Regulates Airway Epithelial
Cell Activation
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
Abstract |
|---|
|
|
|---|
The peroxisome proliferator-activated receptors (PPARs) are
nuclear hormone transcription factors that regulate genes associated with lipid and glucose metabolism. Recent evidence
suggests that PPAR-
may also act as a negative immunomodulator. To investigate the potential role of PPAR-
in regulating
airway inflammation, we characterized the expression and
function of PPAR-
in airway epithelial cells. Airway epithelial
cells constitutively express PPAR-
-specific messenger RNA and
protein. Further, airway epithelial PPAR-
is inducible by interleukin (IL)-4 in NIH-A549 cells. Two PPAR-
agonists, the prostaglandin D2 metabolite 15-deoxy-
12,14 prostaglandin J2 (15d-PGJ2) and a thiazolidinedione, ciglitazone, were used to study
the effects of PPAR-
activation on airway epithelial cytokine
expression. Activation of PPAR-
stimulated a PPAR-responsive reporter gene in a ligand-specific manner. In NIH-A549
cells, both ligands also blocked the cytokine-induced expression of the inducible form of nitric oxide synthase in a dose-dependent manner. In contrast, ciglitazone alone had a slight effect on cytokine-induced IL-8 secretion, but markedly inhibited IL-8 secretion from cells pretreated with IL-4. The demonstration of PPAR-
expression and function in airway epithelial
cells expands the immunoregulatory role of PPARs and suggests a critical role for PPAR-
in antagonizing proinflammatory pathways in the airways.
| |
Introduction |
|---|
|
|
|---|
Peroxisome proliferator-activated receptors (PPARs) are
nuclear hormone receptor transcription factors that regulate adipocyte differentiation and metabolism (1). Three
PPAR isoforms (
,
, and
) have been identified to date.
Ligands for PPAR-
include naturally occurring compounds
such as the hydroxyeicosatetraenoic acids (HETEs), hydroxyoctadecanoic acids (HODEs), and prostaglandin D2
metabolite 15-deoxy-
12,14 prostaglandin J2 (15d-PGJ2) (2, 3),
as well as synthetic compounds such as thiazolidinedione
antidiabetic agents (4) and fibrates. Ligand-induced activation of PPAR results in heterodimerization of the receptor
with the retinoid X receptor and subsequent binding to
specific peroxisome proliferator-responsive elements located within the promoter region of target genes (5).
PPAR-
has been shown to play a major role in regulating adipocyte differentiation and glucose homeostasis (6, 7).
In addition, it has been proposed that thiazolidinediones
may possess anti-inflammatory properties (8). In adipose
tissue, the adipogenic action of PPAR-
agonists are opposed by several proinflammatory cytokines, including
tumor necrosis factor (TNF)-
and interferon (IFN)-
. In
vitro, the antidiabetic thiazolidinediones block the effects
of TNF-
on both adipogenesis and insulin sensitivity. Recent studies demonstrate that 15d-PGJ2 blocks IFN-
-
induced murine macrophage activation (9). These findings
have prompted several laboratories to begin investigating
the role of PPAR-
as an immunomodulator.
Although the cellular expression pattern of PPAR-
in
pulmonary tissue has not been well characterized, several
lines of evidence suggest that airway epithelium may also
express PPAR-
(10). In murine macrophages, expression of PPAR-
is upregulated by interleukin (IL)-4, a cytokine believed to play a crucial role in certain subsets of
airways inflammation (13). In the same study, IL-4 induced 12/15-lipoxygenase (12/15-LO), an enzyme capable of generating PPAR-
agonists in vivo. 12/15-LOs are also
highly expressed in surface airway epithelial cells under
basal conditions (14).
Here, we demonstrate that airway epithelial cells constitutively express high levels of PPAR-
. Activation of
PPAR-
dramatically inhibited the cytokine-induced expression of inflammatory mediators in airway epithelial
cells, suggesting that PPAR-
may act as a negative immunomodulator in the airways.
| |
Materials and Methods |
|---|
|
|
|---|
Reagents
Recombinant IL-1
, TNF-
, and IFN-
were obtained from
R&D Systems (Minneapolis, MN), fetal calf serum (FCS) from
GIBCO BRL (Gaithersburg, MD), and 15d-PGJ2 and ciglitazone
from Biomol (Plymouth Meeting, PA). (AOx)3-TK-luciferase is
a thymidine kinase/luciferase reporter gene containing three direct repeats of a PPAR response element cloned upstream of the
thymidine kinase promoter and was a generous gift of Dr. Ron
Evans (Salk Institute, La Jolla, CA). A
-actin promoter/
-galactosidase reporter gene was used for normalization of luciferase
activity. The mouse monoclonal immunoglobulin G antihuman
PPAR-
antibody (E8/sc-7273) was purchased from Santa Cruz
Biotechnology, Inc. (Santa Cruz, CA).
Cell Culture and Activation Protocol
NIH-A549, HeLa, BEAS-2B, and THP-1 cells were obtained
from ATCC (Rockville, MD). A549 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 5% human serum (Gemini Bioproducts, Calabasas, CA). The other cell
lines were grown in DMEM with 10% FCS with penicillin (100 U/
ml) and streptomycin (100 µg/ml). NIH-A549 cells were plated in
assay medium (0.5% human serum) and then treated with or without PPAR-
agonists and/or cytokine mix (10 ng/ml IL-1
, 10 ng/ml
TNF-
, and 100 U/ml IFN-
) for 24 h and assessed for inducible
nitric oxide (NO) synthase (iNOS) expression and IL-8 secretion.
Immunoblot and Northern Analyses
NIH-A549 cells were harvested, washed, pelleted, and resuspended in lysis buffer. After protein concentrations were determined, Laemmli's loading buffer was added. Whole-cell extracts
from A549 cells (50 µg/lane) were resolved on 10% sodium
dodecyl sulfate-polyacrylamide gels and electroblotted to nitrocellulose. Membranes were then probed with anti-PPAR-
E8 or
iNOS antibodies (Transduction Laboratories, San Diego, CA)
according to manufacturer's protocols.
PPAR-
- and -
-specific probes were generated using Hifidelity
Taq polymerase (Stratagene, Palo Alto, CA) according to the manufacturer's suggested protocols. Briefly, total RNA was prepared from NIH-A549 cell cultures using Trizol (Life Technologies,
Gaithersburg, MD) and used in reverse transcription reactions.
The resulting complementary DNA (cDNA) was then used as template in polymerase chain reaction (PCR) reactions using primers
specific to PPAR-
(upstream: atgaccatggttgacacaga; downstream:
5'gcagccctgaaagatgcgga3') and PPAR-
(upstream: atggtggacacg
gaaagccc; downstream: 5'gcagccctgaaagatgcgga3'). These primers
were designed to amplify either PPAR-
- or PPAR-
-specific sequence and not PPAR-
. The amplified fragments were cloned
into a sequencing vector and sequenced in both directions to confirm their identity to cloned cDNAs. Clones from two different reverse transcriptase-PCR reactions revealed a fragment identical
to published human PPAR-
sequence. Both clones contained the
same GC- to -CG inversion at base pairs (bp) 727-728 (Figure 1).
This inversion would cause nonconservative AA changes and is
believed to be PCR artifacts.
|
Northern analysis was performed using standard techniques.
Briefly, 32P-labeled, human-specific PPAR-
and PPAR-
cDNA
probes were prepared by random priming (specific activity approximately 108 counts per min/ng). Total RNA was resolved on
a 1.0% agarose/formaldehyde gel and transferred to nylon membrane overnight. Membranes were prehybridized for 20 min at
42°C and then hybridized with the labeled probes in QuikHyb
(Stratagene). After hybridization, the membranes were washed
as described in the manufacturer's protocols.
Transient Transfection Assays
NIH-A549 cells were transiently transfected using calcium phosphate according to standard techniques (15). Protein extracts generated from harvested cells were assessed for luciferase
(Tropix, Bedford, MA) and
-galactosidase (Promega, Madison,
WI) activity using commercial chemiluminescence assays. Luciferase activity was normalized to
-galactosidase activity.
IL-8 Enzyme-Linked Immunosorbent Assays
Corning-Costar (Acton, MA) 96-well plates were coated with a
monoclonal goat antihuman IL-8 antibody (R&D Systems) overnight at 4°C and blocked with 0.1% bovine serum albumin. Cells
were treated overnight with or without PPAR-
and/or a mixture
of inflammatory cytokines. Equal aliquots of conditioned media
were then placed into wells. In some cases, the media was diluted
up to 1:25 to insure that the concentration of IL-8 was within the
range of the assay. After 2 h, a polyclonal rabbit antihuman IL-8
antibody was applied (Upstate Biotechnology, Saranac Lake,
NY) followed by a biotinylated goat antirabbit secondary antibody (Vector, Burlingame, CA). Next, wells were incubated with
streptavidin alkaline phosphatase (Jackson Immunoresearch,
West Grove, PA) and detection of captured IL-8 complexes was
achieved using an alkaline phosphatase substrate kit (Sigma, St.
Louis, MO). Absorbance was measured at 405 nm using a Microplate Devices reader.
| |
Results |
|---|
|
|
|---|
Airway Epithelial Cells Express PPAR-
Protein and
Messenger RNA
To determine whether human airway epithelial cells express PPAR-
, we analyzed protein extracts from two airway epithelial cell lines, BEAS-2B and NIH-A549, by
standard immunoblotting techniques using the E8/sc-7273
antibody. As a control, protein extracts from Hela cells
transfected with an expression vector for murine PPAR-
were analyzed concurrently. Using this approach, protein extracts from both BEAS-2B and NIH-A549 cells were
found to contain a protein that comigrated with the
PPAR-
control (Figure 2A). BEAS-2B and NIH-A549
cells constitutively expressed high levels of PPAR-
protein. NIH-A549 cells were selected for further studies because these cells have an intact signal transducer and activator of transcription (Stat) 6 signal transduction pathway.
IL-4 treatment significantly upregulated PPAR-
expression in NIH-A549 cells. Similar levels of expression were
demonstrated in protein extracts of other airway cell lines,
including 1HAE and 9HTE cells (data not shown).
|
Although the E8 antibody preferentially recognizes
PPAR-
, it cross-reacts with PPAR-
. To confirm the
identity of the PPAR-
isoform, an 857-bp PPAR-
-specific probe (see MATERIALS AND METHODS) was used to
perform Northern analysis using total RNA harvested from THP-1 and NIH-A549 cells. A single hybridization
signal migrating at the appropriate size was detected (Figure 2B). The hybridization signal was much stronger in
airway cells than in THP-1 cells. Further, IL-4 upregulated PPAR-
messenger RNA (mRNA) expression by
2- to 3-fold in NIH-A549 cells. Parallel studies using a
PPAR-
-specific probe did not identify a signal in mRNA
from NIH-A549 or BEAS-2B cells (data not shown).
Endogenous Airway Epithelial PPAR-
Is Functional
We next assessed whether the PPAR-
expressed by NIH-A549 cells could be activated. NIH-A549 cells were transfected with a PPAR-dependent promoter gene construct,
(AOx)3-TK-luciferase. This luciferase reporter gene contains
three direct repeats of the acyl COA (rat) PPAR response
element subcloned upstream of the thymidine kinase promotor. It is well characterized, and the vector from which
it was derived is not responsive to PPAR ligands (2, 16).
After resting overnight in 0.5% human serum, the cells were
treated with 1 or 5 µM 15d-PGJ2 for 24 h, as indicated in the
figures. These concentrations of 15d-PGJ2 were selected because they are associated with the inhibition of inflammatory cytokine release in murine and human monocytes (17, 18).
The data in Figure 3A demonstrate that 15d-PGJ2 activates transcription of the (AOx)3-TK-luciferase reporter
gene in a dose-dependent manner.
|
Several investigators have raised concerns about the use
of 15d-PGJ2 as a PPAR-
-specific ligand. Some commercially available preparations contain bioactive contaminants that may affect functional studies (19). Other studies
have shown that 15d-PGJ2 may affect cellular function and
transcriptional process through PPAR-
-independent pathways (20). Therefore, we confirmed the functional data in these studies using the specific PPAR-
agonist ciglitazone. Ciglitazone is a relatively weak activator of PPAR-
compared with 15d-PGJ2 and has an EC50 of about 3 µM.
As depicted in Figure 3B, treatment of cells with increasing concentrations of ciglitazone also resulted in a dose-dependent activation of (AOx)3-TK-luciferase.
To further confirm that the activation of (AOx)3-TK-
luciferase was due solely to PPAR-
, similar experiments
were performed using this reporter gene to examine the
possible role of PPAR-
-specific activity. In these experiments (Figure 3C), the cells were rested overnight in
0.5% human serum and then stimulated for 24 h with a
PPAR-
-specific ligand, WY14643. In control experiments, WY14643 weakly activated (AOx)3-TK-luciferase
in cells cotransfected with an expression vector for murine
PPAR-
. However, WY14643 failed to activate (AOx)3-TK-luciferase in untransfected cells. Together with protein and Northern data, these results indicate that NIH-A549 cells express little if any PPAR-
.
Finally, we examined the effects of IL-4 on ciglitazone-induced (AOx)3-TK-luciferase activity. If IL-4 increases
PPAR-
expression in NIH-A549 cells, ciglitazone should
stimulate higher levels of PPAR-
-dependent activity in
IL-4-treated cells. In these experiments, NIH-A549 cells
were transfected with (AOx)3-TK-luciferase and the normalizing vector and then treated with IL-4 (10 ng/ml). The
following morning, ciglitazone was added to the cultures
for an additional 24 h. As expected, the highest level of
promoter activity was observed in cells treated with IL-4
and ciglitazone (Figure 3D).
Importantly, the studies using PPAR-
agonists were
completed in the absence of a cotransfected PPAR-
expression vector and indicate that the transcriptional activation of
(AOx)3-TK-luciferase in these experiments results from the
activation of endogenous PPAR-
. Thus, NIH-A549 cells
not only express PPAR-
but also possess intact signaling
pathways for mediating its effects on gene transcription.
PPAR-
Activation Blocks Cytokine-Induced
iNOS Expression
We next focused on characterizing the immunomodulatory effects of PPAR-
in airway epithelial cells. In murine
macrophages, PPAR-
inhibits cytokine-induced iNOS
and gelatinase B expression through nuclear factor (NF)-
B, Stat protein, and activator protein (AP)-1-dependent
mechanisms. On the basis of these data, we examined the
effect of PPAR-
activation on the expression of two airway epithelial cytokines that that also depend on NF-
B
and AP-1: iNOS (21) and IL-8 (22).
Similar to previously published findings, resting NIH-A549 cells did not produce detectable levels of iNOS protein in vitro (Figure 4A). Stimulation of NIH-A549 cells with proinflammatory cytokines dramatically upregulated iNOS protein expression. The cytokine-induced increase in iNOS expression was blocked by both 15d-PDJ2 and ciglitizone in a dose-dependent manner.
|
Activation of PPAR-
Downregulates IL-8 Secretion
NIH-A549 cells secreted little IL-8 at baseline (Figure 5A).
Stimulation with inflammatory cytokines significantly upregulated secretion of IL-8 protein as detected by enzyme-linked immunosorbent assay. Both 15d-PGJ2 and ciglitazone
inhibited cytokine-induced IL-8 secretion, although the effects of 15d-PGJ2 were more profound (Figure 5B). Because
IL-4 stimulates PPAR-
expression, we postulated that pretreating the cells with IL-4 would increase the PPAR-
- dependent transrepression of IL-8 secretion. Indeed, ciglitazone dramatically inhibited the cytokine-induced secretion
of IL-8 in IL-4-primed NIH-A549 cells (5B).
|
| |
Discussion |
|---|
|
|
|---|
Both iNOS and IL-8 are believed to play critical roles in
airway host defense. NO synthases are responsible for the
in vivo synthesis of NO, a short-lived molecule that is an
effective bactericidal agent and may also regulate expression of various proinflammatory genes, such as IL-8 (23).
IL-8 is a potent chemoattractant and activator of neutrophils (24). To our knowledge these findings are the first to
demonstrate that activation of airway epithelial PPAR-
,
a ligand-dependent activator of gene transcription, significantly inhibits the cytokine-mediated induction of inflammatory mediators iNOS and IL-8.
Chang and Szabo (25) recently described the expression of PPAR-
in a variety of non-small cell lung cancer
cell lines. Treatment of multiple cell lines using higher
concentrations of ciglitazone and 15dPGJ2 resulted in the
induction of several protein markers of differentiation
(25). Whether these effects were mediated strictly through
PPAR-
activation was unclear given the high doses of
ligands used and the differing effect of the ligands on
PPAR-
activation and expression. In particular, high doses of 15d-PGJ2 have been found to induce signaling
through non-PPAR-
-dependent pathways (20). In our
study, we demonstrate that stimulating airway epithelial
PPAR-
using either 15d-PGJ2 or a synthetic ligand specific
for PPAR-
, ciglitazone, resulted in the transactivation of a
PPAR-dependent promoter, (AOx)3-TK-luciferase. This
strongly suggests that the effects of these ligands on inflammatory gene expression are indeed mediated through
activation of PPAR-
.
Both 15d-PGJ2 and ciglitazone abrogated the cytokine-induced iNOS expression in airway epithelial cells. Although ciglitazone alone did not significantly affect the upregulation of IL-8 secretion in response to proinflammatory cytokines, it significantly inhibited cytokine-induced IL-8 secretion in cells that had been pretreated with IL-4.
In monocytes and macrophages, PPAR-
inhibits the
expression of various cytokines partly by preventing the
activation of the NF-
B, AP-1, and Stat transcription factors (26). Both IL-8 and iNOS expression are regulated
primarily by transcriptional mechanisms dependent on the
regulatory influences of NF-
B, AP-1, and NF-IL-6 response elements. The differential effects of PPAR-
activation on iNOS and IL-8 gene expression in airway epithelial cells suggest that there may be important differences in
the contribution of each pathway to IL-8 and iNOS gene
expression and that there are differences in the effects of
PPAR-
activation on individual signal transduction pathways. The effects of ciglitazone on IL-8 expression in airway
epithelial cells are consistent with a recent report in which
PPAR-
ligands inhibited IL-1
-induced IL-8 expression in colonic epithelial cells (27). In contrast, activation of PPAR-
failed to decrease lipopolysaccharide-induced IL-8
secretion from human monocytic THP-1 cells (28). One
explanation may be that the levels of endogenous PPAR-
in THP-1 cells were insufficient to inhibit IL-8 secretion.
Although airway epithelial cells expressed much higher
levels of PPAR-
than did THP-1 monocyte controls, the
inhibitory effect of ciglitazone on IL-8 secretion required that PPAR-
levels be upregulated by priming with IL-4.
In addition, the use of FCS by the other groups may also
have contributed to conflicting results. Our experiments
used human serum, which we have found to be important
in maintaining IL-4 responsiveness.
The effects of PPAR-
on cytokine-induced IL-8 secretion were less profound compared with its effects on iNOS
expression. PPAR-
activation using ciglitazone alone
produced little if any change in IL-8 secretion. However,
ciglitazone is a relatively weak activator of PPAR-
. Ciglitazone had a much greater effect on IL-8 secretion in IL-4-
primed cells, consistent with our finding that IL-4 upregulates PPAR-
expression. Although these results do not
rule out the possibility that ciglitazone may be working through non-PPAR-
-dependent pathways in IL-4-treated
cells, they do suggest that the effects of PPAR-
activation
are more potent in the presence of IL-4. IL-4 also upregulates 12/15-LO in NIH-A549 cells (29). Considering that
human 12/15-LO generates two known PPAR-
ligands,
13S-HODE and 15S-HETE, it suggests that IL-4 can coordinate the expression of PPAR-
and an enzyme that generates functional ligands in NIH-A549 cells as it does in
murine macrophages (13).
The 12/15-LO and its metabolites have long been associated with anti-inflammatory properties. The activation
of PPAR-
suggests yet another mechanism in addition to
lipoxin synthesis, altered phosphatidyl inositol/protein kinase C signaling and 5-lipoxygenase pathway antagonism
through which 12/15-LO can downregulate certain proinflammatory responses. Recently, lipoxin A4, a 12/15-LO
metabolite, was shown to inhibit Salmonella typhimurium-
induced IL-8 secretion from T84 cells (30). Similarly, overexpression of human 12/15-LO in rat mesangial cells in a
rat model of glomerulonephritis, was associated with increased lipoxin A4 secretion and improved glomerular function (31). Although the role of PPAR-
in these studies was not determined, studies linking the IL-4-dependent inhibition of iNOS in NIH-A549 cells may prove to
be dependent on the expression of 12/15-LO and PPAR-
(32).
These findings may be especially relevant in airway
diseases such as asthma. Neutrophils may augment or perpetuate airway inflammation and injury during asthma exacerbations. Studies also suggest that an inflammatory
process dominated by neutrophils rather than eosinophils
characterizes the airway of patients with severe disease
(33, 34). The cause of the airway neutrophilia found in
asthma is unclear but may be due to phenotypic differences in mediator synthesis and release between asthmatics and nonasthmatics (35, 36). Elevated levels of IL-8 are
found in bronchoalveolar lavage fluid from intrinsic asthmatics (37). Our findings that PPAR-
is expressed and
upregulated by IL-4 in airway epithelial cells and that activation of airway epithelial PPAR-
downregulates expression of inflammatory mediators suggests that PPAR-
can act as an anti-inflammatory agent, possibly through 12/15-LO-dependent pathways.
Persistent airway wall inflammation is believed to play
a critical role in the development and progression of diseases such as asthma (38). However, therapeutic options
aimed at reducing or suppressing airway inflammation are
limited. There is growing interest in the use of PPAR-
agonists as anti-inflammatory therapies. The antidiabetic thiazolidinediones have been demonstrated to have a protective effect in animal models of atherosclerosis (39) and
chronic bowel inflammation (27). Further investigation
into the mechanisms through which PPAR-
inhibits inflammation should greatly expand our knowledge of the
immunomodulatory role of the airway epithelium and also
promote the development of novel anti-inflammatory agents for the airways.
| |
Footnotes |
|---|
Address correspondence to: Douglas J. Conrad, Div. of Pulmonary and Critical Care, VA Healthcare System, San Diego, 111J, 3350 La Jolla Village Drive, San Diego, CA 92161. E-mail: dconrad{at}ucsd.edu
(Received in original form September 19, 2000 and in revised form January 24, 2001).
Abbreviations: prostaglandin D2 metabolite 15-deoxy-
12,14 prostaglandin
J2, 15d-PGJ2; activator protein, AP; complementary DNA, cDNA; interferon, IFN; interleukin, IL; inducible nitric oxide synthase, iNOS; 12/15-
lipoxygenase, 12/15-LO; nuclear factor, NF; peroxisome proliferator-activated receptor, PPAR; tumor necrosis factor, TNF.
Acknowledgments:
The authors gratefully acknowledge the excellent technical
assistance of Anne Ho and Vince Hogan, and also thank Dr. Carolyn Kelly for
her helpful comments. This work was supported by a Clinical Investigator Development Award from the NIH, K08-HL-03108, to one author (D.J.C.); by
Veterans Administration Merit Review support to two authors (D.J.C. and
A.C.C.W.); by American Lung Association support to one author (A.C.C.W.);
by NIH Training Grant 5T32HL07022 to one author (B.L.); and by funds from
the Division of Pulmonary and Critical Care, University of California, San Diego.
| |
References |
|---|
|
|
|---|
1. Kersten, S., B. Desvergne, and W. Wahli. 2000. Role of PPARs in health and disease. Nature 405: 421-424 [Medline].
2.
Forman, B. M.,
P. Tontonoz,
J. Chen,
R. P. Brun,
B. M. Spiegelman, and
R. M. Evans.
1995.
15-deoxy-
12,14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR
.
Cell
83:
803-812
[Medline].
3.
Kliewer, S. A.,
J. M. Lenhard,
T. M. Willson,
I. Patel,
D. C. Morris, and
J. M. Lehmann.
1995.
A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor
and promotes adipocyte differentiation.
Cell
83:
803-819
.
4.
Lehmann, J. M.,
L. B. Moore,
T. A. Smith-Oliver,
W. O. Wilkison,
T. M. Willson, and
S. A. Kliewer.
1995.
An antidiabetic thiazolidinedione is a
high affinity ligand for peroxisome proliferator-activated receptor
(PPAR-
).
J. Biol. Chem.
270:
12953-12956
5. Kliewer, S. A., K. Umesono, D. J. Noonan, R. A. Heyman, and R. M. Evans. 1992. Convergence of 9-cis retinoic acid and peroxisome proliferator signalling pathways through heterodimer formation of their receptors. Nature 358: 771-774 [Medline].
6. Spiegelman, B. M.. 1998. PPAR-gamma: adipogenic regulator and thiazolidinedione receptor. Diabetes 47: 507-514 [Abstract].
7.
Tontonoz, P.,
E. Hu,
R. A. Graves,
A. I. Budavari, and
B. M. Spiegelman.
1994.
mPPAR
2: tissue-specific regulator of an adipocyte enhancer.
Genes
Dev.
8:
1224-1234
8. Serhan, C. N.. 1996. Inflammation. Signalling the fat controller [news; comment]. Nature 384: 23-24 .
9. Ricote, M., J. T. Huang, J. S. Welch, and C. K. Glass. 1999. The peroxisome proliferator-activated receptor (PPARgamma) as a regulator of monocyte/macrophage function. J. Leukoc. Biol. 66: 733-739 [Abstract].
10.
Houseknecht, K. L.,
C. A. Bidwell,
C. P. Portocarrero, and
M. E. Spurlock.
1998.
Expression and cDNA cloning of porcine peroxisome proliferator-activated receptor gamma (PPAR
).
Gene
225:
89-96
[Medline].
11.
Michael, L.,
M. Lazar, and
C. Mendelson.
1997.
Peroxisome proliferator-
activated receptor gamma1 expression is induced during cyclic adenosine
monophosphate-stimulated differentiation of alveolar type II pneumonocytes.
Endocrinology
138:
3695-3703
12.
Sundvold, H.,
A. Brzozowska, and
S. Lien.
1997.
Characterisation of bovine
peroxisome proliferator-activated receptors
1 and
2: genetic mapping
and differential expression of the two isoforms.
Biochem. Biophys. Res.
Commun.
239:
857-861
[Medline].
13. Huang, J. T., J. S. Welch, M. Ricote, C. J. Binder, T. M. Willson, C. Kelly, J. L. Witztum, C. D. Funk, D. Conrad, and C. K. Glass. 1999. Interleukin-4- dependent production of PPAR-gamma ligands in macrophages by 12 / 15-lipoxygenase. Nature 400: 378-382 [Medline].
14. Nadel, J., D. Conrad, I. Ueki, A. Schuster, and E. Sigal. 1991. Immunocytochemical localization of arachidonate 15-lipoxygenase in erythrocytes, leukocytes, and airway cells. J. Clin. Invest. 87: 1139-1145 .
15. Sambrook, J., T. Maniatis, and E. F. Fritsch. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
16. Saez, E., P. Tontonoz, M. C. Nelson, J. G. Alvarez, U. T. Ming, S. M. Baird, V. A. Thomazy, and R. M. Evans. 1998. Activators of the nuclear receptor PPARgamma enhance colon polyp formation. Nat. Med. 4: 1058-1061 [Medline].
17.
Jiang, C.,
A. T. Ting, and
B. Seed.
1998.
PPAR-
agonists inhibit production
of monocyte inflammatory cytokines.
Nature
391:
82-86
[Medline].
18.
Ricote, M.,
A. C. Li,
T. M. Willson,
C. J. Kelly, and
C. K. Glass.
1998.
The
peroxisome proliferator-activated receptor-
is a negative regulator of
macrophage activation.
Nature
391:
79-86
[Medline].
19. Maxey, K. M., E. Hessler, J. MacDonald, and L. Hitchingham. 2000. The nature and composition of 15-deoxy-Delta(12,14)PGJ(2). Prostaglandins and Other Lipid Mediators 62: 15-21 .
20.
Straus, D. S.,
G. Pascual,
M. Li,
J. S. Welch,
M. Ricote,
C. H. Hsiang,
L. L. Sengchanthalangsy,
G. Ghosh, and
C. K. Glass.
2000.
15-deoxy-delta
12,14-prostaglandin J2 inhibits multiple steps in the NF-kappa B signaling
pathway.
Proc. Natl. Acad. Sci. USA
97:
4844-4849
21.
Marks-Konczalik, J.,
S. C. Chu, and
J. Moss.
1998.
Cytokine-mediated transcriptional induction of the human inducible nitric oxide synthase gene requires both activator protein 1 and nuclear factor kappaB-binding sites.
J.
Biol. Chem.
273:
22201-22208
22.
Roger, T.,
T. Out,
N. Mukaida,
K. Matsushima,
H. Jansen, and
R. Lutter.
1998.
Enhanced AP-1 and NF-
B activities and stability of interleukin 8 (IL-8) transcripts are implicated in IL-8 mRNA superinduction in lung epithelial H292 cells.
Biochem. J.
330:
429-435
.
23.
Sanders, S..
1999.
Nitric oxide in asthma: pathogenic, therapeutic, or diagnostic?
Am. J. Respir. Cell Mol. Biol.
21:
147-149
24. Baggiolini, M., A. Walz, and S. Kunkel. 1989. Neutrophil-activating peptide-1/interleukin 8, a novel cytokine that activates neutrophils. J. Clin. Invest. 84: 1045-1049 .
25.
Chang, T. H., and
E. Szabo.
2000.
Induction of differentiation and apoptosis
by ligands of peroxisome proliferator-activated receptor gamma in non-small cell lung cancer.
Cancer Res.
60:
1129-1138
26.
Li, M.,
G. Pascual, and
C. K. Glass.
2000.
Peroxisome proliferator-activated
receptor gamma-dependent repression of the inducible nitric oxide synthase gene.
Mol. Cell. Biol.
20:
4699-4707
27.
Su, C. G.,
X. Wen,
S. T. Bailey,
W. Jiang,
S. M. Rangwala,
S. A. Keilabugh,
A. Flanigan,
S. Mruthy,
M. A. Lazar, and
G. D. Wu.
1999.
A novel therapy
for colitis utilizing PPAR-
ligands to inhibit the epithelial inflammatory
response.
J. Clin. Invest.
104:
383-389
[Medline].
28.
Shu, H.,
B. Wong,
G. Zhou,
Y. Li,
J. Berger,
J. W. Woods,
S. D. Wright, and
T.-Q. Cai.
2000.
Activation of PPAR
or
reduces secretion of matrix
metalloproteinase 9 but not interleukin 8 from human monocytic THP-1
cells.
Biochem. Biophys. Res. Commun.
267:
345-349
[Medline].
29. Brinckmann, R., M. S. Topp, I. Zalan, D. Heydeck, P. Ludwig, H. Kuhn, W. E. Berdel, and J. R. Habenicht. 1996. Regulation of 15-lipoxygenase expression in lung epithelial cells by interleukin-4. Biochem. J. 318: 305-312 .
30. Gewirtz, A. T., B. McCormick, A. S. Neish, N. A. Petasis, K. Gronert, C. N. Serhan, and J. L. Madara. 1998. Pathogen-induced chemokine secretion from model intestinal epithelium is inhibited by lipoxin A4 analogs. J. Clin. Invest. 101: 1860-1869 [Medline].
31.
Munger, K. A.,
A. Montero,
M. Fukunaga,
S. Uda,
T. Yura,
E. Imai,
Y. Kaneda,
J. M. Valdivielso, and
K. F. Badr.
1999.
Transfection of rat kidney
with human 15-lipoxygenase suppresses inflammation and preserves function in experimental glomerulonephritis.
Proc. Natl. Acad. Sci. USA
96:
13375-13380
32. Berkman, N., A. Robichaud, R. A. Robbins, G. Roesems, E. B. Haddad, P. J. Barnes, and K. F. Chung. 1996. Inhibition of inducible nitric oxide synthase expression by interleukin-4 and interleukin-13 in human lung epithelial cells. Immunology 89: 363-367 [Medline].
33. Fahy, J. V., K. W. Kim, J. Liu, and H. A. Boushey. 1995. Prominent neutrophilic inflammation in sputum from subjects with asthma exacerbation. J. Allergy Clin. Immunol. 95: 843-852 [Medline].
34. Sur, S., T. B. Crotty, G. M. Kephart, B. A. Hyma, T. V. Colby, C. E. Reed, L. W. Hunt, and G. J. Gleich. 1993. Sudden-onset fatal asthma. A distinct clinical entity with few eosinophils and relatively more neutrophils in the airway submucosa? Am. Rev. Respir. Dis. 148: 713-719 [Medline].
35.
Bayram, H.,
J. L. Devalia,
R. J. Sapsford,
T. Ohtoshi,
Y. Miyabara,
M. Sagai, and
R. J. Davies.
1998.
The effect of diesel exhaust particles on cell
function and release of inflammatory mediators from human bronchial epithelial cells in vitro.
Am. J. Respir. Cell Mol. Biol.
18:
441-448
36. Calderon, M. A., J. L. Devalia, A. J. Prior, R. J. Sapsford, and R. J. Davies. 1997. A comparison of cytokine release from epithelial cells cultured from nasal biopsy specimens of atopic patients with and without rhinitis and nonatopic subjects without rhinitis. J. Allergy Clin. Immunol. 99: 65-76 [Medline].
37. Folkard, S. G., J. Westwick, and A. B. Millar. 1997. Production of interleukin-8, RANTES and MCP-1 in intrinsic and extrinsic asthmatics. Eur. Respir. J. 10: 2097-2104 [Abstract].
38. Elias, J. A., Z. Zhu, G. Chupp, and R. J. Homer. 1999. Airway remodeling in asthma. J. Clin. Invest. 104: 1001-1006 [Medline].
39. Shiomi, M., T. Ito, T. Tsukada, Y. Tsujita, and H. Horikoshi. 1999. Combination treatment with troglitazone, an insulin action enhancer, and pravastatin, an inhibitor of HMG-CoA reductase, shows a synergistic effect on atherosclerosis of WHHL rabbits. Atherosclerosis 142: 345 [Medline].
This article has been cited by other articles:
![]() |
D. Gras, P. Chanez, V. Urbach, I. Vachier, P. Godard, and C. Bonnans Thiazolidinediones induce proliferation of human bronchial epithelial cells through the GPR40 receptor Am J Physiol Lung Cell Mol Physiol, June 1, 2009; 296(6): L970 - L978. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yuhas, E. Berent, R. Cohen, and S. Ashkenazi Roles of NF-{kappa}B Activation and Peroxisome Proliferator-Activated Receptor Gamma Inhibition in the Effect of Rifampin on Inducible Nitric Oxide Synthase Transcription in Human Lung Epithelial Cells Antimicrob. Agents Chemother., April 1, 2009; 53(4): 1539 - 1545. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Jaudszus, M. Krokowski, P. Mockel, Y. Darcan, A. Avagyan, P. Matricardi, G. Jahreis, and E. Hamelmann Cis-9,trans-11-Conjugated Linoleic Acid Inhibits Allergic Sensitization and Airway Inflammation via a PPAR{gamma}-Related Mechanism in Mice J. Nutr., July 1, 2008; 138(7): 1336 - 1342. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Chen, G. Jin, Y. Wang, H. Wang, H. Liu, Y. Liu, W. Fan, H. Ma, R. Miao, Z. Hu, et al. Genetic variants in peroxisome proliferator-activated receptor-{gamma} gene are associated with risk of lung cancer in a Chinese population Carcinogenesis, February 1, 2008; 29(2): 342 - 350. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Y. Ivashchenko, S. Z. Duan, M. G. Usher, and R. M. Mortensen PPAR-{gamma} knockout in pancreatic epithelial cells abolishes the inhibitory effect of rosiglitazone on caerulein-induced acute pancreatitis Am J Physiol Gastrointest Liver Physiol, July 1, 2007; 293(1): G319 - G326. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Simon, M. C. Arikan, S. Srisuma, S. Bhattacharya, L. W. Tsai, E. P. Ingenito, F. Gonzalez, S. D. Shapiro, and T. J. Mariani Epithelial cell PPAR{gamma} contributes to normal lung maturation FASEB J, July 1, 2006; 20(9): 1507 - 1509. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Standiford, V. G. Keshamouni, and R. C. Reddy Peroxisome Proliferator-activated Receptor-{gamma} as a Regulator of Lung Inflammation and Repair Proceedings of the ATS, October 1, 2005; 2(3): 226 - 231. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.A. Birrell, H.J. Patel, K. McCluskie, S. Wong, T. Leonard, M.H. Yacoub, and M.G. Belvisi PPAR-{gamma} agonists as therapy for diseases involving airway neutrophilia Eur. Respir. J., July 1, 2004; 24(1): 18 - 23. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Peters-Golden The Alveolar Macrophage: The Forgotten Cell in Asthma Am. J. Respir. Cell Mol. Biol., July 1, 2004; 31(1): 3 - 7. [Full Text] [PDF] |
||||
![]() |
X. Lian, C. Yan, L. Yang, Y. Xu, and H. Du Lysosomal acid lipase deficiency causes respiratory inflammation and destruction in the lung Am J Physiol Lung Cell Mol Physiol, April 1, 2004; 286(4): L801 - L807. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Reddy, V. G. Keshamouni, S. H. Jaigirdar, X. Zeng, T. Leff, V. J. Thannickal, and T. J. Standiford Deactivation of murine alveolar macrophages by peroxisome proliferator-activated receptor-{gamma} ligands Am J Physiol Lung Cell Mol Physiol, March 1, 2004; 286(3): L613 - L619. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Culver, B. P. Barna, B. Raychaudhuri, T. L. Bonfield, S. Abraham, A. Malur, C. F. Farver, M. S. Kavuru, and M. J. Thomassen Peroxisome Proliferator-Activated Receptor {gamma} Activity Is Deficient in Alveolar Macrophages in Pulmonary Sarcoidosis Am. J. Respir. Cell Mol. Biol., January 1, 2004; 30(1): 1 - 5. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yang, D. Yan, C. Yan, and H. Du Peroxisome Proliferator-activated Receptor {gamma} and Ligands Inhibit Surfactant Protein B Gene Expression in the Lung J. Biol. Chem., September 19, 2003; 278(38): 36841 - 36847. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Woerly, K. Honda, M. Loyens, J.-P. Papin, J. Auwerx, B. Staels, M. Capron, and D. Dombrowicz Peroxisome Proliferator-activated Receptors {alpha} and {gamma} Down-regulate Allergic Inflammation and Eosinophil Activation J. Exp. Med., August 4, 2003; 198(3): 411 - 421. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ando, Y. Murakami, F. Kojima, H. Endo, H. Kitasato, A. Hashimoto, H. Kobayashi, M. Majima, M. Inoue, H. Kondo, et al. Retrovirally Introduced Prostaglandin D2 Synthase Suppresses Lung Injury Induced by Bleomycin Am. J. Respir. Cell Mol. Biol., May 1, 2003; 28(5): 582 - 591. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. Patel, M. G. Belvisi, D. Bishop-Bailey, M. H. Yacoub, and J. A. Mitchell Activation of Peroxisome Proliferator-Activated Receptors in Human Airway Smooth Muscle Cells Has a Superior Anti-inflammatory Profile to Corticosteroids: Relevance for Chronic Obstructive Pulmonary Disease Therapy J. Immunol., March 1, 2003; 170(5): 2663 - 2669. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Shankaranarayanan and S. Nigam IL-4 Induces Apoptosis in A549 Lung Adenocarcinoma Cells: Evidence for the Pivotal Role of 15-Hydroxyeicosatetraenoic Acid Binding to Activated Peroxisome Proliferator-Activated Receptor {gamma} Transcription Factor J. Immunol., January 15, 2003; 170(2): 887 - 894. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Pawliczak, C. Han, X.-L. Huang, A. J. Demetris, J. H. Shelhamer, and T. Wu 85-kDa Cytosolic Phospholipase A2 Mediates Peroxisome Proliferator-activated Receptor gamma Activation in Human Lung Epithelial Cells J. Biol. Chem., August 30, 2002; 277(36): 33153 - 33163. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Bureau, C. Desmet, D. Melotte, F. Jaspar, C. Volanti, A. Vanderplasschen, P.-P. Pastoret, J. Piette, and P. Lekeux A Proinflammatory Role for the Cyclopentenone Prostaglandins at Low Micromolar Concentrations: Oxidative Stress-Induced Extracellular Signal-Regulated Kinase Activation Without NF-{kappa}B Inhibition J. Immunol., May 15, 2002; 168(10): 5318 - 5325. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. N. Serhan and P. R. Devchand Novel Antiinflammatory Targets for Asthma . A Role for PPARgamma ? Am. J. Respir. Cell Mol. Biol., June 1, 2001; 24(6): 658 - 661. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Crit. Care Med. |