help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, C. P.
Right arrow Articles by Knowles, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, C. P.
Right arrow Articles by Knowles, M.
American Journal of Respiratory Cell and Molecular Biology. Vol. 27, pp. 314-319, 2002
© 2002 American Thoracic Society
DOI: 10.1165/rcmb.2002-0029OC

Systemic Pseudohypoaldosteronism from Deletion of the Promoter Region of the Human ß Epithelial Na+ Channel Subunit

Christie P. Thomas*, Jackie Zhou*, Kang Z. Liu, Verity E. Mick, Eithne MacLaughlin and Michael Knowles

Departments of Internal Medicine, University of Iowa, Iowa City, Iowa; University of North Carolina at Chapel Hill, Chapel Hill, North Carolina; and Department of Pediatrics, Children's Hospital and University of Southern California, Los Angeles, California

Address correspondence to: Christie P. Thomas, Department of Internal Medicine, University of Iowa College of Medicine, 200 Hawkins Drive, Iowa City, IA 52242-1081. E-mail: christie-thomas{at}uiowa.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Systemic pseudohypoaldosteronism type I (PHAI) is an autosomal recessive disorder that arises from loss of function mutations of the {alpha}, ß, or {gamma} subunit of Epithelial Na+ Channel (ENaC). In addition to a severe renal phenotype in the neonatal period, patients with PHAI develop a childhood pulmonary syndrome characterized by cough and frequent respiratory infections. We tested a patient, born to consanguineous parents, who presented with dehydration, metabolic acidosis, hyperkalemia, elevated renin and aldosterone levels at birth, and recurrent respiratory symptoms in his first year. He demonstrated defective epithelial Na+ transport in multiple organs (raised sweat Cl-, 120 mM; raised salivary Na+ and Cl-, 118 and 111 mM, respectively; and little nasal amiloride-sensitive potential difference). No deleterious mutation was identified in the coding region of the three ENaC subunits. Reverse transcriptase-polymerase chain reaction of nasal epithelial RNA showed reduced ßENaC expression, and inability to amplify promoter elements indicated the possibility of a deletion in the 5' region. Using a probe that corresponded to exon 1A of ßENaC, we confirmed a large deletion (> 1,300 bp). In summary, a homozygous mutation in the promoter region of ßENaC leads to PHAI, the first description of a mutation in the regulatory regions of an ENaC subunit leading to a clinical phenotype.

Abbreviations: cystic fibrosis transmembrane regulator, CFTR • epithelial Na+ channel, ENaC • mineralocorticoid receptor, MR • pseudohypoaldosteronism type 1, PHAI • reverse transcriptase–polymerase chain reaction, RT-PCR


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pseudohypoaldosteronism type 1 (PHAI) is a rare life-threatening disease that presents in the first few days of life with salt wasting, hyperkalemia, and acidosis. Characteristically these patients have elevated renin and aldosterone values but are unable to maintain blood pressure, which led to the hypothesis of end-organ resistance to the action of aldosterone in these patients (1, 2). In target tissues, including the renal collecting duct, the distal colon, salivary gland, and sweat ducts, aldosterone binds to the mineralocorticoid receptor (MR) and activates a series of transcriptional events that leads to a significant and sustained stimulation of Na+ transport (35). The molecular identity of the Na+ transport pathway in these epithelia has now been determined to be the heteromultimeric amiloride-sensitive epithelial Na+ channel (ENaC) composed of {alpha}, ß, and {gamma} subunits (68). In addition to aldosterone-sensitive sites, ENaC is also expressed throughout the airway epithelia from the nose to the terminal bronchioles, as well as in alveolar type II cells (912).

The more severe form of PHAI includes a respiratory phenotype and is inherited as an autosomal recessive disorder, whereas the milder form is inherited in an autosomal dominant fashion wherein symptoms appear to be limited to the kidney (13, 14). Recently, inactivating homozygous or compound heterozygous mutations in {alpha}-, ß-, or {gamma}ENaC subunits have been identified in patients with systemic PHAI (1518). Consistent with loss of function of the epithelial Na+ channel, these patients have elevated sweat and salivary Na+ and Cl- and absent nasal amiloride-sensitive Na+ transport. The dominantly inherited form of PHAI appears to arise in some patients from a mutation in MR, and as predicted from its tissue distribution, these patients have normal airway Na+ transport and no pulmonary phenotype (19).

In this article we report a patient with the classic systemic phenotype of PHAI as a result of a homozygous deletion of the upstream regulatory region of ßENaC leading to near-total absence of ßENaC expression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Case Presentation
J.L. (PHA 44) was the product of a normal full-term labor and delivery, and weighed 7 1/2 pounds at birth. He had no respiratory distress at birth but presented with marked dehydration, metabolic acidosis, hyponatremia (Na+ 127), and severe hyperkalemia (K+ 10.2) at 4 d of age. He had no evidence of respiratory disease at that juncture and had a normal chest X-ray. His initial serum aldosterone and plasma renin activity were markedly elevated (1,281 ng/dl and 235.5 ng/ml/h, respectively). After fluid resuscitation, he was treated with supplemental NaCl, NaHCO3, and sodium polystyrene sulfonate. The onset of respiratory symptoms was at 1 mo with persistent clear rhinorrhea, and by 3 mo he began to have recurrent ear and sinus infections. At ~ 8 mo of age he started to have recurrent episodes of cough and tachypnea. The chest roentgenogram with these episodes showed peribronchial thickening, atelectasis, and/or small, fluffy infiltrates. On some occasions accompanying fever was noted, and systemic antimicrobial therapy was administered for presumptive respiratory tract infections, although no pathogenic bacteria were ever demonstrated by blood culture. During these illnesses, he also had modest increases in his AA gradient, with pO2s in the mid-70s, but normal pCO2. He demonstrated an elevated sweat Cl- (120 mM), and salivary Na+ (118 mM) and Cl- (111 mM). During his first 3 yr of life, he was repeatedly hospitalized for these respiratory illnesses (at least 30 d of hospitalization per year), but during intervening periods his lung function was normal, with an FEV1 at 86% predicted at age 5. Over time, the frequency and severity of these respiratory illnesses tended to wane, and after the age of 6, his pulmonary status stabilized, and he developed respiratory illnesses only when associated with an apparent viral infection. By age 7, his only pulmonary symptom was a mild, exercise-induced dry cough. He was treated intermittently with an inhaled ß-agonist. At that time, his chest roentgenogram showed very mild peribronchial changes, predominantly in the right upper lobe, with no evidence of chronic pulmonary infiltrates or hyperinflation.

Polymerase Chain Reaction Amplification of {alpha}-, ß-, and {gamma}ENaC DNA
Each coding exon of the {alpha}-, ß-, and {gamma}ENaC genes was amplified by polymerase chain reaction (PCR) using primers as described, with a few modifications (18). PCR products were sequenced using BigDye Terminator Cycle Sequencing Kit and ABI PRISM 377 Genetic Analyzer (Perkin-Elmer, Applied Biosystem, Foster City, CA). The 5' flanking region and 5' UTR of {alpha}-, ß-, and {gamma}ENaC subunits were amplified using primers corresponding to these regions (Table 1) and the products analyzed by agarose gel electrophoresis and in some instances by sequencing, as indicated above (2023).


View this table:
[in this window]
[in a new window]
 
TABLE 1 Primer pairs used to amplify the 5' end of {alpha}-, ß-, and {gamma}ENaC

 
Nasal Scrape Biopsy and RNA Isolation
Nasal scrape biopsy was performed by gently scraping the inferior turbinates with a rhinoprobe (Arlington Scientific Inc., Arlington, TX). Approximately 5 x 105 nasal epithelial cells were obtained from both patients and control subjects. Immediately after scraping, the cells were washed in F12 medium and then lysed in 1 ml of TRIzol reagent (Life Technologies, Gaithersburg, MD). Total RNA was isolated following the manufacturer's instructions. The final RNA pellet was dissolved in 50 µl of RNase-free water.

Reverse Transcription-PCR
First-strand cDNA was synthesized with oligo(dT)12–18 and SuperScript II RNase H- Reverse Transcriptase (RT) (Life Technologies) following the manufacturer's instructions. Three to five microliters of the total RNA (~ 1 µg) from each sample was used in a 20-µl RT reaction that was performed at 42°C for 1 h. This first-strand cDNA served as a template for subsequent PCR analysis.

The entire coding region of each of the three ENaC subunits ({alpha}, ß, and {gamma}) was amplified by PCR in separate tubes. A 50-µl PCR mixture contained 5 µl of 10x buffer (200 mM Tris-HCl, 500 mM KCl, pH 8.4; Life Technologies), 2 µl of 50 mM MgCl2, 0.25 µl of 5 µ/µl Taq DNA polymerase (Life Technologies), 1 µl of dNTP mix (2.5 mM of each), 2 µl of forward and 2 µl of reverse primers (10 pmol/µl each), 2 µl of cDNA, 5 µl of 0.04% Cresol Red (Sigma) in 60% sucrose, and 31 µl of H2O. The primers used for {alpha}ENaC were {alpha}2F and {alpha}2218R; for ßENaC, ß1F and ß2396R; and for {gamma}ENaC, {gamma}2F and {gamma}2187R (Table 2). The cDNA fragments were first heated to 94°C for 3 min, then amplified for 35 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 45 s. After a final 5-min extension at 72°C, the PCR products were analyzed by electrophoresis in a 3% Nusieve 3:1 agarose gel.


View this table:
[in this window]
[in a new window]
 
TABLE 2 List of oligonucleotide primers for RT-PCR

 
Quantitative Evaluation of ßENaC mRNA
ßENaC cDNA was coamplified with cystic fibrosis transmembrane regulator (CFTR) cDNA by PCR in the presence of [{alpha}-32P]dCTP. 1 µl of [{alpha}-32P] dCTP (3,000 µCi/mmol; ICN Biomedicals, Costa Mesa, CA), 2 µl of forward, and 2 µl of reverse CFTR primers (10 pmol/µl each; Table 2) were added to the PCR mixture. The cDNA fragments in a final volume of 50 ml were amplified for 20 and 24 cycles using the conditions described above. Twenty microliters of the PCR products were separated on a 6% acrylamide gel containing 1x TBE and 4% glycerol. Electrophoresis was performed at room temperature at 300 V for ~ 2 h. The gel was vacuum dried and exposed to X-ray film at -70°C, and the 32P labeled DNA fragments on the dried gel were quantified using a PhosporImager (Molecular Dynamics, Sunnyvale, CA).

Southern Blotting
Patient and control genomic DNA (20 µg) was digested with 160 U of NdeI for 6 h and then run on a 0.8% agarose gel and transferred to nylon membranes (Zetaprobe GT; Biorad, Hercules, CA). Cosmid clones containing the 5' portion of the hßENaC gene, 359G1 and 355F5, were also cut with NdeI and run alongside as positive controls (23). The 613-bp ß15-ß7 genomic DNA fragment was radiolabeled with Klenow DNA polymerase and [{alpha}-32P]dCTP (Decaprime II DNA Labeling kit; Ambion, Austin, TX) and the transferred membrane hybridized overnight at 65°C in a solution that contained 0.5 M Na2HPO4 (pH 7.2) and 7% SDS. The membranes were washed twice at 65°C in 40 mM Na2HPO4 (pH 7.2), 5% SDS, and then with 40 mM Na2HPO4 (pH 7.2), 1% SDS and subjected to autoradiography.

A second genomic fragment corresponding to a 200-bp region of terminal exon of hßENaC was amplified with primers 5' GCTGGTGGCCTTGGCCAAGAG and 5' GTCCAGCGGCTGCAGACGCAG, and radiolabeled as previously described. After allowing the radiographic signals to decay, the membrane was rehybridized to the second DNA fragment, then washed and autoradiograms generated.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The clinical syndrome manifested by this young male with renal salt wasting, hyperkalemia, and metabolic acidosis associated with elevated plasma renin activity and aldosterone levels is characteristic of PHAI. This phenotype arises from loss of function of the epithelial sodium channel and occurs with mutations of any of the three ENaC subunits as an autosomal recessive disease or with mutations in the MR as an autosomal dominant disease (18, 19, 24). Mutations of ENaC subunits cause a more severe phenotype at birth and are often associated with childhood pulmonary symptoms, a form called systemic PHAI (14, 25). We have recently demonstrated that most patients with systemic PHAI have mutations in the coding exons of {alpha}-, ß-, or {gamma}ENaC (15). Patients with mutations of the MR have milder symptoms without lung involvement, and these symptoms remit with age.

In this particular patient (PHA 44) with a clinical picture consistent with systemic PHAI, we first estimated nasal Na+ transport by measuring basal and amiloride-sensitive transepithelial voltage. (26). Some of the clinical features and laboratory data have been previously presented in abbreviated form (15). In each nostril this patient had a low basal PD (10 and 14 mV, respectively) with an inhibition of only 1 mV after amiloride infusion, which demonstrates a substantially reduced amiloride-sensitive potential difference as previously reported (15). To test for a mutation in ENaC, we amplified each of the coding exons and adjacent splice sites of each of the ENaC subunits by PCR for direct sequencing and could not identify a significant mutation (Patient #5 in Ref. 15). The lack of mutations in the coding region indicated one of two possibilities: (i) the disorder exhibited genetic heterogeneity and in this patient it was secondary to a mutation in a gene other than ENaC, or (ii) that the mutation was present elsewhere in an ENaC gene such as in the untranslated region, intron, or in a regulatory region, thus affecting transcription, translation, stability, or splicing of the transcript. To determine if there was a change in expression of ENaC transcript, the coding region of each subunit was amplified by RT-PCR from the patient's nasal epithelial RNA. A single band of the appropriate size was observed for {alpha} and {gamma} subunits, whereas no product was detectable for the ß subunit (Figure 1) . Nasal epithelia cDNA from a normal control subject and from a patient (PHA 46) with a known mutation elsewhere were used as controls and, as expected, amplified products for each of the subunits. To exclude the possibility that one of the primers was located in an absent noncoding region of the ßENaC cDNA, four pairs of primers generating four overlapping segments of ßENaC cDNA were used in a second set of PCR reactions. We were unable to amplify any of these regions of ßENaC in this patient (data not shown).



View larger version (73K):
[in this window]
[in a new window]
 
Figure 1. RT-PCR of {alpha}-, ß-, and {gamma}ENaC subunits. Total RNA was prepared from nasal scrapings of PHA 44 and 46 and from a normal control subject. PCR products were examined by agarose gel electrophoresis. {alpha}- and {gamma}ENaC were present in all samples, whereas ßENaC mRNA was absent in PHA 44.

 
To evaluate ßENaC mRNA semiquantitatively, we compared ßENaC mRNA levels in this patient with that of CFTR, an unrelated chloride channel. ßENaC cDNA was coamplified with CFTR cDNA in the presence of [32P]dCTP to increase the sensitivity of detection. In comparison with normal control subjects and PHA 46 (a patient with normal levels of expressed ßENaC), there was no detectable ßENaC after 20 cycles of PCR, although a faint signal was observed after 24 cycles (Figure 2) . This signal was less than 2% of the ßENaC product in normal control subjects, and it is not clear if the faint signal in the patient was indeed from ßENaC cDNA.



View larger version (57K):
[in this window]
[in a new window]
 
Figure 2. Semiquantitative RT-PCR of ßENaC. ßENaC mRNA was coamplified with CFTR mRNA for 20 and 24 cycles. [32P]-labeled PCR products were separated by acrylamide gel electrophoresis. There is no detectable ßENaC in PHA 44 after 20 cycles, although a very faint band was observed after 24 cycles. The second lane is a pooled sample from normal individuals.

 
We then considered the possibility that the phenotype was secondary to a mutation in the 5' untranslated region or the 5' regulatory regions of the ßENaC gene. The 5' end of the ßENaC gene has a complex organization with three exons, 1A, 1B and 1C, upstream of exon 2, which contains the translation start codon (23). As a result of this organization, two transcripts, ßENaC-1 and -2, arise from alternate initiating exons under the control of separate promoters. A series of primers was designed to amplify each of the 5' exons and the 5' flanking region upstream of these exons as well as the 5' flanking region of {alpha}- and {gamma}ENaC genes (see Table 1). Although we amplified exon 2 of BENaC we were unable to amplify exon 1A or exon 1B with its adjacent 5' flanking region (Figure 3) . In all reactions we were able to amplify the corresponding sequence in a "normal" control. We were also able to amplify the 5' flanking region of {alpha}- and {gamma}ENaC genes in PHA 44 (data not shown). Because each 5' exon in ßENaC is ~ 1.5 kb apart, these findings were strongly suggestive of a large deletion in this region of the gene.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 3. Genomic PCR of selected regions at the 5' end of ßENaC. (A) Schematic of the 5' end of ßENaC. Open and closed boxes are numbered exons, and the bent arrows indicate transcription start sites. Primers are indicated as numbered arrows, and the size of each intron is indicated below. An asterisk indicates primers that failed to give a PCR product in PHA 44. (B) Individual PCR reactions in negative control (no DNA), positive control (normal DNA), and PHA 44 DNA. Primer pairs ß9-ß24, ß20-ß11, and ß15-ß7 do not amplify a product from PHA 44 DNA.

 
To confirm this hypothesis, we performed Southern blot analysis using NdeI digested patient and control subject genomic DNA, as well as ßENaC cosmid clones and a radiolabeled probe corresponding to the proximal promoter region for ßENaC-1. A distinct band of the predicted size was present in control lanes but was not seen in the lane that contained patient DNA (Figure 4) . To confirm that there was no error in DNA loading and to look at a different region of the ßENaC gene, the blot was rehybridized with a probe that corresponded to the terminal exon of ßENaC. The results showed that a similar sized fragment of equal intensity was detected in both control subject and patient lanes. These studies confirm that patient PHA 44 has a homozygous deletion that includes the 5' end of ßENaC that is at least 1,300 bp in length. Based on the inability to amplify selected regions of the gene, the deletion is likely to be greater than 2,600 bp.



View larger version (58K):
[in this window]
[in a new window]
 
Figure 4. Southern blot. (A and B) Schematic of the 5' and 3' ends of the ßENaC gene with numbered exons as open and closed boxes, the probes shown as lines, and NdeI sites indicated. (C) Cosmid and genomic DNA digested with NdeI and analyzed by Southern hybridization. A specific 1,300-bp band cor- responding to the NdeI fragment shown in A is seen with cosmid clones 359G1 and 355F5 and in normal control DNA. The marker is a 1-kb DNA ladder (Life Technologies) that shows nonspecific hybridization with the probe. (D) A specific 3,200-bp band corresponding to the NdeI fragment shown in B is seen in normal control DNA and in PHA 44 DNA. There is nonspecific hybridization to the 1,600-bp marker. There is no hybridization signal with cosmid clones 359G1 and 355F5 because these contain the 5' end of the gene only.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This patient has the typical clinical features of systemic PHAI: (1) born with no evidence of perinatal respiratory stress; (2) early presentation within the first week of life with severe dehydration, acidosis, and hyperkalemia; (3) striking evidence of renal salt wasting, but with high levels of aldosterone and renin; (4) successful treatment of the metabolic syndrome with supplemental NaCl, NaHCO3-, and potassium exchange resins; (5) recurrent respiratory illnesses beginning in the first year of life and waning in severity and frequency by approximately age 6; and (6) evidence of defective Na+ absorption in sweat ducts and salivary ducts and nasal epithelia. If these patients reach the age of 6 to 8 without development of serious bronchiectasis, they tend to have relatively normal pulmonary status, although viral illnesses appear to precipitate mild exacerbations of their PHA-related pulmonary disease, which is manifested primarily as cough and sometimes as wheezing.

There are three principal forms of PHA. Type 1 refers to a clinical syndrome that appears to be inherited as an autosomal recessive disorder arising from mutations in any of the ENaC subunits or as an autosomal dominant disorder from mutations in the MR (13, 27). Mutations in MR have also been detected in apparently sporadic cases of PHAI (28). Furthermore, some dominant kindred do not have identifiable mutations in the MR, suggesting that there may be locus heterogeneity for the dominant form. Type II refers to a clinical syndrome that includes hyperkalemia and acidosis without salt wasting and with normal or low aldosterone levels, which, in some families, arise from mutations in kinases of the WNK family (29). In contrast to other types of PHA, patients with PHAII (also called Gordon's syndrome) have hypertension and the absence of an elevated aldosterone level, indicating that this form of PHA is a misnomer. PHA type III include a variety of "salt wasting" acquired chronic renal diseases that have reductions in GFR, hyperkalemia, acidosis, and hyperaldosteronism (30).

The only form of PHA with reported lung disease is the autosomal recessive form of PHAI. The pulmonary phenotype appears to be related to absent or severely reduced amiloride-sensitive Na+ transport in airway epithelia, a functional defect that can be identified by measurement of transepithelial potential difference in nasal and bronchial epithelia. This systemic syndrome arises from loss of function mutations in both copies of the {alpha}-, ß- or {gamma}ENaC subunit (1518). As is common with rare autosomal recessive disorders, many of these patients are the products of consanguinity, whereby homozygous mutations reflect the inheritance of the same abnormal allele from both parents (15). In other patients, the syndrome arises from heterozygous mutations in both alleles of the same gene (1518). Interestingly, in three Swedish kindred, all affected patients had a single base deletion, 1449delC, in the {alpha}ENaC subunit, suggesting that this may be a founder mutation in that population. In contrast to mutations in ENaC subunits that cause the systemic form of PHAI, mutations in MR cause a renal limited form of PHAI because Na+ transport in alveolar and airway epithelium is not normally responsive to aldosterone (31). We have previously measured nasal and rectal potential difference before and after stimulation with spironolactone and gathered in vivo data to support this concept (32).

Some patients, like PHA 44, who have systemic PHAI with reduced amiloride-sensitive Na+ absorption in nasal epithelia do not appear to have mutations in the coding exons of any of the three ENaC subunits (15, 33). In one of these patients, we now demonstrate a homozygous deletion in the 5' regulatory region of ßENaC resulting in absent or near-absent expression of the ßENaC transcript. Compared with point mutations, large gene deletions are unusual causes of disease and arise from unequal crossover during meiosis, replication slippage, or excision by transposable elements. We have been unable to confirm the full extent of the deletion or the mechanism that may have led to this type of mutation. Using the Censor server at http://www.girinst.org/Censor_Server.html we identified numerous interspersed repetitive sequences, including Alu, MIR, and L2B elements, and we speculate that replication slippage during DNA synthesis may account for this gene deletion (34).

In summary, when there is no identifiable loss of function mutations in {alpha}-, ß-, and {gamma}ENaC subunits in patients with classic systemic PHAI, screening for mutations in the proximal promoter region should be considered. The demonstration that large deletions in regulatory regions can cause severe disease also raises the possibility that milder clinical phenotypes may result from polymorphisms in the promoter regions of ENaC. Furthermore, because at least three distinct genes can cause loss of function of the epithelial sodium channel, it is possible that systemic PHAI could be inherited in a digenic pattern from heterozygous mutations in one copy of each of two independent genes. Indeed, in a recent study, five sporadic cases of renal-limited PHAI had single nucleotide substitutions in one or both copies of MR and one or both copies of {alpha}ENaC (35).


    Acknowledgments
 
This work was supported in part by USPHS grants DK54348, HL34322, and RR00046; by March of Dimes Birth Defects Foundation Research Grant #6-FY99-444; and by a CF Foundation RDP. C.T. is an Established Investigator of the American Heart Association.


    Footnotes
 
* The first two authors contributed equally to the work presented in this article. Back

Received in original form February 27, 2002

Received in final form March 21, 2002


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Petersen, S., J. Giese, A. M. Kappelgaard, H. T. Lund, J. O. Lund, M. D. Nielsen, and A. C. Thomsen. 1978. Pseudohypoaldosteronism: clinical, biochemical and morphological studies in a long-term follow-up. Acta Paediatr. Scand. 67:255–261.[Medline]
  2. Oberfield, S. E., L. S. Levine, R. M. Carey, R. Bejar, and M. I. New. 1979. Pseudohypoaldosteronism: multiple target organ unresponsiveness to mineralocorticoid hormones. J. Clin. Endocrinol. Metab. 48:228–234.[Abstract/Free Full Text]
  3. Verrey, F. 1999. Early aldosterone action: toward filling the gap between transcription and transport. Am. J. Physiol. Renal Physiol. 277:F319–327.[Abstract/Free Full Text]
  4. Rogerson, F. M., and P. J. Fuller. 2000. Mineralocorticoid action. Steroids 65:61–73.[Medline]
  5. Stokes, J. B. 2000. Understanding how aldosterone increases sodium transport. Am. J. Kidney Dis. 36:866–870.[Medline]
  6. Garty, H., and L. G. Palmer. 1997. Epithelial sodium channels: function and regulation. Physiol. Rev. 77:359–396.[Abstract/Free Full Text]
  7. Barbry, P., and P. Hofman. 1997. Molecular Biology of Na+ absorption. Am. J. Physiol. 273:G571–G585.[Abstract/Free Full Text]
  8. Matalon, S., and H. O'Brodovich. 1999. Sodium channels in alveolar epithelial cells: molecular characterization, biophysical properties and physiological significance. Annu. Rev. Physiol. 61:627–661.[Medline]
  9. Matsushita, K., P. B. J. McCray, R. D. Sigmund, M. J. Welsh, and J. B. Stokes. 1996. Localization of epithelial sodium channel subunit mRNAs in adult rat lung by in situ hybridization. Am. J. Physiol. 271:L332–L339.[Abstract/Free Full Text]
  10. Talbot, C. L., D. G. Bosworth, E. L. Briley, D. A. Fenstermacher, R. C. Boucher, S. E. Gabriel, and P. M. Barker. 1999. Quantitation and localization of ENaC subunit expression in fetal, newborn, and adult mouse lung. Am. J. Respir. Cell Mol. Biol. 20:398–406.[Abstract/Free Full Text]
  11. Smith, D. E., G. Otulakowski, H. Yeger, M. Post, E. Cutz, and H. M. O'Brodovich. 2000. Epithelial Na+ channel (ENaC) expression in the developing normal and abnormal human perinatal lung. Am. J. Respir. Crit. Care Med. 161:1322–1331.[Abstract/Free Full Text]
  12. Rochelle, L. G., D. C. Li, H. Ye, E. Lee, C. R. Talbot, and R. C. Boucher. 2000. Distribution of ion transport mRNAs throughout murine nose and lung. Am. J. Physiol. Lung Cell. Mol. Physiol. 279:L14–24.[Abstract/Free Full Text]
  13. Hanukoglu, A. 1991. Type I pseudohypoaldosteronism includes two clinically and genetically distinct entities with either renal or multiple target organ defects. J. Clin. Endocrinol. Metab. 73:936–944.[Abstract/Free Full Text]
  14. Hanukoglu, A., T. Bistritzer, Y. Rakover, and A. Mandelberg. 1994. Pseudohypoaldosteronism with increased sweat and saliva electrolyte values and frequent lower respiratory infections mimicking cystic fibrosis. J. Pediatr. 125: 752–755.[Medline]
  15. Kerem, E., T. Bistritzer, A. Hanukoglu, T. Hofman, Z. Zhou, W. Bennett, E. MacLaughlin, P. Barker, M. Nash, L. Quittell, R. Boucher, and M. R. Knowles. 1999. Pulmonary epithelial sodium-channel dysfunction and excess airway liquid in pseudohypoaldosteronism. N. Engl. J. Med. 341:156–162.[Abstract/Free Full Text]
  16. Schaedel, C., L. Marthinsen, A.-C. Kristoffersson, R. Kornfalt, K. O. Nilsson, B. Orlenius, and L. Holmberg. 1999. Lung symptoms in pseudohypoaldosteronism type 1 are associated with deficiency of the {alpha}-subunit of the epithelial sodium channel. J. Pediatr. 135:739–745.[Medline]
  17. Adachi, M., K. Tachibana, Y. Asakura, S. Abe, J. Nakae, T. Tajima, and K. Fujieda. 2001. Compound heterozygous mutations in the gamma subunit gene of ENaC (1627delG and 1570–1G->A) in one sporadic Japanese patient with a systemic form of pseudohypoaldosteronism type 1. J. Clin. Endocrinol. Metab. 86:9–12.[Abstract/Free Full Text]
  18. Chang, S. S., S. Grunder, A. Hanukoglu, A. Rosler, P. M. Mather, I. Hanukoglu, L. Schild, Y. Lu, R. A. Shimkets, C. Nelson-Williams, B. C. Rossier, and R. P. Lifton. 1996. Mutations in subunits of the epithelial sodium channel cause salt wasting with hyperkalemic acidosis, pseudohypoaldosteronism type 1. Nat. Genet. 12:248–253.[Medline]
  19. Geller, D. S., J. Rodriguez-Soriano, A. Vallo Boado, S. Schifter, M. Bayer, S. S. Chang, and R. P. Lifton. 1998. Mutations in the mineralocorticoid receptor gene cause autosomal dominant pseudohypoaldosteronism type I. Nat. Genet. 19:279–281.[Medline]
  20. Thomas, C. P., N. A. Doggett, R. Fisher, and J. B. Stokes. 1996. Genomic organization and the 5' flanking region of the gamma subunit of the human amiloride-sensitive epithelial sodium channel. J. Biol. Chem. 271:26062–26066.[Abstract/Free Full Text]
  21. Thomas, C. P., S. D. Auerbach, J. B. Stokes, and K. A. Volk. 1998. 5' heterogeneity in amiloride-sensitive epithelial sodium channel alpha subunit mRNA leads to distinct NH2-terminal variant proteins. Am. J. Physiol. 274:C1312–1323.
  22. Mick, V. E., O. A. Itani, R. W. Loftus, R. F. Husted, T. J. Schmidt, and C. P. Thomas. 2001. The {alpha} subunit of the epithelial sodium channel is an aldosterone-induced transcript in mammalian collecting ducts, and this transcriptional response is mediated via distinct cis-elements in the 5' flanking region of the gene. Mol. Endocrinol. 15:575–588.[Abstract/Free Full Text]
  23. Thomas, C. P., K. Z. Liu, R. W. Loftus, and O. A. Itani. 2002. Genomic organization of the 5' end of human ßENaC and preliminary characterization of its promoter. Am. J. Physiol. Renal Physiol. 282:F898–F909.[Abstract/Free Full Text]
  24. Strautnieks, S. S., R. J. Thompson, R. M. Gardiner, and E. Chung. 1996. A novel splice-site mutation in the gamma subunit of the epithelial sodium channel gene in three psuedohypoaldosteronism type 1 families. Nat. Genet. 13:248–250.[Medline]
  25. Malagon-Rogers, M. 1999. A patient with pseudohypoaldosteronism type 1 and respiratory distress syndrome. Pediatr. Nephrol. 13:484–486.[Medline]
  26. Knowles, M. R., A. M. Paradiso, and R. C. Boucher. 1995. In vivo nasal potential difference: techniques and protocols for assessing efficacy of gene transfer in cystic fibrosis. Hum. Gene Ther. 6:445–455.[Medline]
  27. Oh, Y. S., and D. G. Warnock. 2000. Disorders of the epithelial Na(+) channel in Liddle's syndrome and autosomal recessive pseudohypoaldosteronism type 1. Exp. Nephrol. 8:320–325.[Medline]
  28. Viemann, M., M. Peter, J. P. Lopez-Siguero, G. Simic-Schleicher, and W. G. Sippell. 2001. Evidence for genetic heterogeneity of pseudohypoaldosteronism type 1: identification of a novel mutation in the human mineralocorticoid receptor in one sporadic case and no mutations in two autosomal dominant kindreds. J. Clin. Endocrinol. Metab. 86:2056–2059.[Abstract/Free Full Text]
  29. Wilson, F. H., S. Disse-Nicodeme, K. A. Choate, K. Ishikawa, C. Nelson-Williams, I. Desitter, M. Gunel, D. V. Milford, G. W. Lipkin, J. M. Achard, M. P. Feely, B. Dussol, Y. Berland, R. J. Unwin, H. Mayan, D. B. Simon, Z. Farfel, X. Jeunemaitre, and R. P. Lifton. 2001. Human hypertension caused by mutations in WNK kinases. Science 293:1107–1112.[Abstract/Free Full Text]
  30. Stokes, J. B. 1999. Disorders of the epithelial sodium channel: insights into the regulation of extracellular volume and blood pressure. Kidney Int. 56:2318–2333.[Medline]
  31. Grubb, B. R., and R. C. Boucher. 1998. Effect of in vivo corticosteroids on Na+ transport across airway epithelia. Am. J. Physiol. Cell Physiol. 275: C303–308.[Abstract/Free Full Text]
  32. Knowles, M. R., J. T. Gatzy, and R. C. Boucher. 1985. Aldosterone metabolism and transepithelial potential difference in normal and cystic fibrosis subjects. Pediatr. Res. 19:676–679.[Medline]
  33. Prince, L. S., J. L. Launspach, D. S. Geller, R. P. Lifton, J. H. Pratt, J. Zabner, and M. J. Welsh. 1999. Absence of amiloride-sensitive sodium absorption in the airway of an infant with pseudohypoaldosteronism. J. Pediatr. 135:786–789.[Medline]
  34. Jurka, J. 1998. Repeats in genomic DNA: mining and meaning. Curr. Opin. Struct. Biol. 8:333–337.[Medline]
  35. Arai, K., K. Zachman, T. Shibasaki, and G. P. Chrousos. 1999. Polymorphisms of amiloride-sensitive sodium channel subunits in five sporadic cases of pseudohypoaldosteronism: do they have pathologic potential? J. Clin. Endocrinol. Metab. 84:2434–2437.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. J. Ramminger, K. Richard, S. K. Inglis, S. C. Land, R. E. Olver, and S. M. Wilson
A regulated apical Na+ conductance in dexamethasone-treated H441 airway epithelial cells
Am J Physiol Lung Cell Mol Physiol, August 1, 2004; 287(2): L411 - L419.
[Abstract] [Full Text] [PDF]


Home page
PediatricsHome page
O. Helve, O. M. Pitkanen, S. Andersson, H. O'Brodovich, T. Kirjavainen, and G. Otulakowski
Low Expression of Human Epithelial Sodium Channel in Airway Epithelium of Preterm Infants With Respiratory Distress
Pediatrics, May 1, 2004; 113(5): 1267 - 1272.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
O. A. Itani, J. R. Campbell, J. Herrero, P. M. Snyder, and C. P. Thomas
Alternate promoters and variable splicing lead to hNedd4-2 isoforms with a C2 domain and varying number of WW domains
Am J Physiol Renal Physiol, November 1, 2003; 285(5): F916 - F929.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, C. P.
Right arrow Articles by Knowles, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, C. P.
Right arrow Articles by Knowles, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2002 American Thoracic Society.