help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goto, Y.
Right arrow Articles by Sekizawa, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goto, Y.
Right arrow Articles by Sekizawa, K.
Am. J. Respir. Cell Mol. Biol., Volume 23, Number 6, December 2000 712-718

Dislocation of E-Cadherin in the Airway Epithelium during an Antigen-Induced Asthmatic Response

Yukio Goto,* Yoshiyuki Uchida, Akihiro Nomura, Tohru Sakamoto, Yukio Ishii, Yuko Morishima, Kuniko Masuyama, and Kiyohisa Sekizawa

Department of Pulmonary Medicine, Institute of Clinical Medicine, University of Tsukuba, Tsukuba, Japan

    Abstract
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The airway epithelium plays a critical role in asthma. E-cadherin, located on the basolateral side of the epithelial cells, forms adherent junctions. To investigate the role of E-cadherin on the regulation of permeability of molecules and fluid in asthmatic responses, we observed the dynamics of E-cadherin after an immunochallenge against guinea pigs. Immunohistochemical studies revealed that E-cadherin was expressed on the lateral sides of epithelial cells before the immunochallenge and after immediate airway responses (IAR). However, E-cadherin immunoreactivities decreased from the basolateral region in late airway responses (LAR) 6 h after the challenge. Simultaneously, soluble E-cadherin immunoreactivities were detected in lavage fluid only in LAR, suggesting that E-cadherin is partly cleaved and released into the lumen in LAR. Airway permeability, which was examined by penetration of horseradish peroxidase from the airway side into the epithelium, increased in both IAR and LAR. These results suggest that E-cadherin detachment from the lateral side of the epithelial cells increased airway permeability in LAR but not IAR. We conclude that an antigen challenge causes an opening of adherent junctions as well as increases airway permeability in LAR. This mechanism would participate in airflow limitation during attacks and the increase of airway permeability and hyperresponsiveness in asthmatics.

    Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The airway epithelium serves as a target organ for inhaled organisms and irritants. One of the most important roles of the epithelia is to function as a barrier provided by intercellular junctions. The following types of junctions are formed by epithelial cells: tight junctions, adherence junctions, desmosomes, and gap junctions. Of these, it is the tight junctions that are located at an apicolateral border of the epithelial cells forming the major barrier to paracellular traffic between external and internal milieus. There is evidence that the integrity between tight junctions of epithelial cells is influenced by E-cadherin-mediated normal homophilic connections. E-cadherin is a type of calcium-dependent adhesion molecule expressed on epithelial cells, especially in adherence junctions, and mediates mainly homophilic cell-cell adhesion (1, 2). The cytoplasmic domain of E-cadherin associates with three proteins termed alpha -, beta -, and gamma -catenin that link E-cadherin to the actin cytoskeleton (3). Low calcium concentration and the presence of the blocking antibody to E-cadherin led to diffusion of not only E-cadherin itself but also of zonula occludens (ZO-1) and actin filaments (4, 5). The diffusion of actin filaments causes functional and morphologic disruption of the tight junction barrier (6). Therefore, normal expression and the functional activity of E-cadherin are critical for the maintenance of tight junctions between epithelial cells and for maintaining normal function of the paracellular barrier in the airway epithelia.

Bronchial asthma is defined as a chronic airway inflammatory disease (9). The tracheobronchial epithelium in asthmatics shows such histologic features as epithelial shedding and the opening of tight junctions (10, 11). However, the precise mechanism of those pathologic changes has not yet been clarified. Furthermore, despite the importance of the molecule in maintaining airway epithelial integrity, the roles and functions of E-cadherin in the epithelium are not known, in particular in the case of asthma.

To investigate the role of E-cadherin in the pathogenesis of bronchial asthma, we employed a guinea-pig asthma model characterized by immediate and late asthmatic responses after an immunochallenge, as described previously (12, 13). By using this asthma model, we analyzed the dynamics of E-cadherin after administration of the immunochallenge and then examined the effects of disrupted E-cadherin on paracellular permeability of the epithelium. Moreover, the effectiveness of glucocorticoid on the disruption of adherent junctions was examined.

    Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Animals

Guinea-pig asthma models were prepared as previously described by Uchida and coworkers (12) and Iijima and colleagues (13). Briefly, female Hartley guinea pigs, weighing 250 to 300 g (SLC Farm, Shizuoka, Japan), were pretreated with cyclophosphamide (30 mg/kg) intraperitoneally. Two days later, the animals were sensitized to 1 mg of ovalbumin (OVA) (Sigma, St. Louis, MO) emulsified in Al(OH)3 by intraperitoneal injection. Three weeks after the primary sensitization, 10 µg OVA and Al(OH)3 were intraperitoneally injected as a booster. Three weeks after the booster injection, these guinea pigs were challenged with inhalation of OVA (2 mg/ml in saline).

Measurement of Airway Responses and Inhalation Procedure

Six weeks after the primary sensitization, guinea pigs were placed in a body plethysmograph chamber equipped with a mouth-nose mask. Six weeks after the primary sensitization, the animals were placed in a whole-body plethysmograph chamber equipped with a mouth-nose mask isolated from a body chamber. Specific airways conductance (SGaw) was measured according to Agrawal's methods (14). The relationship between airflow and box volume change, which was calculated from change of box pressure, can be determined as slope in an x-y plot of box volume change and airflow. The average of slopes in five respiratory cycles was used for the calculation of SGaw. Box pressure signal and airflow were monitored by a differential pressure transducer, TP-602, and a pneumotachograph, TV-241 (Nihon Kohden, Tokyo, Japan), respectively. After we were sure that SGaw had not been changed by a 2-min aerosol of saline, sensitized guinea pigs were challenged for 2 min to an aerosol of 4 mg OVA/2 ml saline solution at 3 liters/min flow rate with an Omron NE-U11 nebulizer (Tateishi Electric Co., Tokyo, Japan). Then, changes of SGaw were monitored at intervals of 5 min until 1 h after the antigen challenge and at intervals of 15 min up to 7 h. Each SGaw value was compared with that obtained before the immunochallenge, which was defined as percent change in SGaw. SGaw was monitored at 15-min intervals for a total period of 7 h.

Immunohistologic Analysis

Twenty-four hours after intraperitoneal treatment with or without 4 mg/kg dexamethasone daily for 3 d, guinea pigs were killed by exsanguination under anesthesia, with an intraperitoneal injection of 50 mg/kg pentobarbital administered before the challenge, 30 min, and 6 h after the challenge. Their tracheas were immediately removed and fixed with 10% phosphate-buffered formalin (Wako Pure Chemical Industries, Ltd., Osaka, Japan) for 2 h. The samples were washed with phosphate-buffered saline (PBS) (pH 7.4), incubated in 5, 10, and 20% sucrose in PBS, and were then frozen. Air-dried cryostat sections (10 µm) were rehydrated with washing buffer (0.5 M NaCl, 0.02 M Tris, 0.01 M CaCl2, 0.1% Tween 20, pH 7.4) for 5 min and incubated with 0.3% hydrogen/methanol for 30 min to block endogenous peroxidase activity. The samples were blocked for 1 h with a mixture of normal goat serum (Dako Japan Co., Ltd., Kyoto, Japan) and Dako Protein Block Serum-Free (Dako) (1:4), followed by rinsing with washing buffer. For detection of E-cadherin, we used monoclonal antibody raised against the extracellular portion of E-cadherin (ECCD-2) (Takara Shuzo Co., Ltd., Kyoto, Japan) (15). Sections with primary antibody were incubated for 30 min at room temperature. After three washes in washing buffer, sections were incubated with biotinylated goat antirat secondary antibody (Organon Teknica Corp., Durham, NC), followed by incubation in an avidin-biotin-peroxidase complex (Vector Laboratories, Burlingame, CA). Sites of immunoreaction were visualized by immersing sections in a solution of diaminobenzidine (DAB) (Dojindo Co., Kumamoto, Japan) and hydrogen peroxide (Wako). For electron microscopic analysis, the sections were fixed for 2 h with 2.5% glutaraldehyde in 0.1 M sodium phosphate buffer (pH 7.4) after the reaction with DAB; sections were then postfixed in 2% osmium tetroxide for 4 h. Sections were dehydrated in a graded series of ethanol (50 to 100%) followed by propylene oxide, and embedded in Poly/Bed 812 resin (Polysciences, Inc., Warrington, PA) for transmission electron microscopy. Ultrathin sections of 150 nm, cut with a diamond knife by an Ultrotome LKB 2088 (LKB-Produkter AB., Bromma, Sweden), were observed with an H-7000 electron microscope (Hitachi, Ltd., Tokyo, Japan).

Western Blot Analysis

The tracheal lavaged fluids were collected by washing the luminal side of removed tracheas with 0.5 ml of ice-cold PBS containing a cocktail of protease inhibitors (Complete) (Boehringer Mannheim, GmbH, Germany). The lavaged fluids of the tracheas were centrifuged at 400 × g for 5 min at 4°C, and then were concentrated tenfold by using Centricon 10 (Millipore Corp., Bedford, MA). The concentrated fluid was mixed with an equal volume of loading buffer (125 mM Tris-HCl, pH 6.8, 4% sodium dodecyl sulfate [SDS], 20% glycerol, 0.05% bromophenol blue, 5% beta -mercaptoethanol) and was boiled for 3 min. The samples were subjected to SDS-polyacrylamide gel electrophoresis on an acrylamide gel (Bio-Rad Laboratories, Hercules, CA). After electrophoresis, the gels were blotted onto a polyvinylidene difluoride membrane (Bio-Rad Laboratories). The membranes were blocked for 1 h with 5% dry milk powder in washing buffer and then incubated with ECCD-2 for 30 min at room temperature. After three washes with buffer, the membranes were incubated with biotinylated goat antirat secondary antibody followed by an avidin-biotin-alkaliphosphatase.

Measurement of Paracellular Permeability

Twenty-four hours after intraperitoneal treatment with or without 4 mg/kg dexamethasone daily for 3 d, immunized guinea pigs were assigned to four groups (three animals per group). Before the challenge, 0.5, 3, and 6 h after the challenge, guinea pigs were killed by the method described previously. Measurement of paracellular permeability was done according to the modified method of Ranga and colleagues (16). Briefly, 2.5 mg horseradish peroxidase (HRP) (type VI; Sigma) in 0.5 ml PBS was instilled into the upper portion of the tracheas using a 27-gauge needle attached to a 1-ml syringe. After 5 min, the tracheal segments distal to the site of instillation were removed and were fixed by immersion in 2.0% glutaraldehyde in 0.1 M phosphate buffer (pH 7.4). Each tracheal cylinder was cut longitudinally into three pieces and was rinsed thoroughly with phosphate buffer. HRP was visualized by treating the tissues for 30 min with DAB (Grade II; Sigma) in 0.1 M Tris-HCl buffer (pH 7.2) containing 0.01% H2O2. Tissues were rinsed again, fixed for 1 h with 1% aqueous OsO4, dehydrated in a graded series of alcohol and propylene oxide, and embedded in epon. Semithin sections of 1 µm were cut with a glass knife and were stained with toluidine blue. The proximal intercellular spaces, which penetrated DAB deposits in the sections, numbered more than 1,000 proximal intercellular spaces per section; these spaces were counted under a light microscope. Paracellular permeability was expressed as the percentage of the penetrated intercellular spaces. Ultrathin sections of 100 nm, cut with a diamond knife by an Ultrotome III, were observed with an H-7000 electron microscope.

Total RNA Isolation

After the tracheas were immediately removed, tracheal epithelial cells were collected by scraping the inside of the tracheas with a rubber scraper. Total RNA was extracted from the epithelial cells with a RNeasy total RNA kit (Quiagen, Hilden, Germany) according to the manufacturer's protocol.

Semiquantitative Reverse Transcriptase/Polymerase Chain Reaction

For complementary DNA synthesis, 400 ng total RNA were used in a 20-µl reaction containing 1 mM deoxynucleotide triphosphates (dNTPs), 2.5 µM random hexamers, 1,000 U/ml RNase inhibitor, 2,500 U/ml murine leukemia virus reverse transcriptase, and 0.1 volume of 10× buffer (500 mM KCl, 100 mM Tris-HCl, pH 8.3). The reverse transcriptase (RT) reaction was carried out for one cycle (42°C for 15 min, 99°C for 5 min) in a thermal cycler (Perkin Elmer, Foster City, CA). Polymerase chain reaction (PCR) was carried out in a 100-µl reaction mixture containing 5 µl of the RT reaction product, 1 mM dNTPs, 0.2 µM primers, 0.2 volume of 5× buffer (75 mM [NH4]2SO4, 7.5 mM MgCl2, Tris-HCl, pH 8.5), and 1 U of Ampli Taq DNA polymerase (Perkin Elmer). PCR primers used for amplification of E-cadherin-specific sequences were TGGGCTGGACCGAGAGAGTT (beginning at position 993 at the 5' end of human E-cadherin; sense strand) and ATCTCCAGCCAGTTGGCAGT (1,585 at the 3' end of human E-cadherin; antisense strand). Using these primers, PCR yields a 612-base-pair (bp) product. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-specific sequences were amplified by using the sense strand primer (ACCACAGTCCATGCCATCAC; beginning at position 525 at the 5' end of human GAPDH) and the antisense strand primer (TCCACCACCCTGTTGCTGTA; 958 at the 3' end of human GAPDH), which yield a 453-bp product. The amplification reaction was carried out in 25 cycles at 94°C for 1 min, 55°C for 1 min, and 74°C for 1 min in a thermal cycler. PCR products were separated on 1.2% agarose gel containing SYBR Green I (Molecular Probes, Inc., Eugene, OR). DNA amounts of E-cadherin- and GAPDH-specific bands in the gel were determined using Storm (Molecular Dynamics Japan, Inc., Tokyo, Japan) with FragmeNT Analysis software (Molecular Dynamics Japan). Data from experiments using epithelial cells from three different animals in each group were calculated as a mean and expressed as a percentage of those values taken before the challenge (controls). The sequences of these primers were highly conserved against E-cadherin sequences of the human epithelial cells (17). The PCR product was subcloned into a cloning vector with pGEM-T and pGEM-T Easy Vector Systems (Promega, Madison, WI), and was sequenced by the dideoxynucleotide chain termination method using a dideoxyterminator kit (Perkin Elmer) and with a DNA sequencer model 373S (Perkin Elmer Applied Biosystems Division).

In preliminary experiments, E-cadherin- and GAPDH-specific PCR products were still in the exponential range in 24 to 30 cycles of amplification reaction (data not shown). Therefore, the amplification reaction for E-cadherin- and GAPDH-specific PCR products was carried out in 25 cycles.

Statistical Analysis

All values were expressed as means ± standard error of the mean (SEM). Unpaired t tests were applied when two value sets were compared. Multiple comparison of mean values was made by analysis of variance (Fisher's protected least significant difference test). Differences were considered significant when P < 0.05.

    Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Airway Responses

To examine the effect of dexamethasone on asthmatic responses, the airway responses due to antigen inhalation against sensitized animals treated with or without dexamethasone were observed (Figure 1). The mean baseline values of SGaw in dexamethasone-treated and untreated animals were almost the same, 0.239 ± 0.02 and 0.240 ± 0.03 s-1 cm H2O-1, respectively. After OVA challenge, SGaw of both groups decreased immediately to approximately 45% of the mean baseline values and gradually returned to the baseline 1 h after the challenge. In untreated animals, late airway responses (LAR) were observed about 3 h after the challenge and continued for about another 3 h. The administration of dexamethasone, however, did not have any influence on immediate airway responses (IAR) but completely inhibited the occurrence of LAR.


View larger version (16K):
[in this window]
[in a new window]
 
Figure 1.   Dynamic changes of SGaw after the immunochallenge against sensitized animals treated with 4 mg/kg dexamethasone (open circles; n = 8) or without (solid circles; n = 8). SGaw value was monitored and was compared with that obtained before the immunochallenge, which was defined as 100%. Horizontal axis represents hours after the challenge. *P < 0.05, compared with dexamethasone-untreated animals (unpaired t test).

Localization of E-Cadherin in Tracheal Epithelium in Guinea-Pig Asthma Models

To investigate localization and expression of E-cadherin on epithelial cells before and after the challenge, tracheas from the guinea pigs were examined immunohistochemically. Before the challenge and in IAR, E-cadherin immunoreactivities were localized diffusely in the cytoplasm and were especially concentrated at the lateral side and apicolateral border where adherence junctions are located (Figures 2A, 2B, 2E, and 2F). However, the immunoreactivity of the lateral membranes of the epithelial cells decreased in LAR, although diffuse localization of E-cadherin in the cytoplasm was retained (Figures 2C and 2G). After administration of dexamethasone, the immunoreactivity of the lateral membranes was maintained in LAR (Figures 2D and 2H). A negative control was prepared with normal rat immunoglobulin (Ig) G instead of with ECCD-2. No immunoreactivity was detected when sections were incubated with the normal rat IgG (data not shown).


View larger version (131K):
[in this window]
[in a new window]
 
Figure 2.   Histologic analysis of E-cadherin on tracheal epithelial cells. Immunohistologic (A, B, C, and D) and electron immunohistologic (E, F, G, and H) micrographs are shown. Tracheal epithelia before the challenge (A and E), in IAR (B and F ), in LAR (C and G), and pretreatment with dexamethasone in LAR (D and H) were stained with the antibody ECCD-2. E-cadherin immunoreactivities are especially concentrated at the lateral side and apicolateral border, where adherence junctions are located (arrows) (A, B, E, and F ). The immunoreactivities decrease in the apicolateral membranes of the epithelial cells in LAR (arrowheads) (C and G). Pretreatment with dexamethasone showed maintenance of immunoreactivity of E-cadherin in LAR (arrows) (D and H ). Scale bars, 10 µm (A, B, C, and D); 3 µm (E, F, G, and H ).

Detection of Soluble E-Cadherin in Lavage Fluid of the Trachea

Because immunohistochemical studies revealed that immunoreactivity of E-cadherin in adherence junctions decreased in LAR, E-cadherin in the lavage fluid of the trachea was examined. Because ECCD-2 antibody is known to react with the extracellular portion of E-cadherin, this antibody can be used as a marker of external or cleaved E-cadherin (15). Soluble E-cadherin with a molecular weight of 85 kD was detected in the tracheal fluid in LAR (Figure 3, lane 4). In contrast, before the challenge, 1, and 3 h after the challenge, soluble E-cadherin was not detected in the tracheal fluid.


View larger version (32K):
[in this window]
[in a new window]
 
Figure 3.   Western blot analysis of soluble E-cadherin in lavage fluid of the trachea. The concentrated lavaged fluid before the challenge (lane 1), 1 h (lane 2), 3 h (lane 3), and 6 h (lane 4) after the challenge were loaded onto the gel. After separation, the membrane was proved with ECCD-2. Soluble E-cadherin with a molecular weight of 85 kD is detected in the fluid at LAR (lane 4). In contrast, before the challenge and 1 and 3 h after the challenge, soluble E-cadherin could not be detected in the fluid (lanes 1-3).

Increase of Paracellular Permeability in IAR and LAR

Few HRP reactions were seen in the intercellular spaces before the challenge (Figures 4A and 4E). However, in IAR and LAR tracheas, DAB deposits were observed extensively in the intercellular spaces before the challenge but not 3 h after the challenge (Figures 4B-4D and 4F- 4H). The epithelium in IAR and 3 h after the challenge showed narrow intercellular spaces. However, the intercellular spaces were wider in the LAR tracheas than they were in the IAR tracheas and 3 h after the challenge (Figures 4D and 4H). The time course of the number of junctions penetrated by HRP was evaluated. The penetration of HRP in the intercellular spaces observed at IAR decreased rapidly 3 h after the challenge; again, penetration was increased in LAR (Figure 5). This increased penetration of HRP was completely inhibited by the treatment of dexamethasone.


View larger version (92K):
[in this window]
[in a new window]
 
Figure 4.   Penetration of HRP into intercellular spaces of tracheal epithelia. Semithin sections (A, B, C, and D) and electron micrographs (E, F, G, and H ) show DAB deposits into the intercellular spaces before the challenge (A and E), 0.5 h (IAR; B and F ), 3 h (C and G), and 6 h (LAR; D and H ) after the challenge. Few HRP reactions are seen in the intercellular spaces before the challenge (A and E). In IAR and LAR, DAB deposits are observed extensively in intercellular spaces (B, D, F, and H ). The intercellular spaces are wider during LAR than during IAR (B, D, F, and H ). Scale bars, 20 µm (A, B, C, and D); 3 µm (E, F, G, and H ).


View larger version (13K):
[in this window]
[in a new window]
 
Figure 5.   The time course of the number of proximal intercellular spaces penetrated by HRP. The number on the horizontal axis represents hours after the immunochallenge, and Dex indicates the value at 6 h after the immunochallenge in the group pretreated with dexamethasone. The penetration into the intercellular spaces observed at IAR decreased rapidly 3 h after the challenge and the penetration is again increased at LAR. Values are presented as means ± SEM of three independent experiments. Statistical significance: *P < 0.05 versus before OVA challenge (0 h) and #P < 0.05 versus 6 h after that without treatment by dexamethasone.

Expression of E-Cadherin Messenger RNA in Tracheal Epithelial Cells

Total RNA from tracheal epithelial cells was subjected to RT-PCR analysis before the challenge, and 1, 3, and 6 h after challenge; E-cadherin messenger RNA (mRNA) expression was thus determined (Figure 6). Transient induction of E-cadherin mRNA was observed in IAR. The E-cadherin mRNA increased 2.5 times compared with that of the controls. Thereafter, the expression returned to the control level upon LAR.


View larger version (28K):
[in this window]
[in a new window]
 
Figure 6.   Dynamics of E-cadherin mRNA (A). Values are presented as the means of three independent experiments. Total RNA from tracheal epithelial cells before the challenge (lane 1), 1 h (lane 2), 3 h (lane 3), and 6 h (lane 4) after the challenge were subjected to semiquantitative RT-PCR analysis for determination of E-cadherin mRNA (B) expression and GAPDH mRNA (C) as an internal standard. Shown is one representative experiment of three. Transient induction of E-cadherin mRNA is observed 1 h after the challenge.

    Discussion
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Various in vivo observations indicate that the expression of E-cadherin decreases and that the localization changes in the epithelia of some inflammatory disorders. Hanby and coworkers (18) have recently shown that the expression of E-cadherin on colonal epithelial cells is decreased in patients with peptic ulceration and Crohn's disease. Furthermore, other investigations have reported changes in E-cadherin localization or expression in pathologic epithelia (e.g., pulmonary fibrosis, pemphigus, and Darier's disease) as well as in animal models (e.g., the fibrosis model and the pancreatitis model) (19). It is well known that asthma is also a disease which causes damage to the epithelia; however, the role of E-cadherin in bronchial asthma remains unclear. The purpose of the present study was to demonstrate the dynamics of E-cadherin on airway epithelial cells in asthmatic responses.

Immunohistochemical analysis revealed that E-cadherin localization diminished in adherence junctions between tracheal epithelial cells in LAR but not before immunochallenge or in cases of IAR. Decrement of E-cadherin, however, was not observed during LAR of dexamethasone-treated animals. Furthermore, Western blot analysis revealed that soluble E-cadherin, which was detected by an anti-extracellular portion of E-cadherin antibody was found in the lavage fluid of the trachea in LAR but not before the challenge nor in IAR. These results suggest that the extracellular portion of E-cadherin is cleaved and released from the epithelial cells into the airway lumen during LAR. It has been reported that one of the mechanisms that increase the amount of soluble E-cadherin is involved in proteolysis (22). The number of eosinophils significantly increased in bronchoalveolar lavage fluid in our asthma model 6 h after the challenge (13). Eosinophils can release proteases and eosinophil peroxidase, which are known to damage the epithelium and disrupt airway epithelial barriers (23, 24). Pretreatment with dexamethasone showed maintenance of normal expression of the molecule in LAR. Steroids have a direct inhibitory effect on mediator release from eosinophils, reduction of circulating eosinophils, and inhibition of cytokine-mediated eosinophil survival (25). Furthermore, in an experimental model of asthma, pretreatment with steroids completely inhibited the increase of eosinophil number in the airway (26). Therefore, one of the reasons for the cleavage of the extracellular portion of E-cadherin may be found in proteolysis caused by factors derived from eosinophils.

Tight junctions located on the apical poles of epithelial cells form a diffusion barrier that regulates the flux of ions and hydrophilic molecules through the paracellular pathway (27). The integrity of tight junctions depends on continued expression and functional activity of E-cadherin (5, 28). Conversely, disruption of homophilic connections of E-cadherin led to defective formation of tight junctions in epithelial cells. Inhibition of the homophilic connection of E-cadherin by elimination of Ca2+ resulted in the opening of tight junctions between epithelial cells (4, 29). Moreover, specific antibody against the extracellular portion of E-cadherin destroyed the homophilic connection of E-cadherin and resulted in the opening of tight junctions (4, 5, 32). We observed that paracellular permeability of tracheal epithelium increases upon IAR and LAR. Immunohistochemical observations and Western Blot analysis revealed that the extracellular portion of E-cadherin was lost during LAR but not during IAR. These results suggest that loss of the extracellular portion of E-cadherin on the cells upon LAR resulted in the inability of homophilic connection of the molecule and in the subsequent opening of tight junctions. As a consequence, the paracellular barrier of the tracheal epithelium would be disrupted in LAR. Conversely, an increase in permeability was observed with IAR, although E-cadherin kept its expression intact; this latter observation suggests that E-cadherin disconnection in IAR is possibly a reversible reaction. Ranga and colleagues (16) have reported similar results; they found that paracellular permeability of the tracheal epithelium increased 20 min after an antigen challenge in immunized guinea pigs. Boucher and associates (33) demonstrated that the opening of the tight junctions in IAR is caused by the putative mediators of allergic reaction, including methacholine and histamine. For these reasons, the mechanism of increases in permeability with regard to LAR would be different from that of IAR.

It is well known that E-cadherin plays an important role in maintaining the integrity of airway epithelia. Therefore, we explored the relationship between airway permeability and the disappearance of E-cadherin from the basolateral membranes in LAR. Electron micrographs showed DAB deposition in intercellular spaces in both IAR and LAR. The intercellular spaces were wider with LAR than with IAR. As mentioned previously, the extracellular portion of E-cadherin on the epithelial cells would be cleaved at LAR. These results suggest that the dysfunction of E-cadherin caused by the loss of its extracellular portion eventually leads to a decrease in its functional activity to play a role of adherence molecules. Ranga and coworkers (16) presented morphologic data that was similar to ours in that the epithelium was observed as maintaining the tight intercellular spaces in the case of IAR, although HRP penetrated the intercellular space. Taken together with the intact expression of E-cadherin in IAR, continued expression and functional activity of E-cadherin on epithelial cells would be critical to maintain tight adhesion in the epithelium. Furthermore, the penetration of HRP in the intercellular spaces observed at IAR decreased rapidly 3 h after the challenge; again, penetration was increased at LAR. These results suggest that after the transient opening of tight junctions at IAR, the junctions would reopen or be disrupted at LAR. Hence, the disruption of tight junctions may be caused by a structural defect of E-cadherin during LAR.

E-cadherin mRNA expression rapidly increased after the immunochallenge, even though E-cadherin on the epithelial cells was not dissociated in IAR. Lerch and colleagues (21) also showed rapid increase of E-cadherin mRNA expression in experimental acute pancreatitis. These results indicate that the rapid increase of mRNA during epithelial inflammation may allow quick synthesis of E-cadherin in order to restore cell-cell contact.

The role of E-cadherin in asthma has not been fully explained. However, it has been reported that the opening of tight junctions and the increase of airway permeability are related to airway hyperresponsiveness in patients with asthma (34, 35). These results, taken together with our observations, suggest that a loss of E-cadherin might possibly increase airway hyperresponsiveness in patients with asthma. Our guinea-pig asthma model showed airflow limitation in LAR, which was caused by the extravasation from airway submucosal vessels and the subepithelial edema. In this report, we observed that the paracellular barrier of epithelia was disrupted at LAR, indicating that a loss of the extracellular portion of E-cadherin would result in exudation from the subepithelial region into the lumen. Therefore, we conjectured that loss of E-cadherin might bring about a flooding of the airway. Moreover, a loss of E-cadherin in the epithelial cells would interrupt communication among epithelial cells, which means the disturbance of coordination of cilia movements. Thereafter, the loss of adherence junctions can upset the efficacy of the conveyance of airway mucus and liquid. Those events might be related to the pathogenesis of LAR.

    Footnotes

Address correspondence to: Y. Uchida, Dept. of Pulmonary Medicine, Institute of Clinical Medicine, University of Tsukuba, 1-1-1 Tennoudai, Tsukuba, Ibaraki 305-8575, Japan. E-mail: yuchida{at}md.tsukuba.ac.jp

(Received in original form November 16, 1999 and in revised form July 10, 2000).

* Current address: Tsukuba Research Laboratories, Glaxo Welcome K.K., 43 Wadai, Tsukuba, Ibaraki 300-0042, Japan.
Abbreviations: diaminobenzidine, DAB; glyceraldehyde-3-phosphate dehydrogenase, GAPDH; horseradish peroxidase, HRP; immediate airway responses, IAR; late airway responses, LAR; messenger RNA, mRNA; ovalbumin, OVA; phosphate-buffered saline, PBS; reverse transcriptase/ polymerase chain reaction, RT-PCR; specific airways conductance, SGaw.

Acknowledgments: The authors are grateful to Ms. Iku Sudo and Ms. Noriko Sugae for preparation of the histologic examination. Part of this work was supported by a grant from Glaxo Wellcome K.K., Tokyo, Japan, and by a grant from Takeda Chemical Industries, Ltd.
    References
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Takeichi, M.. 1990. Cadherins: a molecular family important in selective cell-cell adhesion. Annu. Rev. Biochem. 59: 237-252 [Medline].

2. Takeichi, M.. 1991. Cadherin cell adhesion receptors as a morphogenetic regulator. Science 251: 1451-1455 [Medline].

3. Ozawa, M., H. Baribault, and R. Kemler. 1989. The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. EMBO J. 8: 1711-1717 [Abstract].

4. Gumbiner, B., and K. Simons. 1986. A functional assay for proteins involved in establishing an epithelial occluding barrier: identification of a uvomorulin-like polypeptide. J. Cell Biol. 102: 457-468 [Abstract].

5. Gumbiner, B., B. Stevenson, and A. Grimaldi. 1988. The role of the cell adhesion molecule uvomorulin in the formation and maintenance of the epithelial junctional complex. J. Cell Biol. 107: 1575-1587 [Abstract].

6. Meza, I., G. Ibarra, M. Sabanero, A. Martinez-Palomo, and M. Cereijido. 1980. Occluding junctions and cytoskeletal components in a cultured transporting epithelium. J. Cell Biol. 87: 746-754 [Medline].

7. Madara, J. L., R. Moore, and S. Carlson. 1987. Alteration of intestinal tight junction structure and permeability by cytoskeletal contraction. Am. J. Physiol. 253: C854-C861 [Medline].

8. Stevenson, B. R., and D. A. Begg. 1994. Concentration-dependent effects of cytochalasin D on tight junctions and actin filaments in MDCK epithelial cells. J. Cell Sci. 107: 367-375 [Medline].

9. Lemanske, R. F. Jr., and W. W. Busse. 1997. Asthma. JAMA 278: 1855-1873 [Medline].

10. Laitinen, L. A., M. Heino, A. Laitinen, T. Cava, and T. Haahtela. 1985. Damage of the airway epithelium and bronchial reactivity in patients with asthma. Am. Rev. Respir. Dis. 131: 599-606 [Medline].

11. Ohashi, Y., S. Motojima, T. Fukuda, and S. Makino. 1992. Airway hyperresposiveness, increased intracellular spaces of bronchial epithelium, and increased infiltration of eosinophils and lymphocytes in bronchial mucosa in asthma. Am. Rev. Respir. Dis. 145: 1469-1476 [Medline].

12. Uchida, Y., T. Jun, H. Ninomiya, H. Ohse, S. Hasegawa, A. Nomura, T. Sakamoto, M. S. Sardessai, and F. Hirata. 1996. Involvement of endothelins in immediate and late asthmatic responses of guinea pigs. J. Pharmacol. Exp. Ther. 277: 1622-1629 [Abstract].

13. Iijima, H., Y. Uchida, T. Endo, A. Xiang, M. Shirato, A. Nomura, and S. Hasegawa. 1998. Role of endogenous nitric oxide in allergen-induced airway responses in guinea-pigs. Br. J. Pharmacol. 124: 1019-1028 [Medline].

14. Agrawal, K. P.. 1981. Specific airways conductance in guinea pigs: normal values and histamine induced fall. Respir. Physiol. 43: 23-30 [Medline].

15. Shirayoshi, Y., A. Nose, K. Iwasaki, and M. Takeichi. 1986. N-linked oligosaccharides are not involved in the function of a cell-cell binding glycoprotein E-cadherin. Cell Struct. Funct. 11: 245-252 [Medline].

16. Ranga, V., M. A. Powers, M. Padilla, G. L. Strope, L. Fowler, and J. Kleinerman. 1983. Effect of allergic bronchoconstriction on airways epithelial permeability to large polar solutes in the guinea pig. Am. Rev. Respir. Dis. 128: 1065-1070 [Medline].

17. Bussemakers, M. J., A. van Bokhoven, S. G. Mees, R. Kemler, and J. A. Schalken. 1993. Molecular cloning and characterization of the human E-cadherin cDNA. Mol. Biol. Rep. 17: 123-128 [Medline].

18. Hanby, A. M., R. Chinery, R. Poulsom, R. J. Playford, and M. Pignatelli. 1996. Downregulation of E-cadherin in the reparative epithelium of the human gastrointestinal tract. Am. J. Pathol. 148: 723-729 [Medline].

19. Furukawa, F., Y. Miyachi, Y. Wakai, and S. Imamura. 1991. Localization of cadherin cell-adhesion molecules in the skin lesion of Darier disease. Int. J. Dermatol. 30: 599-600 [Medline].

20. Kasper, M., O. Huber, H. Grossmann, B. Rudolph, C. Tränkner, and M. Müller. 1995. Immunocytochemical distribution of E-cadherin in normal and injured lung tissue of the rat. Histochem. Cell Biol. 104: 383-390 [Medline].

21. Lerch, M. M., M. P. Lutz, H. Weidenbach, F. Müller-Pillasch, T. M. Gress, J. Leser, and G. Adler. 1997. Dissociation and reassembly of adherens junctions during experimental acute pancreatitis. Gastroenterology 113: 1355-1366 [Abstract].

22. Matsuyoshi, N., T. Tanaka, K. Toda, H. Okamoto, F. Furukawa, and S. Imamura. 1995. Soluble E-cadherin: a novel cutaneous disease marker. Br. J. Dermatol. 132: 745-749 [Medline].

23. Ståhle-Bäckdahl, M., M. Inoue, G. J. Guidice, and W. C. Parks. 1994. 92kD gelatinase is produced by eosinophils at the site of blister formation in bullous pemphigoid and cleaves the extracellular domain of recombinant 180kD bullous pemphigoid autoantigen. J. Clin. Invest. 93: 2022-2030 [Medline].

24. Brottman, G. M., W. E. Regelmann, A. Slungaard, and O. D. Wangensteen. 1996. Effect of eosinophil peroxidase on airway epithelial permeability in the guinea pig. Pediatr. Pulmonol. 21: 159-166 [Medline].

25. Wallen, N., H. Kita, D. Weiller, and G. J. Gleich. 1991. Glucocorticoids inhibit cytokine-mediated eosinophil survival. J. Immunol. 147: 3490-3495 [Abstract].

26. Elwood, W., J. O. Lotvall, P. J. Barnes, and K. F. Chung. 1992. Effect of dexamethasone and cyclosporin A on allergen-induced airway hyperresponsiveness and inflammatory cell responses in sensitized Brown Norway rats. Am. Rev. Respir. Dis. 145: 1289-1294 [Medline].

27. Gumbiner, B.. 1987. Structure, biochemistry, and assembly of epithelial tight junctions. Am. J. Physiol. 253: C749-C758 [Medline].

28. Collares-Buzato, C. B., M. A. Jepson, N. L. Simmons, and B. H. Hirst. 1998. Increased tyrosine phosphorylation causes redistribution of adherens junction and tight junction proteins and perturbs paracellular barrier function in MDCK epithelia. Eur. J. Cell Biol. 76: 85-92 [Medline].

29. Staddon, J. M., K. Herrenknecht, C. Smales, and L. L. Rubin. 1995. Evidence that tyrosine phosphorylation may increase tight junction permeability. J. Cell Sci. 108: 609-619 [Medline].

30. Citi, S.. 1992. Protein kinase inhibitors prevent junction dissociation induced by low extracellular calcium in MDCK epithelial cells. J. Cell Biol. 117: 169-178 [Abstract].

31. Martinez-Palomo, A., I. Meza, G. Beaty, and M. Cereijido. 1980. Experimental modulation of occluding junctions in a cultured transporting epithelium. J. Cell Biol. 87: 736-745 [Abstract].

32. Wheelock, M. J., and P. J. Jensen. 1992. Regulation of kelatinocyte intercellular junction organization and epidermal morphogenesis by E-cadherin. J. Cell Biol. 117: 415-425 [Abstract].

33. Boucher, R. C., V. Ranga, P. D. Pare, S. Inoue, L. A. Moroz, and J. C. Hogg. 1978. Effect of histamine and methacholine on guinea pig tracheal permeability to HRP. J. Appl. Physiol. 45: 939-948 [Medline].

34. Ohashi, Y., S. Motojima, T. Fukuda, and S. Makino. 1992. Airway hyperresponsiveness, increased intercellular spaces of bronchial epithelium, and increased infiltration of eosinophils and lymphocytes in bronchial mucosa in asthma. Am. Rev. Respir. Dis. 145: 1469-1476 [Medline].

35. Hogg, J. C.. 1981. Bronchial mucosal permeability and its relationship to airways hyperreactivity. J. Allergy Clin. Immunol. 67: 421-425 [Medline].





This article has been cited by other articles:


Home page
J. Appl. Physiol.Home page
A. Thammanomai, A. Majumdar, E. Bartolak-Suki, and B. Suki
Effects of reduced tidal volume ventilation on pulmonary function in mice before and after acute lung injury
J Appl Physiol, November 1, 2007; 103(5): 1551 - 1559.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. L. Humlicek, L. J. Manzel, C. L. Chin, L. Shi, K. J. D. A. Excoffon, M. C. Winter, D. M. Shasby, and D. C. Look
Paracellular Permeability Restricts Airway Epithelial Responses to Selectively Allow Activation by Mediators at the Basolateral Surface
J. Immunol., May 15, 2007; 178(10): 6395 - 6403.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
C. P Hersh, M. E Soto-Quiros, L. Avila, S. L Lake, C. Liang, E. Fournier, M. Spesny, J. S Sylvia, R. Lazarus, T. Hudson, et al.
Genome-wide linkage analysis of pulmonary function in families of children with asthma in Costa Rica
Thorax, March 1, 2007; 62(3): 224 - 230.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
J. Zabner, M. Winter, K. J. D. A. Excoffon, D. Stoltz, D. Ries, S. Shasby, and M. Shasby
Histamine alters E-cadherin cell adhesion to increase human airway epithelial permeability
J Appl Physiol, July 1, 2003; 95(1): 394 - 401.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
P. D. Vermeer, R. Harson, L. A. Einwalter, T. Moninger, and J. Zabner
Interleukin-9 Induces Goblet Cell Hyperplasia during Repair of Human Airway Epithelia
Am. J. Respir. Cell Mol. Biol., March 1, 2003; 28(3): 286 - 295.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
J. Zabner, M. C. Winter, S. Shasby, D. Ries, and D. M. Shasby
Histamine Decreases E-Cadherin-Based Adhesion To Increase Permeability of Human Airway Epithelium
Chest, March 1, 2003; 123(2007): 385S - 385S.
[Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
S. M. Evans, D. I. Blyth, T. Wong, S. Sanjar, and M. R. West
Decreased Distribution of Lung Epithelial Junction Proteins after Intratracheal Antigen or Lipopolysaccharide Challenge: Correlation with Neutrophil Influx and Levels of BALF sE-Cadherin
Am. J. Respir. Cell Mol. Biol., October 1, 2002; 27(4): 446 - 454.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
K.-I. HASHIMOTO, Y. ISHII, Y. UCHIDA, T. KIMURA, K. MASUYAMA, Y. MORISHIMA, K. HIRANO, A. NOMURA, T. SAKAMOTO, H. TAKANO, et al.
Exposure to Diesel Exhaust Exacerbates Allergen-induced Airway Responses in Guinea Pigs
Am. J. Respir. Crit. Care Med., November 15, 2001; 164(10): 1957 - 1963.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goto, Y.
Right arrow Articles by Sekizawa, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goto, Y.
Right arrow Articles by Sekizawa, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2000 American Thoracic Society.