Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

Asthma is a characterized by allergic inflammation, airway hyperresponsiveness, and airway remodeling. Recent evidence suggests that human airway smooth muscle (HASM) is an important mediator of airway remodeling and airway inflammation (1). In response to inflammatory mediators such as tumor necrosis factor (TNF)-, HASM cells synthesize and express cell adhesion molecules (2). HASM cells also synthesize and secrete a variety of cytokines, including interleukin (IL)-6 (3) and regulated on activation, normal T cells expressed and secreted (RANTES) (4). Such synthetic functions of HASM can play a critical role in perpetuating airway inflammation and inducing airway smooth-muscle growth (1).

Little information is available regarding mechanisms that regulate HASM synthetic functions, in particular, the regulation of cytokine synthesis. In a number of cell types, 3':5' cyclic adenosine monophosphate (cAMP) has been shown to regulate cytokine synthesis (reviewed in Ref. 5). Examination of the immunomodulatory role of cAMP in HASM cells is of relevance given that cAMP-elevating agents are: (1) induced during airway inflammation (e.g., prostaglandin [PG] E₂); and (2) administered as first-line therapy for acute asthma attacks (exogenous -adrenoceptor agonists).

In this study we examined the effect of increased intracellular cAMP ([cAMP]_i) on TNF--induced RANTES and IL-6 secretion from HASM cells. Elevation of [cAMP]_i was achieved by directly activating adenylyl cyclase with forskolin, or via stimulation of G_s coupled receptors using PGE₂. Additionally, cells were pretreated with a phosphodiesterase (PDE) type 4 inhibitor, SB 207499 (6), to inhibit cAMP hydrolysis by HASM cell PDE4 (7). We found that elevated [cAMP]_i enhanced IL-6 secretion by HASM cells stimulated by TNF-, but inhibited the secretion of RANTES. The PDE4 inhibitor SB 207499 also inhibited TNF-- induced RANTES secretion. Because the results of reverse transcriptase/polymerase chain reaction (RT-PCR) and ribonuclease protection assays (RPAs) suggested that these opposite effects of increased [cAMP]_i occurred at the transcriptional level, we also examined the effects of TNF- and cAMP on the regulation of nuclear factor (NF)-B, a transcription factor known to modulate cytokine synthesis in numerous cell types.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

ASM Cell Culture

Human trachea was obtained from lung-transplant donors in accordance with procedures approved by the University of Pennsylvania Committee on Studies Involving Human Beings at the University of Pennsylvania. HASM cells were dissected, purified, and cultured in Ham's F12 medium supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 0.1 mg/ml streptomycin (GIBCO BRL Life Technologies, Grand Island, NY) as described previously (8). HASM cells in subculture during the second through to fifth cell passages were studied. Cultured HASM cells retain native contractile protein expression, as demonstrated by indirect immunofluorescent staining for smooth muscle-specific actin (8), and retain functional cell-excitation coupling systems determined by fura-2 measurements of agonist-induced changes in cytosolic calcium (8). A minimum of three different cell lines was used for each experiment.

Unless otherwise specified, all chemicals used in this study were purchased from Sigma Chemical Company (St. Louis, MO).

Measurement of RANTES and IL-6 Secretion by HASM Cells

Confluent HASM cells were growth-arrested by incubating the monolayers in Ham's F12 with 0.1% bovine serum albumin for 48 h. Cells were then pretreated with either 1 to 1,000 nM PGE₂ (Calbiochem-Novabiochem, La Jolla, CA), 0.1 to 10 µM forskolin, or 0.2 to 1 mM dibutyryl cAMP, in the absence and presence of 1 to 100 nM SB 207499 (c-4-cyano-4-[3-cyclopentyloxy-4-methoxyphenyl-r-1-cyclohexane carboxylic acid]; SmithKline Beecham, King of Prussia, PA) for 30 min at 37°C. The cells were then stimulated with either vehicle or 10 ng/ml TNF- (Boehringer Mannheim, Indianapolis, IN). After 40 h at 37°C, cell culture media were removed and frozen at 20°C for later analysis by enzyme-linked immunosorbent assay (ELISA). ELISAs for RANTES and IL-6 were performed according to the manufacturer's instructions (R&D Systems, Minneapolis, MN).

Measurement of cAMP Production by Radioimmunoassay

Growth-arrested, confluent HASM cells were washed in ice-cold Ca²⁺/Mg²⁺-free phosphate-buffered saline, then individual wells were treated with 1 to 1,000 nM PGE₂ or 0.1 to 10 µM forskolin for 10 min at 37°C. cAMP was isolated and quantified by radioimmunoassay as described previously (9).

RNA Isolation, RT-PCR, and RPA

Growth-arrested, confluent HASM cells were pretreated for 30 min with either vehicle, 1 µM PGE₂, 10 µM forskolin, or 1 mM dibutyryl cAMP before stimulation with TNF- (10 ng/ml) for 24 h at 37°C. Total RNA was isolated from HASM cells using Trizol Reagent (Life Technologies, Rockville, MD) according to the manufacturer's instructions.

To analyze steady-state messenger RNA (mRNA) levels by RT-PCR, 5 µg of total RNA for each sample was mixed with 0.5 µg oligo dT primers (Promega, Madison, WI) and heated at 70°C for 5 min, then chilled on ice. First Strand Buffer (50 mM Tris-HCl, pH 8.3; 75 mM KCl; and 3 mM MgCl₂), 10 mM dithiothreitol (both from Life Technologies), and 1 mM deoxynucleotide mix (1 mM each of deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanidine triphosphate, and deoxythymidine triphosphate; Promega) were mixed with the RNA and oligo dT and heated at 50°C for 2 min. Superscript II RT (200 U; Life Technologies) was added to each tube, and the reverse transcription reactions proceeded for 60 min at 50°C. The reactions were inactivated by heating at 70°C for 15 min. Samples were diluted 1:40 to 1:80 with TE buffer (10 mM Tris-HCl and 1 mM ethylenediaminetetraacetic acid, pH 8.0) before amplification by PCR.

For PCR analysis, 2.5 µl of each complementary DNA sample was used per reaction, in a buffer containing 10 mM Tris-HCl, 50 mM KCl, 2 mM MgCl₂, 1 M betaine, and 0.1% Triton X-100 with 200 µM of each deoxynucleotide triphosphate (Promega). Specific primers for smooth muscle -actin (forward: 5'GCATCCAYGARACYACCTWCAACWSCATC3'; reverse: 5'GCGAATTCACATAGGTAACGAGTCAGAGC3'), RANTES (forward: 5'CTCATTGCTACTGCCCTCTGCGCTCCTGC3'; reverse: 5'GCTCATCTCCAAAGAGTTGATGTACTC3'), and IL-6 (forward: 5'CCAGCTATGAACTCCTTCTCCACAAGC3'; reverse: 5'GCTGGACTGCAGGAACTCCTTAAAGC3') were used at 200 nM each. PCR was performed for 30 cycles at 94°C denaturation, 60°C annealing, and 72°C extension using Taq DNA polymerase (Promega). Reaction products were confirmed on 1% agarose (Fisher Biotech, Fair Lawn, NJ) gels with size markers (New England Biolabs, Beverly, MA). Each primer pair produced a specific size product: smooth muscle -actin, 425 base pairs (bp); RANTES, 239 bp; and IL-6, 620 bp.

RPAs were performed using the RiboQuant Multi-Probe RNase Protection Assay System (BD Pharmingen, San Diego, CA) with a custom template set that included probes for human RANTES (unprotected probe: 388 nucleotide [nt]; protected probe: 361 nt) and human IL-6 (unprotected probe: 211 nt; protected probe: 182 nt). A total of 5 µg of total RNA from each HASM cell sample was used for each RPA, and the assays were performed according to manufacturer's instruction. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (unprotected probe: 124 nt; protected probe: 96 nt) was used as a housekeeping gene to normalize IL-6 and RANTES mRNA levels. Densitometric analysis was performed using the NIH Image Analysis program (Version 1.61).

Electrophoretic Mobility Shift Assay

Briefly, growth-arrested, confluent HASM cells were pretreated for 30 min with either vehicle, 1 µM PGE₂, or 10 µM forskolin, and either left unstimulated or stimulated with TNF- (10 ng/ml) for 1 h at 37°C. Electrophoretic mobility shift assay (EMSA) was performed to assess NF-B DNA binding as described previously (10).

NF-B-Luciferase Reporter Assay

A commercially available plasmid designed for monitoring NF-B activation, pNF-B-luciferase (Luc) (Clontech, Palo Alto, CA) was used to perform the B-Luc reporter assays. Transfection of HASM cells was performed as described previously (11) using the calcium phosphate transfection system (GIBCO BRL Life Technologies). Cells were transfected with 8 µg of pNF-B-Luc and 2 µg of pSV--galactosidase control vector (Promega) to normalize transfection efficiencies. After transfection, cells were cultured for 48 h in Ham's F12 medium supplemented with 10% FBS, 100 U/ml penicillin, and 0.1 mg/ml streptomycin.

Transfected HASM cells were growth-arrested, then pretreated for 30 min at 37°C with either vehicle, 1 µM PGE₂, or 10 µM forskolin, before 4 h incubation in the absence or presence of TNF- (10 ng/ml) at 37°C. Cells were then harvested and Luc and -galactosidase activities assessed as described previously (11).

Statistical Analysis

One-way or two-way analysis of variance (ANOVA) was used on all data when experiments were of a factorial design to compare differences between treatment means (expressed as means ± standard error [SE]). After ANOVA, Fisher's PLSD was used as a multiple-comparison test. Comparison of two populations was made using Student's unpaired t test. P values < 0.05 were sufficient to reject the null hypothesis for all analyses.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

Time Course of RANTES and IL-6 Secretion by TNF--Stimulated HASM Cells

HASM cultures were treated with TNF- (10 ng/ml) for 0 to 40 h, and RANTES and IL-6 protein levels in culture media were subsequently measured by ELISA. As shown in Figure 1, growth-arrested, unstimulated HASM cells secrete low levels of RANTES (Figure 1A) or IL-6 (Figure 1B). TNF- treatment of HASM cells markedly increased RANTES secretion by 16 to 24 h (Figure 1A). The TNF--induced secretion of IL-6 from HASM cells was more rapid than that of RANTES, with detectable amounts secreted as early as 2 h after stimulation, and levels progressively increased through 40 h. After 40 h of TNF- stimulation, the amount of IL-6 secreted was approximately 7.5-fold less than that of RANTES (3,624.2 ± 462.7 versus 27,532.8 ± 2,621.5 pg/ml, respectively). For all subsequent experiments, modulation of RANTES and IL-6 secretion was examined after 40 h stimulation with TNF- (10 ng/ml).

View larger version (16K): [in this window] [in a new window]   Figure 1.   Time course of RANTES and IL-6 secretion by TNF--stimulated HASM cells. Growth-arrested HASM cells were stimulated with TNF- (10 ng/ml) for the indicated times, and secreted RANTES (A) and IL-6 (B) measured by ELISA. Data represent means ± SE from three to nine replicates.

In parallel experiments, we examined whether TNF-- induced cytokine secretion was mediated by cyclooxygenase (COX)-2. Inhibition of COX-2 by pretreatment with indomethacin (1 µM) had no effect on TNF--induced RANTES or IL-6 secretion (data not shown), suggesting that cytokine-induced COX-2 expression is not involved in TNF--induced cytokine production in HASM cells.

PGE₂ or Forskolin Pretreatment Inhibits TNF--Induced RANTES but Increases TNF--Induced IL-6 Secretion

To test the effect of [cAMP]_i on TNF--induced RANTES and IL-6 secretion, HASM cells were pretreated with PGE₂ or forskolin 30 min before treatment with TNF-. As shown in Figure 2, pretreatment of HASM cells with PGE₂ or forskolin (Figures 2A and 2B, respectively) inhibited TNF--induced RANTES secretion in a concentration-dependent manner (P < 0.05). Significant inhibition of RANTES secretion was observed after pretreatment with low concentrations of PGE₂ (1 nM; P < 0.05) and forskolin (0.1 µM; P < 0.05).

View larger version (15K): [in this window] [in a new window]   Figure 2.   PGE2 or forskolin pretreatment inhibits TNF--induced RANTES secretion from HASM cells. Growth-arrested HASM cells stimulated with TNF- (10 ng/ml) were pretreated for 30 min with either 1 to 1,000 nM PGE2 (A) or 0.1 to 10 µM forskolin (B) and compared with cells stimulated with TNF- alone. After 40 h incubation, secreted RANTES was measured by ELISA. Statistical analysis was performed using one-way ANOVA, then Fisher's PLSD multiple comparison test (* denotes a significant effect of either PGE2 or forskolin pretreatment on TNF--induced RANTES secretion, compared with RANTES secretion from cells stimulated with TNF- alone [P < 0.05]). Data represent means ± SE from 3 to 20 replicates.

In contrast to their inhibitory effects on RANTES secretion, PGE₂ or forskolin pretreatment increased production of IL-6 by HASM cells stimulated with TNF- (Figure 3). Interestingly, the threshold concentrations of PGE₂ and forskolin required to achieve a significant effect on TNF--induced IL-6 secretion were 10-fold higher than those that inhibited RANTES secretion (at 10 nM and 1 µM, respectively) (P < 0.05). These results suggest that the mechanisms that regulate RANTES secretion may be more sensitive to [cAMP]_i than those mechanisms that modulate IL-6 secretion.

View larger version (15K): [in this window] [in a new window]   Figure 3.   PGE2 or forskolin pretreatment increases TNF--induced IL-6 secretion from HASM cells. Growth-arrested HASM cells stimulated with TNF- (10 ng/ml) were pretreated for 30 min with either 1 to 1,000 nM PGE2 (A) or 0.1 to 10 µM forskolin (B) and compared with cells stimulated with TNF- alone. After 40 h incubation, secreted IL-6 was measured by ELISA. Statistical analysis was performed using one-way ANOVA, then Fisher's PLSD multiple comparison test (* denotes a significant effect of either PGE2 or forskolin pretreatment on TNF--induced IL-6 secretion, compared with IL-6 secretion from cells stimulated with TNF- alone [P < 0.05]). Data represent means ± SE from 4 to 22 replicates.

Modulation of TNF--Induced RANTES and IL-6 Secretion by PGE₂ or Forskolin Is Associated with Increased [cAMP]_i in HASM Cells

A series of experiments were performed to examine the possible role of [cAMP]_i in the inhibition of RANTES secretion and augmentation of IL-6 by PGE₂ and forskolin. In the absence of PDE inhibition, PGE₂ and forskolin increased [cAMP]_i in HASM cells in a concentration-dependent manner (Figure 4). Dibutyryl cAMP, a cell-permeable cAMP analog, produced a concentration-dependent inhibition of TNF--induced RANTES secretion (Figure 4A) but increased the production of IL-6 in response to TNF- stimulation (Figure 5B). Lastly, treatment of cells with PGE₂, forskolin, or dibutyryl cAMP in the absence of TNF- resulted in a concentration-dependent increase in IL-6 secretion from HASM cells (Figure 6). Collectively, these data strongly suggest that increased [cAMP]_i is sufficient to induce IL-6 secretion and is likely the intracellular messenger mediating the effects of PGE₂ and forskolin on IL-6 and RANTES secretion in HASM.

View larger version (11K): [in this window] [in a new window]   Figure 4.   PGE2 or forskolin treatment increases [cAMP]i in HASM cells. Growth-arrested HASM cells were treated for 30 min with 1 to 1,000 nM PGE2 or 0.1 to 10 µM forskolin and compared with vehicle-stimulated controls (basal). cAMP was measured by radioimmunoassay. Data represent means ± SE from four replicates.

View larger version (16K): [in this window] [in a new window]   Figure 5.   Pretreatment with dibutyryl cAMP, a cell-permeable cAMP analog, inhibits TNF--induced RANTES secretion from HASM cells but increases TNF--induced IL-6 secretion. Growth-arrested HASM cells stimulated with TNF- (10 ng/ml) were pretreated for 30 min with 0.2 to 1 mM dibutyryl cAMP, and compared with cells stimulated with TNF- alone. After 40 h incubation, secreted RANTES (A) and IL-6 (B) were measured by ELISA. Statistical analysis was performed using one-way ANOVA, then Fisher's PLSD multiple comparison test (* denotes a significant effect of dibutyryl cAMP pretreatment on TNF--induced RANTES or IL-6 secretion, compared with secretion from cells stimulated with TNF- alone [P < 0.05]). Data represent means ± SE from 3 to 22 replicates.

View larger version (38K): [in this window] [in a new window]   Figure 6.   Treatment with compounds that elevate [cAMP]i is sufficient to induce IL-6 secretion from HASM cells. Growth-arrested HASM cells were treated with either PGE2 (1 to 1,000 nM), forskolin (0.1 to 10 µM), or dibutyryl cAMP (0.2 to 1 mM) and compared with an untreated control (as indicated). After 40 h incubation, secreted IL-6 was measured by ELISA. Statistical analysis was performed using one-way ANOVA, then Fisher's PLSD multiple comparison test (* denotes a significant [P < 0.05] effect of treatment with PGE2, forskolin, or dibutyryl cAMP on IL-6 secretion, compared with untreated control). Data represent means ± SE from 3 to 18 replicates.

Effect of SB 207499, a Specific PDE4 Inhibitor, on the Inhibition of TNF--Induced RANTES and the Augmentation of TNF--Induced IL-6 Secretion by cAMP

Because cAMP can be hydrolyzed within cells by PDEs, and PDE4 is a prominent PDE in HASM (7), we examined the effect of SB 207499, a specific PDE4 inhibitor (12), on the modulation of TNF--induced RANTES and IL-6 secretion.

SB 207499 (10 and 100 nM) increased the inhibitory effects of PGE₂ (1 and 10 nM) on TNF--induced RANTES secretion (Figure 7A) (P < 0.05). At higher concentrations of PGE₂ (100 to 1,000 nM), where TNF--induced RANTES secretion was already significantly reduced, the effects of SB 207499 were less pronounced (data not shown).

View larger version (21K): [in this window] [in a new window]   Figure 7.   Effect of SB 207499 on the inhibition of TNF--induced RANTES and the augmentation of TNF--induced IL-6 secretion by PGE2. Growth-arrested HASM cells stimulated with TNF- (10 ng/ml) were pretreated for 30 min with indicated concentrations of PGE2 in the absence or presence of increasing concentrations of SB 207499 (1 to 100 nM). After 40 h incubation, secreted RANTES (A) and IL-6 (B) were measured by ELISA. Statistical analysis was performed using one-way ANOVA, then Fisher's PLSD multiple comparison test (* denotes a significant effect of SB 207499 on the modulation of TNF--induced RANTES or IL-6 secretion at each concentration of PGE2 [P < 0.05]). Data represent means ± SE from 3 to 20 replicates.

Although SB 207499 (10 and 100 nM) significantly increased the PGE₂-mediated inhibition of TNF--stimulated RANTES secretion, it had no effect on PGE₂-induced IL-6 secretion (Figure 7B). SB 207499 alone (1 to 100 nM) had no effect on RANTES or IL-6 secretion after TNF- stimulation (data not shown). The differential effects of SB 207499 on TNF--induced RANTES and IL-6 may be due to the apparent different sensitivities of RANTES and IL-6 to small changes in [cAMP]_i (as shown in Figures 2 and 3).

The effect of SB 207499 on the forskolin-induced inhibition of TNF--induced RANTES secretion and the augmentation of TNF--induced IL-6 secretion are shown in Figures 8A and 8B, respectively. SB 207499 (100 nM) significantly increased the inhibition of TNF--induced RANTES mediated by 1 µM forskolin (Figure 8A) (P < 0.05). At a higher concentration of forskolin (i.e., 10 µM), where there was maximal inhibition of TNF--induced RANTES secretion, augmentation of inhibition by SB 207499 was less apparent. As shown in Figure 8B, SB 207499 significantly increased TNF--induced IL-6 secretion by HASM cells in the presence of 1 to 10 µM forskolin (P < 0.05).

View larger version (29K): [in this window] [in a new window]   Figure 8.   Effect of SB 207499 on the inhibition of TNF--induced RANTES and the augmentation of TNF--induced IL-6 secretion by forskolin. Growth-arrested HASM cells stimulated with TNF- (10 ng/ml) were pretreated for 30 min with either vehicle or forskolin (0.1 to 10 µM) in the absence (filled bars) or presence of 100 nM SB 207499 (stippled bars). After 40 h incubation, secreted RANTES (A) and IL-6 (B) were measured by ELISA. Statistical analysis was performed using two-way ANOVA, then Fisher's PLSD multiple comparison test (* denotes a significant effect of SB 207499 on the modulation of TNF--induced RANTES or IL-6 secretion by forskolin, compared with cells treated with forskolin alone [P < 0.05]). Data represent means ± SE from 4 to 22 replicates.

SB 207499 (100 nM) had no effect on dibutyryl cAMP- mediated effects on TNF--induced RANTES (Figure 9A) or IL-6 secretion (Figure 9B). These results confirm that dibutyryl cAMP, a stable analog of cAMP, is resistant to the effects of PDE.

View larger version (33K): [in this window] [in a new window]   Figure 9.   Lack of effect of SB 207499 on the inhibition of TNF--induced RANTES and the augmentation of TNF--induced IL-6 secretion by dibutyryl cAMP, a PDE-resistant cAMP analog. Growth-arrested HASM cells stimulated with TNF- (10 ng/ml) were pretreated for 30 min with either vehicle or dibutyryl cAMP (0.2 to 1 mM) in the absence (filled bars) or presence of 100 nM SB 207499 (stippled bars). After 40 h incubation, secreted RANTES (A) and IL-6 (B) were measured by ELISA. Data represent means ± SE from 4 to 22 replicates.

Increased [cAMP]_i Inhibits TNF--Induced Transcription of RANTES mRNA, but Enhances That of IL-6

To further elucidate the mechanisms underlying cAMP-mediated effects on TNF--induced cytokine secretion by HASM cells, we examined RANTES and IL-6 mRNA levels using RT-PCR and RPA. As shown in Figure 10A, the total mRNA for RANTES and IL-6 was increased after TNF- stimulation. Unstimulated HASM cells expressed low levels of RANTES and IL-6 mRNA (data not shown). As also shown in Figure 10A, PGE₂, forskolin, and dibutyryl cAMP pretreatment inhibited TNF--induced transcription of RANTES mRNA but enhanced that of IL-6. This was confirmed by RPA, as shown in Figure 10B. When ratios of densitometric levels of mRNA for IL-6 and RANTES (relative to GAPDH mRNA levels) were examined, PGE₂, forskolin, and dibutyryl cAMP induced 4.7-, 4.7-, and 3.0-fold increases, respectively, in IL-6 mRNA over TNF- alone. TNF--stimulated RANTES appeared to be totally inhibited by increased [cAMP]i, as shown in Figure 10B.

View larger version (32K): [in this window] [in a new window]   Figure 10.   Increased [cAMP]i inhibits TNF--induced transcription of RANTES mRNA but enhances that of IL-6. Growth-arrested HASM cells stimulated with TNF- (10 ng/ml) were pretreated for 30 min with either: lane 1, vehicle; lane 2, 1 µM PGE2; lane 3, 10 µM forskolin; or lane 4, 1 mM dibutyryl cAMP. After 24 h incubation, cells were lysed and total mRNA prepared. (A) RT-PCR was performed using specific primer pairs to RANTES and IL-6. Smooth-muscle -actin mRNA expression shows that comparable mRNA levels were amplified in each lane. (B) RPA was performed using probes for human RANTES (unprotected probe: 388 nt; protected probe: 361 nt) and human IL-6 (unprotected probe: 211 nt; protected probe: 182 nt). GAPDH (unprotected probe: 124 nt; protected probe: 96 nt) was used as a housekeeping gene. Data shown are representative results.

Increased [cAMP]_i in HASM Cells Has No Effect on TNF--Induced NF-B DNA Binding and NF-B-Mediated Reporter Activity

Because RT-PCR and RPA suggested that the opposite effects of increased [cAMP]_i on TNF--induced IL-6 and RANTES secretion may occur at the transcriptional level, we examined the effects of TNF- and cAMP on the regulation of NF-B, a transcription factor known to mediate TNF--induced cytokine synthesis in numerous cell types, and whose activity can be modulated by increases in [cAMP]_i. As shown in Figure 11A, stimulation of HASM cells with TNF- increased NF-B DNA-binding activity. Interestingly, the addition of cAMP-elevating agents alone to HASM cells had no effect on NF-B DNA-binding activity. Moreover, TNF--induced NF-B DNA-binding activity was unaffected by pretreatment with 1 µM PGE₂ or 10 µM forskolin (Figure 11A). These results were confirmed using a NF-B-Luc reporter assay, as shown in Figure 11B, where increased [cAMP]_i in HASM neither activated NF-B-Luc nor altered TNF--induced NF-B-Luc activity. Together, these results suggest that TNF--induced IL-6 and RANTES secretion may be associated with NF-B activation and translocation, and that inhibition of TNF--stimulated RANTES secretion and augmentation of TNF--induced IL-6 secretion by increased [cAMP]_i in HASM cells does not involve NF-B.

View larger version (39K): [in this window] [in a new window]   Figure 11.   Increased [cAMP]i in HASM cells has no effect on TNF--induced NF-B DNA binding and NF-B-mediated Luc reporter activity. (A) Growth-arrested HASM cells were pretreated for 30 min with either vehicle (basal), 1 µM PGE2, or 10 µM forskolin and stimulated with TNF- (10 ng/ml) for 1 h at 37°C. The effect of 1 µM PGE2 or 10 µM forskolin alone was also assessed. Nuclear extracts were prepared and assayed for NF-B binding by EMSA. Data shown are representative results. (B) HASM cells transfected with pNF-B-Luc were growth-arrested, then pretreated for 30 min with either vehicle (basal), 1 µM PGE2, or 10 µM forskolin before 4 h incubation in the absence (filled bars) or presence of TNF- (stippled bars: 10 ng/ml) at 37°C. Cells were then harvested and Luc and -galactosidase activities assessed. Statistical analysis was performed using an unpaired t test (* denotes a significant effect of TNF- compared with basal [P < 0.05]). Data represent means ± SE from eight replicates.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

Numerous inflammatory agents important in asthma pathogenesis, as well as the principal therapy for acute asthma attacks (inhaled -agonists), are powerful regulators of cAMP production in HASM (12). cAMP is an important second messenger linked to both the regulation of contractile state and growth of airway smooth muscle (1). Because HASM has recently been shown to play a potential immunomodulatory role through diverse mechanisms, including production and secretion of chemokines and cytokines (3, 4), we examined the effect of increasing [cAMP]_i on the TNF--induced secretion of RANTES and IL-6. RANTES (13) and IL-6 (14) have been found in increased amounts in the bronchoalveolar lavage fluid of asthmatics, and both factors have been implicated as playing important roles in allergic inflammatory processes (15).

Our results demonstrated that pretreatment of HASM with cAMP-elevating agents such as PGE₂, forskolin, or dibutyryl cAMP inhibited TNF--induced RANTES secretion but increased TNF--induced IL-6 secretion. SB 207499, a specific PDE4 inhibitor, augmented the inhibition of TNF--induced RANTES induced by PGE₂ and forskolin pretreatment. Moreover, stimulation with PGE₂, forskolin, or dibutyryl cAMP alone increased IL-6 secretion in a concentration-dependent manner. Collectively, these data demonstrate that increasing [cAMP]_i in HASM effectively increases IL-6 secretion but reduces RANTES secretion promoted by TNF-.

Elevated [cAMP]_i has been shown to have numerous effects on RANTES or IL-6 production (reviewed in Ref. 5). RANTES secretion in mesangial (16) and epithelial cells (17) is inhibited by cAMP. Although cAMP augments IL-6 secretion in HeLa cells (18), mesangial cells (19), macrophages (20), and brain endothelial cells (21), IL-6 secretion is inhibited by cAMP-elevating agents in lung fibroblasts (22).

Because RT-PCR and RPA showed that the opposite effects of increased [cAMP]_i on TNF--induced IL-6 and RANTES secretion occurred at the transcriptional level, we wished to investigate the underlying transcriptional mechanisms. Increased [cAMP]_i can modulate gene expression by activating or inhibiting a variety of transcription factors (reviewed in Ref. 23). cAMP can also modulate cytokine gene expression synergistically with other mediators, such as TNF- (reviewed in Ref. 5). We examined the effects of TNF- and cAMP on regulation of the transcription factor NF-B.

NF-B is a ubiquitous transcription factor that controls gene expression of cytokines, cell adhesion molecules, and growth factors. In unstimulated cells, NF-B is sequestered in the cytoplasm in its inactive form, a result of being bound to IB. Specific NF-B-activating agents promote the phosphorylation of IB, causing its degradation by proteosomes and other proteases. This proteolyic degradation activates NF-B by releasing it from its inactive IB-bound state, allowing NF-B to translocate into the nucleus. In nuclei, NF-B can initiate or modulate gene transcription by binding to the decameric B motif found in the promoter regions of specific genes.

The RANTES promoter region contains a variety of DNA binding sites, including B (24). Numerous studies of diverse cell types (25, 26) have demonstrated that transcription of the RANTES gene after stimulation with TNF- is NF-B-dependent. However, some stimulus-specific differences (27) and synergistic cooperation between NF-B and other transcription factors, such as activator protein (AP)-1 (27) and signal transducer and activator of transcription 1 (28), exist. Transcriptional regulation of IL-6 exhibits more cell-type and stimulus specificity than does RANTES regulation (29), but the NF-B-mediated pathway is thought to represent a major pathway mediating TNF--induced IL-6 secretion (30). However, it should be noted that a variety of other transcription factors, such as AP-1, CCAAT/enhancer-binding protein, and cAMP response element binding protein (CREB), can also interact with transcriptional binding elements in the IL-6 promoter (18). In the present study we show that TNF- stimulated NF-B activity and translocation in HASM cells. These results are consistent with previous reports from our laboratory (10, 11). Because TNF- stimulation also increased mRNA expression and protein levels for RANTES and IL-6, our collective data suggest that TNF--induced IL-6 and RANTES secretion is associated with NF-B activation.

NF-B can be regulated directly by cAMP, although the effects of elevated [cAMP]_i on NF-B activity are cell-specific. In mesangial cells, cAMP-elevating agents attentuated NF-B DNA binding (31) and inhibited intracellular cell adhesion molecule-1 and RANTES secretion (16). In contrast, cAMP induced  immunoglobulin light chain synthesis through a B binding element (32); and in HL-60 cells (33), cAMP-elevating agents increased NF-B DNA binding, although the increase in NF-B activity was less in differentiated THP-1 cells and monocytes. In murine monocytes (34), [cAMP]_i levels are correlated with binding of NF-B to B elements and increased IL-6 expression. These studies show that cAMP can either inhibit or stimulate NF-B, and suggest that the effects of cAMP on NF-B activity are unique to the cell type examined. Therefore, we investigated whether an effect of cAMP-elevating agents on NF-B activity could explain either the inhibition of TNF--induced RANTES secretion or the augmentation of TNF--induced IL-6 observed in HASM cells. We found that increased [cAMP]_i in HASM did not activate NF-B-Luc or affect NF-B DNA-binding activity. Moreover, cAMP-elevating agents did not alter TNF--induced NF-B-Luc activity or NF-B DNA binding. Our results in airway smooth muscle are consistent with a recent study performed using coronary artery smooth-muscle cells (35), where activation of NF-B was unaffected by elevated [cAMP]_i. These data demonstrate that inhibition of TNF--stimulated RANTES secretion and augmentation of IL-6 secretion by increased [cAMP]_i in HASM cells is not via an effect on NF-B. Although the identities of transcription factors involved are unclear at present, and further studies using RANTES and IL-6 promoter deletion constructs will be necessary to further delineate other transcription factors that may be involved in this complex response, possible candidates include AP-1 (27) and CREB (19).

In summary, we have demonstrated for the first time that increases in [cAMP]_i in HASM cells induce opposite effects on the transcriptional control of TNF--induced RANTES and IL-6 secretion. Although TNF--induced IL-6 and RANTES secretion may be associated with NF-B activation, we have excluded the possibility that the inhibition of TNF--stimulated RANTES secretion and augmentation of IL-6 secretion by increased [cAMP]_i in HASM cells occurs via an NF-B-dependent mechanism. These results suggest that cAMP plays a major role in the modulation of TNF--stimulated cytokine production.