in situ hybridization. J. Clin. Invest. 88: 1048-1053 .

61. Ohnishi, T., H. Kita, D. Weiler, J. B. Sedgwick, W. J. Calhoun, W. W. Busse, J. Abrams, and G. J. Gleich. 1993. IL-5 is the predominant eosinophil-active cytokine in the antigen-induced pulmonary late phase reaction. Am. Rev. Respir. Dis. 147: 901-907 [Medline].

62. Nagata, M., J. B. Sedgwick, R. Vrtis, H. Kita, and W. W. Busse. 1998. Endothelial cells upregulate eosinophil superoxide generation via VCAM-1 expression. Clin. Exp. Allergy 29: 550-561 .




This article has been cited by other articles:


Home page
 J. Immunol.Home page
H.-B. Wang, I. Ghiran, K. Matthaei, and P. F. Weller
Airway Eosinophils: Allergic Inflammation Recruited Professional Antigen-Presenting Cells
J. Immunol., December 1, 2007; 179(11): 7585 - 7592.
[Abstract] [Full Text] [PDF]