help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kobayashi, H.
Right arrow Articles by Jones, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kobayashi, H.
Right arrow Articles by Jones, R. C.
Am. J. Respir. Cell Mol. Biol., Volume 24, Number 4, April 2001 390-397

Antiinflammatory Properties of Inducible Nitric Oxide Synthase in Acute Hyperoxic Lung Injury

Hirosuke Kobayashi, Ryuji Hataishi, Hisashi Mitsufuji, Masumi Tanaka, Margaretha Jacobson, Tomoyuki Tomita, Warren M. Zapol, and Rosemary C. Jones

Department of Medicine, Kitasato University School of Medicine, Kanagawa, Japan; and Department of Anaesthesia and Critical Care, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts

    Abstract
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The objective of this study was to determine whether endogenous nitric oxide (NO), specifically the inducible NO synthase isoform (iNOS: NOS II), reduces or amplifies lung injury in mice breathing at a high oxygen tension. Previous studies have shown that exogenous (inhaled) NO protects against hyperoxia-induced lung injury, and that endogenous NO derived from iNOS inhibits leukocyte recruitment and protects against lung injury induced by lipopolysaccharide. In the present study, hyperoxia (> 98% O2 for 72 h) induced acute lung injury in both wild-type and iNOS-deficient mice as determined by elevated albumin and lactate dehydrogenase levels in bronchoalveolar lavage fluid (BALF) and by increased extravascular lung water. Lung injury was greater in iNOS-deficient mice than in wild-type mice and was associated with an increased number of polymorphonuclear leukocytes in BALF. iNOS messenger RNA expression levels increased in the lungs of wild-type hyperoxic mice. Nitrotyrosine, a marker of reactive NO species, was expressed in both wild-type and iNOS-deficient mice in hyperoxia, indicating an iNOS-independent pathway for protein nitration. We conclude that iNOS is capable of reducing pulmonary leukocyte accumulation and lung injury. The data indicate that iNOS induction serves as a protective mechanism to minimize the effects of acute exposure to hyperoxia.

    Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cell-derived nitric oxide (NO) may enhance inflammatory lung injury reacting with O2 to form the cytotoxic compound nitrogen dioxide, and with superoxide to form the highly reactive molecule peroxynitrite to result in tissue nitration (1), impaired enzyme system function, and cytotoxicity (2). Alternatively, as antioxidants, both exogenous and endogenous NO may reduce injury by counteracting the cytotoxic effects of reactive oxygen species (2). Cell-derived NO is produced by three NO synthase (NOS) isoforms: NOS I, II, and III. On the basis of data demonstrating its induction by proinflammatory cytokines and the generation of high NO levels (2) NOS II, the inducible isoform (iNOS), is considered important in the inflammatory response. Constitutive expression of iNOS in the lung (5, 6) may increase directly in response to injury, or indirectly via expression of the iNOS-inducing cytokines tumor necrosis factor (TNF)-alpha (7) and interleukin (IL)-1beta (8, 9). iNOS-derived NO protects against lung injury induced by intravenous administration of lipopolysaccharide (LPS) (6) but whether it enhances or reduces oxidant-induced lung injury is not known.

The objective of this study was to determine whether the iNOS isoform protects against acute continuous exposure to 100% oxygen in a well-described in vivo model of lung injury (10). Prolonged exposure to this oxygen tension typically induces pulmonary edema and an inflammatory cell infiltrate (14, 15). A second objective was to identify sites of tissue nitration, using nitrotyrosine (a product of reactive NO species) as a marker, and from this to determine whether iNOS isoform-derived NO exacerbates tissue nitration in hyperoxia. This pathway of iNOS formation and the generation of peroxynitrite is suspected in patients who develop idiopathic pulmonary fibrosis (16).

To identify the role of iNOS in hyperoxia-induced lung injury, we used mice obtained from a colony established by MacMicking and colleagues in which the NOS isoforms I and III are present but functional iNOS (NOS II) activity is absent (17), as also judged by an altered response to LPS or infection (6, 17). We assessed the number of inflammatory cells and the albumin and lactate dehydrogenase (LDH) levels in bronchoalveolar lavage fluid (BALF), extravascular lung water and dry lung weights and extravascular wet-to-dry weight ratio, and cellular sites of iNOS protein and nitrotyrosine expression within the normoxic and hyperoxic lung.

    Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

General Protocol

These studies were approved by the Subcommittee on Research Animal Studies of the Massachusetts General Hospital, and conformed with the Guide for the Care and Use of Laboratory Animals published by the U.S. National Institutes of Health.

We established a colony of iNOS gene-disrupted mice from animals provided by Dr. Carl Nathan (Cornell University Medical School, New York, NY) and Dr. John Mudgett (Merck Research Laboratories, Whitehouse Station, Rahway, NJ). These mice were generated from a C57BL/6J blastocyte injected with a recombinant SV129 ES cell lacking the promoter and exons 1 through 4 of the iNOS-gene (17). Because of the mixed genetic background of these iNOS-deficient mice our wild-type mice were an F1 hybrid of C57BL/6J and SV129 (Jackson Laboratory, Bar Harbor, ME). On the basis of a lack of functional iNOS activity, MacMicking and colleagues originally described the iNOS 5' region-deleted mice as iNOS-deficent (17). Because our mice were genetically identical we continued to term them iNOS-deficient, although in the present study we demonstrate absence of the 5' region of the iNOS gene and expression of the 3' region.

Wild-type mice were randomly assigned into groups that subsequently breathed air or > 98% O2 continuously at normobaric pressure (wild-type normoxia and wild-type hyperoxia groups, respectively): iNOS-deficient mice were similarly assigned to iNOS-deficient normoxia and iNOS-deficient hyperoxia groups. These mice were 4 to 6 wk old (between 16 and 30 g body weight), and age-matched mice were used in all studies.

To breathe > 98% O2, mice were placed in cages inside a Plexiglas chamber (a consumption-dependent, flow-through system consisting of a main chamber and air lock) as was used previously (7, 20). The main chamber was filled with 100% O2, the cages were placed in the air lock of the exposure chamber, and the air lock was flushed with 100% O2. When the air lock and main chamber had equilibrated (> 85% O2) the cages were moved into the main chamber through the connecting door and the main chamber was flushed with 100% O2 until (within minutes) an O2 sensor recorded > 98%. The flow of oxygen into the main chamber was adjusted (relative to the number of mice) to maintain the O2 concentration at > 98% and to prevent any buildup in humidity (condensation). The O2 sensor confirmed that it remained constant, i.e., once the exposure started the mice were not subjected to fluctuation in the oxygen level. We had continuous access to the animals via gloved portholes.

We evaluated the time course of iNOS expression by reverse transcriptase/polymerase chain reaction (RT-PCR) in lung homogenates from mice breathing air or > 98% O2 for 6, 24, 48, and 72 h. For all other studies, we examined the response to > 98% O2 for 72 h because this exposure is known to cause pulmonary edema and an inflammatory cell infiltrate (14, 15) and because this fell short of the time reported for 50% survival (4 to 6 d) at this concentration (9). In an initial study we confirmed a survival time of 135 ± 3.6 h (mean ± standard error of the mean [SEM]) for wild-type mice exposed to > 98% O2 (n = 24). Thus, in our studies, as in others (9, 23), no wild-type mice died before 72 h, and no iNOS-deficient mice died before 72 h.

Mice were anesthetized (xylazine and ketamine: 20 and 50 mg/kg, respectively, intraperitoneally) and killed by severing the abdominal aorta.

RT-PCR of Lung Homogenates

Lung tissue samples (~ 100 mg) from two mice in each group were homogenized in guanidine and phenol (Isogen; Nippon Gene, Toyama-shi, Toyama, Japan), total RNA was extracted according to the manufacturer's instructions, and the final RNA concentration was determined (DU-640 Spectrophotometer; Beckman Instrument, Fullerton, CA).

Complementary DNA (cDNA) was synthesized by reverse transcription using a SuperScript Preamplification System (Life Technologies GIBCO BRL, Rockville, MD). Briefly, the reaction solution (total 19 µl: 3 µg of total RNA in 11 µl diethylpyrocarbonate-treated water, 1 µl oligoDT, 2 µl PCR buffer, 2 µl 25 mM MgCl2, 1 µl 10 mM deoxynucleotide triphosphate mix, and 2 µl 0.1 M dithiothreitol) supplemented with 0.5 µl ribonuclease (RNase) inhibitor (RNasin; Promega Corp., Madison, WI) was incubated at 42°C (5 min), 1 µl (200 units) of SuperScript II RT was added, and subsequent reactions were carried out at 42°C for 50 min followed by heating at 70°C (15 min) to terminate the reaction. The residual RNA was catalyzed by incubating with 1 µl of RNase H (Life Technologies GIBCO BRL) at 37°C (20 min), and the final cDNA products were stored at -20°C.

cDNA aliquots (1 µl) were amplified in 1× PCR buffer (5 µl 10× PCR buffer in a total of 50 µl), a 200 µM mix of deoxynucleotide (GeneAmp dNTP Mix; Perkin-Elmer Applied Biosystems, Branchburg, NJ), and 100 pmol each of the specific 5' and 3' starter primers using a PCR amplifier (PTC-200 DNA Engine; MJ Research, Inc., Watertown, MA). We used two pairs of primers. For the 5' region, an upper primer was designed to cover exons 4 and 5 and the junction because exons 1 through 4 were deleted in our iNOS-deficient mice (17). On the basis of a homology analysis of human iNOS exon 4 (x85762) and exon 5 (x85763) with mouse iNOS (U43428), the junction of exons 4 and 5 of mouse iNOS was identified, and we used an upper primer sequence (5'-3') AGGCCACATCGGATTTCAC that covers exons 4 and 5 through the junction and a lower primer sequence of GCATTCCTCCAGGCCATCT with a final PCR product of 283 base pairs (bp). For the 3' region, we used a mouse iNOS primer set (Cat# 5475-1,-3; Clontech Laboratories, Palo Alto, CA) that does not create PCR products by amplifying genomic DNA with a final PCR product of 496 bp. As an internal control, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA was amplified using GGTGAAGGTCGGTGTCAACGGATTT and GATGCCAAAGTTGTCATGGATGACC as upper and lower primer sequences (24) with a final PCR product size of 502 bp. Briefly, AmpliTag Gold (Perkin Elmer Applied Biosystems) was added to each tube (2.5 U) during the first hot-start step (95°C for 9 min), with each cycle consisting of heat denaturation and primer-annealing and -polymerization at 94°C for 30 s and 70°C for 1 min, respectively (36 cycles for both the 5' and 3' regions of iNOS, and 25 cycles for GAPDH, to ensure amplification in the exponential range). Aliquots of PCR products normalized to give signals equivalent to the GAPDH cDNA were electrophoresed through 2% agarose (NuSieve; FMC BioProducts, Rockland, ME) containing 0.5 g/ml ethidium bromide. Gels were visualized under ultraviolet light and digital images captured using a CCD camera system (FAS-III; Toyobo, Chuo-ku, Tokyo, Japan).

BALF

Lungs were lavaged (0.035 ml/g × g body weight, five times) with endotoxin-free saline (Addipak; Hudson RCI, Temecula, CA). BALF samples from eight mice in each group (i.e., a total of 32 mice) were collected on ice and centrifuged (× 1,500 rpm for 5 min at 4°C). The supernatant was stored frozen for LDH and albumin assays (-60°C). After resuspension of the cell pellet in phosphate-buffered saline (PBS) (0.5 ml), the total number of nucleated cells was counted in a hemocytometer using trypan blue dye exclusion to confirm viability. PBS (~ 4.5 ml) was added to the remaining cell suspension and cytospin preparations were made by placing 0.3 ml in each funnel of a Cytospin II (Shandon, Cheshire, UK; × 1,200 rpm for 4 min). The cells were stained with Leukostat (Fisher Scientific, Pittsburgh, PA) and a differential leukocyte count was performed.

Extravascular Lung Water Weight, Dry Lung Weight, and Wet-to-Dry Weight Ratio

Extravascular lung water and dry lung weights and a wet-to-dry weight ratio corrected for pulmonary blood volume (25) were obtained for five mice in each group (i.e., a total of 20 mice). Briefly, > 0.15-ml aliquots of lung homogenate (prepared by adding 0.4 ml distilled water [dH2O] to 0.2 g lung fragments) and 0.15-ml aliquots of whole blood from the abdominal aorta were weighed and dried (at 60°C for 72 h). Other aliquots of homogenates were centrifuged (× 15,000 rpm for 30 min) and 0.45 ml of the supernatant was cleared by adding 0.05 ml of 10% sodium lauryl sulfate (Sigma, St. Louis, MO). The supernatant mixture (100 µl) and whole blood (10 µl) were each mixed with the reaction solution (2.5 ml) from a commercial kit (HbWako; Wako, Osaka, Japan), and the hemoglobin concentrations were measured by a cyanomethemoglobin technique (DU-64 Spectrophotometer; Beckman Instrument).

Tissue Preparation and Immunohistochemistry of iNOS and Nitrotyrosine

The hearts and lungs of five mice in each group (i.e., a total of 20 mice) were exposed via a midline incision through the sternum, the pulmonary veins were ligated, and the lungs were inflated with 4% paraformaldehyde in PBS via polyethylene catheters in the trachea and main pulmonary artery (at 100 and 23 cm H2O, respectively) (26). The lungs were removed and fixed for an additional 3 h. To confirm even distribution of the histologic findings, tissue was excised from the right cardiac and diaphragmatic lobes and from the single-lobed left lung and stored in fixative at 4°C overnight. The tissue blocks were washed in water (2 h), rinsed in dH2O (2 h), dehydrated in ethanol, cleared in toluene, and embedded in paraffin wax. Sections, 4 µm thick, were deparaffinized, hydrated in ethanol, rinsed in dH2O (5 min), and quenched in a humid chamber (3% H2O2 in absolute methanol for 10 min). After rinsing in PBS (three 5-min rinses), they were treated with normal serum (10 min) and incubated overnight at 4°C with an antibody to iNOS (1:125 in PBS rabbit polyclonal immunoglobulin [Ig] G from Alexis Biochemicals Corp., San Diego, CA; 1:100 in PBS from Transduction Laboratory, Lexington, KY; or 1:100 in PBS SA-200 from Biomol Research Labs, Plymouth Meeting, PA) or nitrotyrosine (1:100 in PBS rabbit polyclonal IgG from Upstate Biotechnology, Lake Placid, NY). Using reagents from a commercial kit (Histostain SP kit; Zymed Laboratories Inc., South San Francisco, CA) the sections were treated with a secondary antibody (biotinylated goat antirabbit IgG) and an enzyme complex, reactive sites were visualized with aminoethylcarbazole, and the sections were counterstained with hematoxylin. The chromogen produces a red reaction product. The distribution of immunoreactive cells was the same in sections stained with each iNOS antibody.

The iNOS antibodies used in this study did not cross-react with neuronal (NOS I) or endothelial NOS (NOS III) by Western analysis (see Manufacturer's Data Sheets). We ran additional preadsorption experiments to confirm the specificity for the NOS isoform. For this we used the Biomol antibody raised against a mouse macrophage C-terminal NOS II peptide (amino acids 1131-1144 with an N-terminal cysteine) because a control blocking peptide (N-acetyl-Cys-Lys-Lys-Gly-Ser-Ala-Leu-Glu-Glu-Pro-Lys-Ala-Thr-Arg-Leu-NH2) was available (SA200 and SP200, respectively; Biomol Research Labs). After preincubation of the antibody with the peptide (for 24 h at 4°C and at a concentration recommended by the manufacturer) no immunoreactive sites were detected in tissue. The peptide-to-antibody ratio and the length of the binding incubation are two variables that influence blocking (see Manufacturer's Data Sheet). In a previous study, using the same peptide-to-antibody ratio as in the present study, we established that the control peptide blocks immunoreactivity to the iNOS antibody after 24 h preabsorption (22).

Sections of lung tissue from rats exposed to chronic hyperoxia were used as a positive control for iNOS immunoreactivity, the alveolar macrophages of these animals being intensely stained (22). As a positive control for nitrotyrosine staining, the sections were quenched (3% H2O2 ), washed in PBS (three times), and incubated (for 2 h at 37°C) in a 1 mM peroxynitrite solution (Upstate Biotechnology).

As a negative control, nonimmune IgG was applied to the lung section instead of the primary iNOS antibody. Negative controls for nitrotyrosine staining included: (1) preadsorption of the nitrotyrosine antibody by incubation with 20 mM of authentic nitrotyrosine, and (2) the application of nonimmune IgG to the lung section instead of the primary antibody. No reactive sites were detected in these negative control sections.

To exclude the possibility of endogenous peroxidase leading to tyrosine nitration in the presence of intrinsic nitrite during quenching (27), or of the conversion of aminotyrosine to nitrotyrosine in the presence of intrinsic copper during quenching (28), tissue sections were flooded with three washes (20 s each) of 1 M sodium hydrosulfite (adjusted to pH 9.0 to 9.5 with 2 N NaOH), and quenched with 3% H2O2 before being stained for nitrotyrosine. No reactive sites were detected in the control sections, confirming the absence of artifactual production of nitrotyrosine. To determine whether the nitrotyrosine antibody cross-reacted with tissue-derived chlorotyrosine (a by-product via peroxidase), we incubated peroxynitrite-treated sections (rich in nitrotyrosine) in the nitrotyrosine antibody after its preadsorption with 20 mM authentic chlorotyrosine. Reactive sites confirmed the absence of cross-reactivity with chlorotyrosine.

Statistical Analysis

Values are expressed as means ± standard deviation (SD) unless otherwise stated. One-way analysis of variance (ANOVA) with Scheffé's post hoc test was used to detect differences among the four groups of mice save for LDH levels. For this we used an unpaired t test to compare the values obtained for the two hyperoxia groups of mice because LDH was undetected in either of the normoxia groups. P values less than 0.05 were considered significant.

    Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

RT-PCR of Lung Homogenates

Semiquantitative RT-PCR using primers for the 5' region of iNOS messenger RNA (mRNA) detected iNOS expression in the lungs of untreated wild-type mice and enhanced expression after 24 h of hyperoxia. No iNOS mRNA was detected in iNOS-deficient mice (Figure 1).


View larger version (35K):
[in this window]
[in a new window]
 
Figure 1.   Using primers targeting the 5' region of iNOS mRNA, semiquantitative RT-PCR detected expression in the lungs of all groups of wild-type mice, expression being enhanced between 24 h and 72 h in hyperoxia. No expression was detected at the start or at the end (72 h) of hyperoxia in the iNOS-deficient mice. A size marker is shown (left lane) and equal lane loading by GAPDH expression (below).

Because of unexpected iNOS immunoreactivity in iNOS-deficient mice (see later text) we performed RT-PCR using primers targeted to either the 3' region of iNOS mRNA (the region with no deleted exons) or to the 5' region (the region with exon 4 deleted). Primers for the 3' region detected iNOS mRNA in both the wild-type and the iNOS-deficient mice (Figure 2).


View larger version (30K):
[in this window]
[in a new window]
 
Figure 2.   RT-PCR and primers targeting the 5' or 3' regions of iNOS mRNA detected expression of both in wild-type mice and expression of the 3' region alone in iNOS-deficient mice.

Cell Counts, Albumin, and LDH Levels in BALF

Values for the total and differential cell counts and the albumin level in BALF were similar in the two normoxia groups (Table 1). In the wild-type hyperoxia group the total cell count was decreased (Table 1) due to a fall in the number of alveolar macrophages (Figure 3), whereas BALF albumin levels were increased and LDH was detected (Table 1). In the iNOS-deficient hyperoxia group the number of alveolar macrophages also fell but the total number of cells was maintained by an increase in polymorphonuclear leukocytes (PMNs) (Figure 3), and BALF albumin and LDH levels were increased as compared with the wild-type hyperoxia group (Table 1).

                              
View this table:
[in this window]
[in a new window]
 

TABLE 1
BALF measurements


View larger version (36K):
[in this window]
[in a new window]
 
Figure 3.   The total cell counts in BALF were similar in the normoxia groups of mice, and in both groups all of the cells were alveolar macrophages. Fewer of these cells were recovered from the lungs of mice in the wild-type hyperoxia group. Similarly, in the iNOS-deficient hyperoxia group, fewer alveolar macrophage were recovered but the total cell count was maintained by an increase in the number of PMNs. PAMs, pulmonary alveolar macrophages. *P < 0.05 comparing wild-type normoxia and wild-type hyperoxia groups; $$ P < 0.01 comparing iNOS-deficient normoxia and iNOS-deficient hyperoxia groups; dagger dagger P < 0.01 comparing wild-type hyperoxia and iNOS-deficient hyperoxia groups.

Extravascular Lung Water and Dry Lung Weights and Wet-to-Dry Weight Ratio

Lung weights, extravascular lung water and dry lung weights, and the extravascular wet-to-dry weight ratios were similar in the two normoxia groups (Table 2). In the wild-type hyperoxia group, lung weight and extravascular lung water and dry lung weights increased but the ratio was unchanged. By contrast, in the iNOS-deficient hyperoxia group each of these values increased, the increase in lung weight and extravascular lung water weight being greater than in the wild-type hyperoxia group (Table 2).

                              
View this table:
[in this window]
[in a new window]
 

TABLE 2
Extravascular lung water weight and extravascular wet-to-dry ratio

Immunohistochemistry of iNOS and Nitrotyrosine

Bronchial and bronchiolar epithelial cells, and some alveolar type II cells (Figure 4), expressed iNOS in the wild-type mice, the number of immunoreactive alveolar type II cells being greater in hyperoxia (Figure 4). iNOS antibodies from Alexis Biochemicals, Transduction Laboratory, and Biomol Research Labs) detected iNOS reactivity in the iNOS-deficient mice (data not shown). This finding, and data showing detection of the 3' region of iNOS mRNA in the lung tissue of the iNOS-deficient mice (see earlier text), indicated the presence of an incomplete, nonfunctioning, shorter iNOS protein that contains an epitope detected by these antibodies, all of which are directed to the C-terminal (3' region) of iNOS protein.


View larger version (110K):
[in this window]
[in a new window]
 
Figure 4.   iNOS protein expression in (i) a large airway, (ii) a peripheral airway, and (iii) alveoli in wild-type normoxic and hyperoxic (> 98% O2 for 72 h) mice. In both groups, bronchial and bronchiolar epithelial cells and alveolar type II cells expressed iNOS. More alveolar type II cells were immunoreactive after hyperoxia. Alveolar macrophages did not express iNOS in either group. (A) Large airway in wild-type normoxia group; (B) large airway in wild-type hyperoxia group; (C) peripheral airway in wild-type normoxia group; (D) peripheral airway in wild-type hyperoxia group; (E) alveoli in wild-type normoxia group; (F ) alveoli in wild-type hyperoxia group. The calibration bar represents 50 µm.

Nitrotyrosine was weakly expressed by bronchial (Figure 5) and bronchiolar epithelial cells, and by a few alveolar type II cells, in both normoxia groups (Figures 5 and 6) and was increased in both hyperoxia groups (Figures 5 and 6). Increased numbers of PMNs were evident in the lungs of the iNOS-deficient hyperoxia group but these cells did not express nitrotyrosine (Figure 5).


View larger version (105K):
[in this window]
[in a new window]
 
Figure 5.   Nitrotyrosine expression in large airways of normoxic and hyperoxic (> 98% O2 for 72 h) mice. In both the wild-type normoxia and iNOS-deficient normoxia groups, weak nitrotyrosine expression was detected in bronchial epithelial cells (A and C; see arrows). In both the wild-type hyperoxia and iNOS-deficient hyperoxia groups, nitrotyrosine expression increased in bronchial epithelial cells (B and D; see arrows). In the lungs of the iNOS-deficient hyperoxia mice, PMNs mainly in the perivascular space did not express nitrotyrosine (E, F, and G). (A) Large airway in wild-type normoxia group; (B) large airway in wild-type hyperoxia group; (C) large airway in iNOS-deficient normoxia group; (D) large airway in iNOS-deficient hyperoxia group; (E and F ) leukocytes of iNOS-deficient hyperoxia group in the perivascular space; (G) a PMN close to bronchial epithelia. The calibration bar represents 50 µm.


View larger version (83K):
[in this window]
[in a new window]
 
Figure 6.   Nitrotyrosine expression in bronchiolar cells and alveoli of normoxic and hyperoxic (> 98% O2 for 72 h) mice. In the wild-type normoxia and iNOS-deficient normoxia groups, only weak nitrotyrosine expression was detected in bronchiolar epithelial cells and in the occasional alveolar type II cell. In the wild-type hyperoxia and iNOS-deficient hyperoxia groups, nitrotyrosine expression increased in both bronchiolar epithelial cells and alveolar type II cells. (A) Peripheral airway in wild-type normoxia group; (B) peripheral airway in wild-type hyperoxia group; (C) peripheral airway in iNOS-deficient normoxia group; (D) peripheral airway in iNOS-deficient hyperoxia group; (E) alveoli in wild-type normoxia group; (F ) alveoli in wild-type hyperoxia group; (G) alveoli in iNOS-deficient normoxia group; (H ) alveoli in iNOS-deficient hyperoxia group. The calibration bar represents 50 µm.

    Discussion
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The new findings in this study include: (1) Depletion of the 5' region of the iNOS gene in mice is associated with a high leukocyte count and exacerbates hyperoxia-induced lung injury, as determined by elevated albumin and LDH levels in BALF and by the increased extravascular lung water level. (2) In the wild-type group a reduced level of lung injury was associated with increased levels of iNOS mRNA expression in the absence of leukocyte recruitment. (3) Increased nitrotyrosine expression in both the iNOS-deficient and wild-type mouse lungs indicates that an iNOS-independent pathway is active in hyperoxia-induced acute lung injury.

The response to hyperoxia is known to differ among mouse strains (9) and we cannot exclude that background inhomogeneity of genes expressed by the iNOS-deficient (C57BL/6J × SV129) and wild-type mice (F1 generation of C57BL/6J and SV129) represents a contributing factor in the present study. On the basis of a mean survival time of 86.4 h for C57BL/6 and 114.5 h for SV129/J mice in > 95% O2 (9), the survival time of our wild-type mice indicates greater tolerance by the hybrid (135.0 ± 3.6 h, mean ± SEM; n = 24). Inasmuch as our mice were only 4 to 8 wk old, increased tolerance may also be age-related (29). The absence of PMNs in the lungs of the wild-type mice, which may reflect the relatively slower rate of recruitment in young animals (30), likely also contributed to increased tolerance.

Our finding of the expression of an iNOS epitope in the iNOS-deficient animals is supported by a study of cerebral ischemia in iNOS-deficient mice (31) derived from the same colony as ours. Glial cultures exposed to cytokines displayed a molecular mass of ~ 112 kD close to that predicted (116 kD) if the first 113 amino acids (exons 1 through 4) of iNOS were absent and, on the basis of nitrite/nitrate levels released by the glial cells, the expressed iNOS were nonfunctional (31). The iNOS protein is a didomain enzyme with an N-terminal oxygenase domain, containing binding sites for L-arginine and heme and a C-terminal reductase domain containing binding sites for flavin mononucleotide, flavin adenine dinucleotide, and nicotinamide adenine dinucleotide phosphate (NADPH). The shorter iNOS mRNA expressed in the iNOS-deficient mice is predicted to reserve the reductase domain without the oxygenase domain (31), and, because activity is dependent upon dimerization (32), would thus be nonfunctional. Because the iNOS promotor and exons 1 through 4, including the start codon ATG on exon 2, were deleted, it may be that transcription of nondeleted exons in the 3' region occurs through another pathway---possibly from an ATG codon at bases 524-526 with the same reading frame as the wild-type gene but with the same termination codon, resulting in the expression of a shorter protein fragment.

Although translation of this altered gene product results in a nonfunctional NOS, the possibility of alternate functions for the shorter protein cannot be excluded. The reductase domain of NOS is capable of catalyzing the transfer of electrons from NADPH to a variety of exogenous acceptors, and, if such an acceptor is oxygen, electron transfer to oxygen will produce superoxide. Recent evidence suggests that the NOS reductase domains are poor superoxide generators, however, because they are slow to transfer electrons from the reductase domain in the absence of an oxygen binding site to dissolved oxygen (33).

iNOS Protects against Leukocyte Recruitment in Hyperoxic Lung Injury

The lung is unusual in that, in contrast to most other organs, iNOS is expressed constitutively (6, 34) although expression levels are relatively weak. Depending upon the species, bronchial epithelial cells, alveolar type II cells, and interstitial and alveolar macrophages each express iNOS protein (5, 22, 35, 36). In the wild-type mice included in the present study, iNOS was expressed constitutively by each of these cell types save alveolar macrophages, and in response to hyperoxia the expression of iNOS increased in the epithelial type II cells. Our finding that hyperoxic lung injury is enhanced in the iNOS-deficient mice, and previous data (6), suggest that the increased iNOS expression levels in wild-type mice protect the lung from an influx of PMNs and from PMN-associated injury.

Increased iNOS expression by type II cells in the wild-type hyperoxia group indicates that these cells play a role in inhibiting PMN sequestration and PMN-dependent lung injury. Further evidence for this is provided by restoration of the deformability of zymosan-treated PMNs by NO-generating compounds, and prevention of the expression of adhesion molecules in pulmonary vessels and PMN accumulation in the lung by inhaled NO (37). Because most type II cells are located at the corners of alveoli, close to pulmonary arterioles (before their division into capillaries), NO derived from iNOS in these cells may promote the passage of PMNs through narrow capillary channels by retaining their ability to deform. The accumulation of PMNs in the hyperoxia-injured lung would thus be suppressed by NO derived from increased type II cell expression of iNOS. Direct tracheal instillation of TNF-alpha (38) or IL-1 (39) protects against oxygen toxicity, and several proinflammatory cytokines induced in hyperoxia, including TNF-alpha and IL-1beta (7), initially attract PMNs into the lung but then induce iNOS activity which suppresses PMN accumulation. In line with this, induction of iNOS via these cytokine pathways, as well as the protective effect of antioxidant enzymes, likely also contributes to the response reported herein.

Our finding that iNOS expression was not expressed in alveolar macrophages in acute hyperoxia is in contrast to our previous findings (22) in a rat model of chronic exposure (1 to 4 wk at 87% O2). To confirm this finding, we extracted mRNA from alveolar macrophages obtained from mice in our model by purifying the mRNA through an oligo-dT column, and amplified the derived cDNA by RT-PCR for 80 cycles. We were unable to detect iNOS mRNA in either normoxic or hyperoxic lung tissue despite marked expresssion of GAPDH as an internal control (data not shown). These findings suggest that in a mouse model of acute hyperoxia-induced lung injury the contribution of alveolar macrophage-derived iNOS is negligible.

iNOS Offers No Protection against Leukocyte-Independent Hyperoxic Lung Injury

Nitrotyrosine is considered a footprint of peroxynitrite (a potent reactive product of NO and superoxide anion) and a marker of an NO-dependent pathway of nitration (40). And in the lungs of rats exposed to 100% O2 for 60 h, large amounts of nitrotyrosine have been found (41). The similarity in distribution of nitrotyrosine-expressing cells, however, in wild-type and iNOS-deficient mice exposed to pathogens (42), and to hyperoxia in our study, suggests a common pathway of injury independent of peroxynitrite generation. Recent studies suggest that nitrotyrosine can be produced by alternative pathways in which tyrosyl radicals and nitrite are generated simultaneously (27), the tyrosyl radicals being produced by a variety of enzymes and presenting susceptible sites for nitration by nitrite. In an important alternate (and peroxidase-dependent) pathway, nitrotyrosine is generated by tyrosine acting as a substrate for peroxidases, e.g., myeloperoxidase (43), eosinophil peroxidase, bronchial epithelial cell lactoperoxidase (27), or peroxisome-derived peroxidases.

Nitrotyrosine expression and lung injury in the iNOS-deficient mice may occur via an NO-dependent pathway, through NO generation via another NOS isoform, or via a peroxidase-dependent pathway and the generation of heme-containing peroxidases. Although PMN-derived myeloperoxidase may generate nitrotyrosine (43) there was no evidence that this occurred in the present study because PMNs did not infiltrate the lungs of wild-type mice and in the iNOS-deficient mice, despite high numbers, these cells failed to express nitrotyrosine. Given the importance of this pathway, further studies are warranted to confirm that PMN-generated myeloperoxidase does not contribute to pulmonary production of nitrotyrosine in hyperoxia. In both the wild-type and iNOS-deficient mice, NOS I or III or peroxidase derived from bronchial epithelial or type II cells may be responsible for tyrosine nitration in hyperoxia, and NOS I- or III-derived NO or blood may provide a sufficient amount of nitrite for nitrotyrosine formation via the peroxidase pathway. Given that nitrotyrosine is a general marker of reactive NO species and/or tyrosyl radicals susceptible to nitration by nitrite, and of the nitration of cellular components that result in cell injury, our data indicate the presence in the mouse of an iNOS-independent pathway of lung nitration and injury in hyperoxia. The mechanism of iNOS-independent lung injury in hyperoxia that is associated with leukocyte accumulation warrants further investigation.

In conclusion, iNOS expression increased in response to hyperoxic exposure, which resulted in reduced leukocyte accumulation in the lungs and less lung injury. Nitration of lung tissue in hyperoxia was independent of iNOS. These results suggest that iNOS-derived NO can protect against hyperoxic lung injury, because the absence of iNOS exacerbates acute lung injury.

    Footnotes

Address correspondence to: Hirosuke Kobayashi, M.D., Dept. of Medicine, Kitasato University School of Medicine, Kitasato 1-15-1, Sagamihara, Kanagawa 228-8555, Japan. E-mail: hiro{at}kitasato-u.ac.jp

(Received in original form April 18, 2000 and in revised form August 1, 2000).

Abbreviations: bronchoalveolar lavage fluid, BALF; complementary DNA, cDNA; glyceraldehyde-3-phosphate dehydrogenase, GAPDH; immunoglobulin, Ig; inducible NOS, iNOS; lactate dehydrogenase, LDH; messenger RNA, mRNA; nitric oxide, NO; NO synthase, NOS; phosphate-buffered saline, PBS; polymorphonuclear leukocyte, PMN; reverse transcriptase/ polymerase chain reaction, RT-PCR; standard deviation, SD.

Acknowledgments: The authors express their gratitude to Dr. K. C. Bloch of the Cardiovascular Research Center, Massachusetts General Hospital, Harvard Medical School, for his advice in our study and critique of our manuscript; and thank S. Hikawa and K. Honda of the Department of Medicine, Kitasato University School of Medicine, for their excellent technical support. The authors also thank Dr. C. Nathan of Cornell University Medical School, and Dr. J. Mudgett of Merck Research Laboratories for generously providing iNOS-deficient mice to establish our colony. This study was supported by research grant No. 08045069 from the Ministry of Education, Science, Sports, and Culture of Japan and a grant from the Kitasato Research Foundation to one author (H.K.), and USPHS Grant HL42397 to two authors (W.M.Z. and R.C.J.).
    References
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Kooy, N. W., J. A. Royall, Y. Z. Ye, D. R. Kelly, and J. S. Beckman. 1995. Evidence for in vivo peroxynitrite production in human acute lung injury. Am. J. Respir. Crit. Care Med. 151: 1250-1254 [Abstract].

2. Steudel, W., W. E. Hurford, and W. M. Zapol. 1999. Inhaled nitric oxide. Basic biology and clinical applications. Anesthesiology 91: 1090-1121 [Medline].

3. Wink, D. A., I. Hanbauer, M. C. Krishna, W. DeGraff, J. Gamson, and J. B. Mitchell. 1993. Nitric oxide protects against cellular damage and cytotoxicity from reactive oxygen species. Proc. Natl. Acad. Sci. USA 90: 9813-9817 [Abstract/Free Full Text].

4. Garat, C., C. Jayr, S. Eddahibi, M. Laffon, M. Meignan, and S. Adnot. 1997. Effect of inhaled nitric oxide or inhibition of endogenous nitric oxide formation on hyperoxic lung injury. Am. J. Respir. Crit. Care Med. 155: 1957-1964 [Abstract].

5. Liu, H. W., A. Anand, K. Bloch, D. Christiani, and R. Kradin. 1997. Expression of inducible nitric oxide synthase by macrophages in rat lung. Am. J. Respir. Crit. Care Med. 156: 223-228 [Abstract/Free Full Text].

6. Hickey, M. J., K. A. Sharkey, E. G. Sihota, P. H. Reinhardt, J. D. MacMicking, C. Nathan, and P. Kubes. 1997. Inducible nitric oxide synthase-deficient mice have enhanced leukocyte-endothelium interactions in endotoxemia. FASEB J. 11: 955-964 [Abstract].

7. Horinouchi, H., C. C. Wang, K. E. Shepherd, and R. Jones. 1996. TNF alpha gene and protein expression in alveolar macrophages in acute and chronic hyperoxia-induced lung injury. Am. J. Respir. Cell Mol. Biol. 14: 548-555 [Abstract].

8. Johnston, C. J., G. W. Mango, J. N. Finkelstein, and B. R. Stripp. 1997. Comparison of adult and newborn pulmonary cytokine mRNA expression after hyperoxia. Exp. Lung Res. 23: 537-552 [Medline].

9. Johnston, C. J., B. R. Stripp, B. Piedbeouf, T. W. Wright, G. W. Mango, C. K. Reed, and J. N. Finkelstein. 1998. Inflammatory and epithelial responses in mouse strains that differ in sensitivity to hyperoxic injury. Exp. Lung Res. 24: 189-202 [Medline].

10. Wright, R. A., H. S. Weiss, E. P. Hiatt, and J. S. Rustagi. 1966. Risk of mortality in interrupted exposure to 100 percent O2: role of air vs. lowered Po2. Am. J. Physiol. 210: 1015-1020 .

11. Adamson, I. Y., D. H. Bowden, and J. P. Wyatt. 1970. Oxygen poisoning in mice: ultrastructural and surfactant studies during exposure and recovery. Arch. Pathol. 90: 463-472 [Medline].

12. Frank, L., J. R. Bucher, and R. J. Roberts. 1978. Oxygen toxicity in neonatal and adult animals of various species. J. Appl. Physiol.: Respirat. Environ. Exercise Physiol. 45:699-704.

13. Wispe, J. R., B. B. Warner, J. C. Clark, C. R. Dey, J. Neuman, S. W. Glasser, J. D. Crapo, L. Y. Chang, and J. A. Whitsett. 1992. Human Mn-superoxide dismutase in pulmonary epithelial cells of transgenic mice confers protection from oxygen injury. J. Biol. Chem. 267: 23937-23941 [Abstract/Free Full Text].

14. Klein, J.. 1990. Normobaric pulmonary oxygen toxicity. Anesth. Analg. 70: 195-207 [Free Full Text].

15. Sibille, Y., and H. Y. Reynolds. 1990. Macrophages and polymorphonuclear neutrophils in lung defense and injury. Am. Rev. Respir. Dis. 141: 471-501 [Medline].

16. Saleh, D., P. J. Barnes, and A. Giaid. 1997. Increased production of the potent oxidant peroxynitrite in the lungs of patients with idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care. Med. 155: 1763-1769 [Abstract].

17. MacMicking, J. D., C. Nathan, G. Hom, N. Chartrain, D. S. Fletcher, M. Trumbauer, K. Stevens, Q. W. Xie, K. Sokol, N. Hutchinson, H. Chen, and J. S. Mudgett. 1995. Altered responses to bacterial infection and endotoxic shock in mice lacking inducible nitric oxide synthase. Cell 81: 641-650 [Medline].

18. Nathan, C.. 1997. Inducible nitric oxide synthase: what difference does it make? J. Clin. Invest. 100: 2417-2423 [Medline].

19. Ullrich, R., K. D. Bloch, F. Ichinose, W. Steudel, and W. M. Zapol. 1999. Hypoxic pulmonary blood flow redistribution and arterial oxygenation in endotoxin-challenged NOS2-deficient mice. J. Clin. Invest. 104: 1421-1429 [Medline].

20. Jones, R., W. M. Zapol, and L. Reid. 1984. Pulmonary artery remodeling and pulmonary hypertension after exposure to hyperoxia for 7 days. Am. J. Pathol. 117: 273-285 [Abstract].

21. Jones, R., W. M. Zapol, and L. Reid. 1985. Oxygen toxicity and restructuring of pulmonary arteries---a morphometric study. Am. J. Pathol. 121: 212-223 [Abstract].

22. Steudel, W., M. Watanabe, K. Dikranian, M. Jacobson, and R. C. Jones. 1999. Expression of nitric oxide synthase ioform (NOS II and NOS III) in adult rat lung in hyperoxic pulmonary hypertension. Cell Tissue Res. 295: 317-329 [Medline].

23. Tsan, M. F., J. E. White, B. Caska, C. J. Epstein, and C. Y. Lee. 1998. Susceptibility of heterozygous MnSOD gene-knockout mice to oxygen toxicity. Am. J. Respir. Cell Mol. Biol. 19: 114-120 [Abstract/Free Full Text].

24. Krzesicki, R. F., G. E. Winterrowd, J. R. Brashler, C. A. Hatfield, R. L. Griffin, S. F. Fidler, K. P. Kolbasa, K. L. Shull, I. M. Richards, and J. E. Chin. 1997. Identification of cytokine and adhesion molecule mRNA in murine lung tissue and isolated T cells and eosinophils by semi-quatitative reverse transcriptase-polymerase chain reaction. Am. J. Respir. Cell Mol. Biol. 16: 693-701 [Abstract].

25. Pearce, M. L., J. Yamashita, and J. Beazell. 1965. Measurement of pulmonary edema. Circ. Res. 16: 482-488 [Abstract/Free Full Text].

26. Roberts, J. D., C. T. Roberts, R. C. Jones, W. M. Zapol, and K. D. Bloch. 1995. Continuous nitric oxide inhalation reduces pulmonary arterial structural changes, right ventricular hypertrophy, and growth retardation in the hypoxic newborn rat. Circ. Res. 76: 215-222 [Abstract/Free Full Text].

27. van der Vliet, A., J. P. Eiserich, M. K. Shigenaga, and C. E. Cross. 1999. Reactive nitrogen species and tyrosine nitration in the respiratory tract: epiphenomena or a pathobiologic mechanism of disease? Am. J. Respir. Crit. Care Med. 160: 1-9 [Free Full Text].

28. Honda, K., H. Kobayashi, R. Hataishi, S. Hirano, N. Fukuyama, H. Nakazawa, and T. Tomita. 1999. Inhaled nitric oxide reduces tyrosine nitration after LPS instillation into lungs of rats. Am. J. Respir. Crit. Care Med. 160: 678-688 [Abstract/Free Full Text].

29. Frank, L., J. R. Bucher, and R. J. Roberts. 1978. Oxygen toxicity in neonatal and adult animals of various species. J. Appl. Physiol.: Respirat. Environ. Exercise Physiol. 45:699-704.

30. Keeney, S. E., M. J. Mathews, A. K. Haque, and F. C. Schmalsteig. 1995. Comparison of pulmonary neutrophils in the adult and neonataol rat after hyperoxia. Pediatr. Res. 38: 857-863 [Medline].

31. Loihl, A. K., S. Whalen, I. L. Campbell, J. S. Mudgett, and S. Murphy. 1999. Transcriptional activation following cerebral ischemia in mice of a promotor-deleted nitric oxide synthase-2 gene. J. Biol. Chem. 274: 8844-8849 [Abstract/Free Full Text].

32. Ghosh, D. K., and D. J. Stuehr. 1995. Macrophage NO synthase: characterization of isolated oxygenase and reductase domains reveals a head-to-head subunit interaction. Biochemistry 36: 10609-10619 .

33. Stuehr, D. J.. 1997. Structure-function aspects in the nitric oxide synthases. Annu. Rev. Pharmacol. Toxicol. 37: 339-359 [Medline].

34. Feder, L. S., D. Stelts, R. W. Chapman, D. Manfra, Y. Crawley, H. Jones, M. Minnicozzi, X. Fernandez, T. Paster, R. W. Egan, W. Kreutner, and T. T. Kung. 1997. Role of nitric oxide on eosinophilic lung inflammation in allergic mice. Am. J. Respir. Cell Mol. Biol. 17: 436-442 [Abstract/Free Full Text].

35. Kobzik, L., D. S. Bredt, C. J. Lowenstein, J. Drazen, B. Gaston, D. Sugarbaker, and J. S. Stamler. 1993. Nitric oxide synthase in human and rat lung: immunocytochemical and histochemical localization. Am. J. Respir. Cell Mol. Biol. 9: 371-377 .

36. Punjabi, C. J., J. D. Laskin, K. J. Pendino, N. L. Goller, S. K. Durham, and D. L. Laskin. 1994. Production of nitric oxide by rat type II pneumocytes: increased expression of inducible nitric oxide synthase following inhalation of a pulmonary irritant. Am. J. Respir. Cell Mol. Biol. 11: 165-172 [Abstract].

37. Sato, Y., K. R. Walley, M. E. Klut, D. English, Y. D'Yachkova, J. C. Hogg, and S. F. van Eeden. 1999. Nitric oxide reduced the sequestration of polymorphonuclear leukocytes in lung by changing deformability and CD18 expression. Am. J. Respir. Crit. Care Med. 159: 1469-1476 [Abstract/Free Full Text].

38. Tsan, M.-F., J. E. White, T. A. Santana, and C. Y. Lee. 1990. Tracheal insufflation of tumor necrosis factor protects rats against oxygen toxicity. J. Appl. Physiol. 68: 1211-1219 [Abstract/Free Full Text].

39. Tsan, M.-F., C. Y. Lee, and J. E. White. 1991. Interleukin 1 protects rats against oxygen toxicity. J. Appl. Physiol. 71: 688-697 [Abstract/Free Full Text].

40. Beckman, J. S.. 1996. Oxidative damage and tyrosine nitration from peroxynitrite. Chem. Res. Toxicol. 9: 836-844 [Medline].

41. Haddad, I. Y., G. Pataki, P. Hu, C. Galliani, J. S. Beckman, and S. Matalon. 1994. Quantitation of nitrotyrosine levels in lung sections of patients and animals with acute lung injury. J. Clin. Invest. 94: 2407-2413 .

42. Hickman-Davis, J., J. Gibbs-Erwin, J. R. Lindsey, and S. Matalon. 1999. Surfactant protein A mediates mycoplasmacidal activity of alveolar macrophages by production of peroxynitrite. Proc. Natl. Acad. Sci. USA 96: 4953-4958 [Abstract/Free Full Text].

43. Eiserich, J. P., M. Hristova, C. E. Cross, A. D. Jones, B. A. Freeman, B. Halliwell, and A. van der Vliet. 1998. Formation of nitric oxide-derived inflammatory oxidants by myeloperoxidase in neutrophils. Nature 391: 393-397 [Medline].





This article has been cited by other articles:


Home page
Am. J. Respir. Cell Mol. Bio.Home page
L. Kobzik
Translating NO Biology into Clinical Advances: Still Searching for the Right Dictionary?
Am. J. Respir. Cell Mol. Biol., July 1, 2009; 41(1): 9 - 13.
[Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
D. Germano, P. Blyszczuk, A. Valaperti, G. Kania, S. Dirnhofer, U. Landmesser, T. F. Luscher, L. Hunziker, H. Zulewski, and U. Eriksson
Prominin-1/CD133+ Lung Epithelial Progenitors Protect from Bleomycin-induced Pulmonary Fibrosis
Am. J. Respir. Crit. Care Med., May 15, 2009; 179(10): 939 - 949.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. Wang, Z. Luo, S. Liu, L. Li, X. Deng, F. Huang, L. Shang, C. Jian, and S. Yue
Glutamate Mediates Hyperoxia-Induced Newborn Rat Lung Injury through N-Methyl-D-Aspartate Receptors
Am. J. Respir. Cell Mol. Biol., March 1, 2009; 40(3): 260 - 267.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. A. J. ter Horst, F. J. Walther, B. J. H. M. Poorthuis, P. S. Hiemstra, and G. T. M. Wagenaar
Inhaled nitric oxide attenuates pulmonary inflammation and fibrin deposition and prolongs survival in neonatal hyperoxic lung injury
Am J Physiol Lung Cell Mol Physiol, July 1, 2007; 293(1): L35 - L44.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
I. T. Demchenko, K. E. Welty-Wolf, B. W. Allen, and C. A. Piantadosi
Similar but not the same: normobaric and hyperbaric pulmonary oxygen toxicity, the role of nitric oxide
Am J Physiol Lung Cell Mol Physiol, July 1, 2007; 293(1): L229 - L238.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
C. M. St. Croix, K. Leelavaninchkul, S. C. Watkins, V. E. Kagan, and B. R. Pitt
Nitric Oxide and Zinc Homeostasis in Acute Lung Injury
Proceedings of the ATS, October 1, 2005; 2(3): 236 - 242.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. C. Parker and M. I. Townsley
Evaluation of lung injury in rats and mice
Am J Physiol Lung Cell Mol Physiol, February 1, 2004; 286(2): L231 - L246.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
T. Okamoto, K. Gohil, E. I. Finkelstein, P. Bove, T. Akaike, and A. van der Vliet
Multiple contributing roles for NOS2 in LPS-induced acute airway inflammation in mice
Am J Physiol Lung Cell Mol Physiol, January 1, 2004; 286(1): L198 - L209.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
T. A. Narasaraju, N. Jin, C. R. Narendranath, Z. Chen, D. Gou, and L. Liu
Protein nitration in rat lungs during hyperoxia exposure: a possible role of myeloperoxidase
Am J Physiol Lung Cell Mol Physiol, November 1, 2003; 285(5): L1037 - L1045.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
T.C. Bailey, C. Cavanagh, S. Mehta, J.F. Lewis, and R.A.W. Veldhuizen
Sepsis and hyperoxia effects on the pulmonary surfactant system in wild-type and iNOS knockout mice
Eur. Respir. J., July 1, 2002; 20(1): 177 - 182.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
B. R. Pitt and C. M. St. Croix
Complex Regulation of iNOS in Lung
Am. J. Respir. Cell Mol. Biol., January 1, 2002; 26(1): 6 - 9.
[Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Yang, V. A. Porter, D. N. Cornfield, C. Milla, A. Panoskaltsis-Mortari, B. R. Blazar, and I. Y. Haddad
Effects of oxidant stress on inflammation and survival of iNOS knockout mice after marrow transplantation
Am J Physiol Lung Cell Mol Physiol, October 1, 2001; 281(4): L922 - L930.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
N. J. Kenyon, A. van der Vliet, B. C. Schock, T. Okamoto, G. M. McGrew, and J. A. Last
Susceptibility to ozone-induced acute lung injury in iNOS-deficient mice
Am J Physiol Lung Cell Mol Physiol, March 1, 2002; 282(3): L540 - L545.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kobayashi, H.
Right arrow Articles by Jones, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kobayashi, H.
Right arrow Articles by Jones, R. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2001 American Thoracic Society.