help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kaplan, F.
Right arrow Articles by Sweezey, N. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaplan, F.
Right arrow Articles by Sweezey, N. B.
American Journal of Respiratory Cell and Molecular Biology. Vol. 28, pp. 33-41, 2003
© 2003 American Thoracic Society
DOI: 10.1165/rcmb.2002-0047OC

The Growth Factor Midkine Is Modulated by Both Glucocorticoid and Retinoid in Fetal Lung Development

Feige Kaplan, Julie Comber, Robert Sladek, Thomas J. Hudson, Louis J. Muglia, Tara Macrae, Stéphane Gagnon, Minoru Asada, Judson A. Brewer and Neil B. Sweezey

McGill University-Montreal Children's Hospital Research Institute, Departments of Human Genetics and Pediatrics, and Montreal Genome Centre, McGill University Health Centre, Montreal, Quebec, Canada; Departments of Pediatrics, Molecular Biology, and Pharmacology, Washington University in St. Louis School of Medicine, St. Louis, Missouri; Lung Biology Research, Research Institute, The Hospital for Sick Children, Toronto; and Departments of Physiology and Pediatrics, University of Toronto, Toronto, Ontario, Canada

Address correspondence to: Feige Kaplan, McGill University-Montreal Children's Hospital Research Institute, 4060 St Catherine St West Rm 236, Montreal, QC H3Z2Z3


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The glucocorticoids (GC) and retinoids (RA) modulate branching morphogenesis and cytodifferentiation in the developing lung. We investigated downstream target genes that link glucocorticoid stimulation to the achievement of a mature lung in glucocorticoid receptor (GR) knockout mice. All GRnull mice and {bsim} 80% of mice homozygous for a hypomorphic allele (GRhypo) die shortly after birth of respiratory failure. cDNA microarray analysis showed organ-specific upregulation of the retinoic acid responsive gene midkine (MK) and its chondroitin-sulfate binding partner PG-M/versican at fetal day 18 and at neonatal day 1 in lungs of GRhypo mice, and at neonatal day 1 in lungs of GRnull mice. By contrast, lung MK and PG-M/versican were downregulated in these mice at fetal day 16.5. In situ hybridization studies showed a dramatic decrease in MK and PG-M/versican RNA between days 16.5 and 17.5 in GRWT but not in GRnull mice. Continued diffuse and robust expression of MK protein was observed in GRnull mice at neonatal day 1. These findings suggest that MK may contribute to the dysmature lung phenotype in GR-deficient mice. Exposure of cultured day 21 fetal rat lung cells to GC downregulated MK, whereas RA enhanced MK expression. Our findings demonstrate the coincident modulation of expression of MK at the same developmental time point by both GC and RA, providing a potential mechanism for the integration of GC and RA effects on fetal lung development.

Abbreviations: extracellular matrix, ECM • glucocorticoids, GC • GC receptor, GR • midkine, MK • retinoids, RA


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Morphogenesis and differentiation of the fetal lung is dependent upon complex interactions between epithelium, mesenchyme, and extracellular matrix (ECM) components (15). These signaling events regulate cell fate, migration, proliferation, and differentiation (1). Regulatory roles in lung development have been proposed for hormones, transcription and growth factors, ECM molecules, and cell surface components. However, the molecular changes associated with these signaling interactions remain incompletely understood.

The glucocorticoids (GC) and retinoids (RA), acting through the GC and RA receptors (GR, RAR) respectively, modulate both airway branching morphogenesis and epithelial cytodifferentiation in the developing lung (610). Fetal lung explants exposed to dexamethasone show growth retardation, distorted branching, dilated proximal tubules, and suppressed proliferation of epithelial cells of the distal tubules (11). Several features of accelerated maturation are also observed following exposure to dexamethasone. These include flattening of epithelial cells lining distal tubules, rudimentary septa and large airspaces, compressed and attenuated mesenchymal tissue, and increased transcription of a number genes associated with epithelial growth and differentiation including surfactant proteins (11).

Early lung formation and subsequent branching morphogenesis are also characterized by distinct stages of RA signaling (6). RA signaling is ubiquitously activated in primary buds. Further airway branching is dependent on downregulation of RA mediated by decreased RA synthesis, increased RA degradation in the epithelium, and inhibition of RA signaling in the mesenchyme by COUPTF-II (6).

RA, like GC, regulates the expression of downstream target genes through receptors (11). Moreover, RA has been shown to antagonize a number of effects of GC on gene expression and organogenesis. RA antagonizes GC-stimulated fatty acid synthase gene expression in fetal rat lung explants (12). RA prevents many of the effects of dexamethasone on lung morphology and gene expression, including (i) dexamethasone-induced formation of large airspace; (ii) increased levels of SP-A, SP-B, and CC-10 mRNAs; and (iii) reduced lung growth and mesenchymal tissue (11). In contrast, RA potentiates the actions of dexamethasone on expression of mesenchymal mitogens of Type II cells such as HGF and KGF. During neonatal alveolarization in rat, RA treatment counteracts dexamethasone-induced inhibition of alveolar formation and increases the number of alveoli (11).

These findings emphasize the critical role of the balanced action of endogenous RA and GC in normal lung development. Investigations of the molecular changes associated with maintaining this exquisitely modulated balance have identified a variety of growth factors, ECM factors, and cell surface components. Recently, a new family of heparin-binding growth factors comprised of midkine (MK) and pleiotrophin has been described which may have important regulatory functions in development, angiogenesis, and cancer (13). The chondroitin sulfate proteoglycan, PG-M/versican, binds MK with a Kd of 1.0 nm (14) and is believed to modulate MK activity. MK was first identified as the product of a retinoic acid–responsive gene in embryonal carcinoma cells (15, 16). MK has been implicated in mesenchymal–epithelial interactions in fetal organogenesis (17) and is believed to play a critical role in cell migration (18).

In the embryonic mouse, the tracheal epithelium and adjacent mesenchyme strongly exhibit MK immunoreactivity (19). MK is widely expressed in the mouse by embryonic day 7 (20). In midgestation, MK is distributed on the surface of epithelial cells of the segmental bronchi, bronchioli, alveolar ducts, and surrounding lung parenchyma. The distribution of MK in bronchial epithelium is related to its differentiation status. MK is expressed in differentiating bronchial epithelial cells, but is diminished and absent in fully differentiated cells (19).

To investigate the role of GC in triggering critical downstream events in fetal lung organogenesis, we undertook a systematic approach to identifying GC-GR targets in the GR knockout mouse models (21, 22). Absence of a functional GR is associated with fatal neonatal respiratory insufficiency in mice congenitally severely deficient in GR. Mice homozygous for the GRhypo allele express an aberrant truncated GC-binding GR and are profoundly GC-resistant (23). A deletion of the second or third exon of GR leads to a complete inactivation of the GR gene (GRnull) (22, 27). All GRnull mice, and most GRhypo mice (> 80–90%) (21, 24, 25), display marked respiratory distress and die within hours of birth (23). The lungs of fetal GRhypo mice are histologically immature from gestational day 15.5 to term. Lungs of newborns dying at birth display immature morphology (hypercellular septae, reduced airway branching) and widespread atelectasis (24, 26).

We used hybridization to cDNA microarrays (n = 3) to assess changes in lung RNA expression at fetal day 18 (GRhypo-18) and neonatal day 1 in surviving (GRsurv) and nonsurviving (GRnsurv) GRhypo mice and at neonatal day 1 in GRnull mice. Hybridization to high density (Affymetrix, Santa Clara, CA) microarrays allowed us to monitor 6,500 genes and expressed sequence tags as potential GR targets. Multiple overlapping alterations in gene expression were observed when the GRnull mice and all three groups of GRhypo mice were compared to each other and to wild-type mice (GRWT) (Kaplan and coworkers, unpublished results). Among these were the retinoic acid–responsive gene MK and its binding chondroitin sulfate partner PG-M/versican (14). Expression of both MK and PG-M/versican was upregulated in GRnull mice and in all three groups of GRhypo mice. By contrast, at fetal day 16.5, MK and PG-M/versican were downregulated in GRhypo relative to GRWT mice. We investigated the mRNA and protein expression and localization of MK and PG-M/versican from fetal day 16.5 until neonatal day 1 by Northern analysis, in situ hybridization, and immunohistochemistry. The continued diffuse and robust expression of MK protein in GRnull mice at neonatal day 1 suggested that MK may contribute to the dysmature lung phenotype observed in these mice and may implicate MK as a modulator of fetal lung alveolarization.

Exposure of day 21 fetal rat lung distal airway epithelial cells and adjacent fibroblasts in primary culture to exogenous GC downregulated MK expression, whereas exposure to RA enhanced MK expression. Our present findings contribute to our understanding of the developmental processes that link GC stimulation to critical downstream events in fetal lung maturation. Moreover, our findings include the first evidence of which we are aware for coincident modulation of expression of the same gene at the same developmental time point by both GC and RA, providing a potential mechanism for the integration of GC and RA effects on lung development.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
GRhypo mice. Rhypo mice, obtained from W. Schmid (Deutsches Krebforschungszentrum, Heidelberg, Germany) through S. Henning (Department of Pediatrics, Baylor College of Medicine, Houston, TX), were bred in the Lab Animal Services of The Hospital for Sick Children, Toronto. The phenotype observed (80% neonatal mortality due to respiratory insufficiency, 20% survival to adulthood with no respiratory distress and with full fertility) was consistent with published reports. Postnatal mice were killed using CO2, and their lungs excised. Pregnant mice of known gestational age were killed by CO2 and had their fetuses delivered by hysterotomy, killed by decapitation, and the lungs excised.

GRnull mice. Animal husbandry. All mouse protocols were in accordance with NIH guidelines and were approved by the Animal Care and Use Committee of Washington University School of Medicine. Mice were housed on a 12 h/12 h light/dark cycle with ad libitum access to rodent chow. Unless otherwise noted, all mice used were littermates of a C57BL/6 x 129/Sv genetic background. Generation of GRnull mice. Full details of generation of the GR null line used for the current studies are described elsewhere (27). Briefly, a clone arising from the TC1 line of ES cells with replacement of one copy of the endogenous GR locus by an allele having deleted exons 1C and 2 of the GR gene were used to generate chimeric, then heterozygous, mice. In more than 100 surviving offspring, no mice homozygous for the disrupted GR allele have been identified.

Preparation of Biologic Samples
RNA isolation. Tissue samples were homogenized in TRIzol (Gibco/BRL, Carlsbad, CA) shortly after harvesting and stored at -70°C until isolation. After extraction with chloroform, the RNA was ethanol precipitated, collected by centrifugation, lyophilized, and dissolved in water. RNA integrity was confirmed by fractionation on 1% (wt/vol) agarose-formaldehyde gels and staining the ribosomal RNA bands with ethidium bromide.

cDNA Microarray Analysis
Preparation of probes, hybridization, and detection were conducted according to the method of Novak and coworkers (28).

Probe Preparation
Twenty micrograms of total RNA was reverse transcribed as described (28). Following second-strand synthesis, the probe cDNA was purified by phenol chloroform extraction and biotinylated probe was prepared from the entire cDNA reaction using the ENZO Bioarray High Yield RNA Transcript Labeling Kit (ENZO Diagnostics, New York, NY). The probe synthesis reaction was performed at 37°C for 5 h with occasional agitation. The biotinylated probe was purified using an RNeasy spin column (Qiagen, Mississauga, ON), eluted in 80 µl of DEPC water, quantified by spectrophotometry, and analyzed on a nondenaturing gel. Incubating the purified probe in 1x Fragmentation Buffer for 35 min at 95°C reduced the average probe length.

Hybridization
The hybridization mixture was prepared by mixing 15 µg of biotinylated probe with Control Oligonucleotide B2 (final concentration 50 pM; Affymetrix), Herring Sperm DNA (final concentration 0.1 mg/ml; Research Genetics, Invitrogen Canada, Burlington, ON), Acetylated BSA (final concentration 0.5 mg/ml Gibco BRL Life Technologies) in a final volume of 300 µl of 1x MES Hybridization Buffer (100 mM MES, 1M NaCl, 20mM EDTA, 0.01%Tween-20; all reagents from Sigma, St. Louis, MO). The hybridization mix was denatured for 10 min at 99°C, incubated for 5 min at 45°C, and spun for 5 min in a benchtop microfuge. The microarray was warmed to room temperature and prehybridized in 1x hybridization buffer for 10–20 min at 45°C. The prehybridization solution was removed and 150 µl of the hybridization mix was added to the array. The array and probe fragments were incubated at 45°C overnight (16–20 h). All experiments were performed using the GeneChip Mu11kSubB microarray (Affymetrix). This microarray contains approximately 6,500 probe sets obtained mainly from the 3' regions of the corresponding cDNAs. When this array was designed, {bsim} 70% of the probes represented known genes, whereas 30% were obtained from EST sequences.

Detection
Following hybridization, nonspecifically bound probe was removed by washing using the GeneChip Fluidics Station 400 (Affymetrix). In total, ten low stringency washes (6x SSPE, 0.01% Tween-20, 0.005% Antifoam) and four high stringency washes (100 mM MES, 0.1 M NaCl, 0.01% Tween-20, 50C) were performed (all reagents, Sigma). Detection of specifically bound probe was performed by incubating the arrays with SAPE (streptavidin phycoerthryin) (Molecular Probes, Eugene, OR) and scanning the chips using a Hewlett-Packard GeneArray Scanner (Affymetrix). A second scan was performed following signal enhancement with biotinylated anti-streptavidin antibody (Vector Laboratories, Burlingame, CA). The scanned images were analyzed using the GeneChip analysis Suite 3.3 (Affymetrix) in order to identify genes differentially expressed among the RNA samples.

Northern Blot Analyses
Preparation of probes. DNA probes used for Northern blots were obtained by PCR amplification of mouse cDNA in a Perkin Elmer 480 thermal cycle under the following conditions: 94°C 35 s, 57°C 35 s, 72°C 1 min, repeated 35 times, followed by a 10-min extension at 72°C. Amplification primers for individual probes were designed in Generunner v3.0 (Sheldon Biotechnology Centre, Montreal, QC), based on GenBank sequences, and are as follows. MK: 5'ctgtgacaccaggacatac3' (forward), 5'ctcctgactcagtcctttcc3' (reverse), yields a 730-bp product; PG-M/versican protein: 5'cctcatccgcaaaggacaattc3' (forward), 5'tcccataatccaaaccaacttctaattc3' (reverse), yields a 188-bp product; Clara cell secretory protein: 5'ccaacctctaccatgaagatcgc3' (forward), 5'ggcagtgacaaggctttagcag3' (reverse), yields a 352-bp product; surfactant protein C: 5'gcacctcaaacgccttctcatc3' (forward), 5'accagtatcatgcccttcctcc3' (reverse), yields a 400-bp product; ß-actin: 5'aaccgcgagaagatgacccagatcatgttt3' (forward), 5'agcagccgtggccatctcttgctcgaagtc3' (reverse), yields a 370-bp product. The sequences of the PCR products were verified by sequencing in an ABI prism 310 automated sequencer (Sheldon Biotechnology Centre). The sequence of the 18s rRNA oligonucleotide probe was: 5'tttacgacggtatctgatcgtcttcgaacctccgactttgttcttgatt3'.

Hybridization
Total RNA was isolated from lungs of 3–4 animals per group as described above. Northern blots were prepared using the Northern Max kit from Ambion (Austin, TX). In brief, 18 µg of total RNA was run on an agarose–formaldehyde gel, and then transferred to a positively charged nylon membrane (BrightStar-Plus; Ambion) by downward transfer. RNA was crosslinked to the membrane by baking at 80°C for 15min. Northern blots were prehybridized for 30 min at 42°C in ULTRAhyb solution (Ambion), to which the labeled probe was added, and allowed to hybridize overnight. Probes were labeled with 32P using Ambion's "Strip-EZ DNA" labeling kit, according to the manufacturer protocol. Following hybridization with the DNA probe, the membranes were washed twice for 5 min at 42°C in low stringency wash solution (2x SSC), followed by two 15-min 42°C washes in high stringency wash solution (0.1x SSC). The radioactive signal was detected by autoradiography using Kodak BIOMAX MR film (Kodak, Rochester, NY). Either an 18S rRNA 50 mer oligonucleotide or a 370-bp ß-actin probe labeled nonisotopically with Ambion's BrightStar Psoralen-Biotin labeling kit was used as control. Following hybridization with the oligonucleotide probe, the membrane was washed three times for 5 min at 42°C in low stringency wash solution. The signal was detected by the BrightStar Biodetect protocol (Ambion), followed by autoradiography. Similar exposures of blots were used for densitometric analysis and amounts of RNA loaded were normalized to the 18S ribosomal band or the ß-actin band for each sample.

Immunohistochemistry
Lungs from neonatal day 1 GRnull and GRWT mice were immersion-fixed in 4% paraformaldehyde in PBS overnight, tissue paraffin-embedded, and cut into 5-µm sections. Rabbit anti-MK antibody was used at 1:500 dilution in 2% normal goat serum, 2% BSA, 0.2% nonfat dry milk in PBS. Incubation was at 4°C overnight. Detection was with Vectastain Elite ABC peroxidase kit (Vector Laboratories) per the manufacturer's instructions using DAB as substrate. Sections counterstained with methyl green were dehydrated, and coverslipped. Images were collected at x100 magnification.

In Situ Hybridization
Timed mating of GRnull heterozygous mice was established, and lungs were isolated at E16.5, E17.5, or neonatal day 1. After 24 h immersion in 4% paraformaldehyde, the lungs were cryoprotected in 10% sucrose in DEPC D-PBS. PCR of DNA prepared from residual fetal tissues determined genotype of each embryo. GRWT and GRnull lungs were then embedded in OCT (Sakura Finetek USA, Inc., Torrance, CA), cut into 14-µm sections on a cryostat, and thaw-mounted onto Superfrost plus slides (Fisher Scientific, Pittsburgh, PA). In situ hybridization utilized an {alpha}-33P-UTP–labeled 419 base reverse riboprobe from the rat MK cDNA and a 188 base reverse riboprobe from the PG-M/versican cDNA for detection of MK and PG-M/versican mRNA, respectively, by methods previously described (29). Six to nine sections were hybridized from each embryo. Hybridizing probes were quantitated by exposure of slides to Hyperfilm-ßMax (Amersham Life Science, Inc., Arlington Heights, IL) with densitometric analysis employing NIH Image Software, then emulsion-dipped, developed, and photographed under dark field microscopy.

Fetal Rat Lung Cell Primary Culture
Isolation and primary culture of the fetal rat lung cells was as described (30). Wistar rats of known gestational age (day 1 = mating; term = day 22) were obtained from Charles River (St. Constant, PQ, Canada), and killed with diethylether. The fetuses were immediately removed from the uterus, and the fetal lungs dissected out. Epithelial and adjacent fibroblast cells were isolated from the fetal lungs as previously described (30). Briefly, after trypsin dispersion, collagenase digestion, and several steps of differential centrifugation and adherence to plastic of adjacent fibroblasts, cells were incubated for attachment of epithelial cells. Nonadherent cells were removed from all cell cultures after overnight incubation. Cells were grown to confluence over one to six days in MEM + 10% FBS, thoroughly rinsed in MEM (serum- and GC-free), and then incubated in MEM alone. Cells incubated in MEM plus a specified concentration of hormone were in all other respects handled exactly as were the MEM controls. An equal volume of the solvent (DMSO) in which the hormone was dissolved was added to the control medium. All experiments were performed 24–48 h after confluence. Viability and purity of the cultures were comparable to previously published data (31). Epithelial cells express phenotypic features of type II cells, and possess antigenic determinants of mature type II cells. Cells in culture (days 20–21) were exposed to GC (cortisol, 10-7 M, 24 h); or retinoic acid (RA 10-5 M, 24 h). Consistent with our previously published work, cell culture purity was > 90% as assessed by intermediate filament staining according to Caniggia and coworkers (32). Epithelial cells were identified by cytokeratin staining, fibroblasts by staining for vimentin. Viability as assessed by trypan blue extrusion was > 95%.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
cDNA Microarray Expression Profiles
We carried out three independent experiments to characterize RNA expression profiles of lung tissue isolated from GRhypo mice. We compared gene expression at fetal day 18 and neonatal day 1 (survivors and nonsurvivors) in GRhypo and GRWT mice. Multiple overlapping alterations in gene expression were observed when the three groups of GRhypo mice were compared to wild-type (GRWT). Eleven genes were identified that showed similar patterns of altered gene expression in all three GRhypo groups (Kaplan and coworkers, unpublished results). The expression profile of MK RNA in the lung at fetal day 18 and neonatal day 1 (survivors and nonsurvivors) is shown in Table 1. MK was elevated in GRhypo versus GRWT mice in all three groups. A dramatic increase in expression was also observed for the binding chondroitin sulfate partner of MK, the PG-M/versican protein (Table 1). Similar patterns of altered gene expression were observed for MK and PG-M/versican RNA in GRnull mice at neonatal day 1 (Table 1). No similar effect was observed on MK or PG-M/versican expression in fetal/neonatal liver or heart.


View this table:
[in this window]
[in a new window]
 
TABLE 1 Midkine and PG-M/Versican expression are increased in the lungs of GRhypo and GRnull mice

 
Northern Analysis
We next carried out Northern analysis to confirm the findings on cDNA microarrays. Figure 1A shows representative autoradiographs from Northern hybridization analyses of RNA extracted from lung tissue of GRWT, GRhypo+, and GRhypo (survivors and nonsurvivors) mice (n = 3) at fetal days 16.5 and 18.5 and neonatal day 1. Figure 1B is a graphic representation of the Northern hybridization analyses. The data in Figure 1 illustrate the changes in MK and PG-M/versican expression in Ghypo versus GRWT mice at fetal day 18 and neonatal day 1. These results were entirely consistent with the cDNA microarray findings showing increased MK and PG-M/versican expression in GRhypo versus GRWT mice at both of these time points. Northern data also indicated intermediate changes in expression of both of these genes in GRhypo/+ heterozygotes. We also carried out Northern analysis on RNA isolated from the lungs of GRhypo, GRhypo/+, and GRWT mice at fetal day 16.5. No microarray data were available for this time point. At fetal day 16.5, a different pattern of expression was observed for both GRhypo and GRhypo/+ mice when compared to GRWT mice (Figures 1A and 1B). At this time, MK and PG-M/versican expression in GRhypo mice were downregulated when compared to GRWT mice. Surfactant protein C showed normal expression in GRhypo homozygotes. Clara cell secretory protein, a marker of lung differentiation, also showed normal expression in all GR mouse genotypes.




View larger version (82K):
[in this window]
[in a new window]
 
Figure 1. Developmental patterns of altered gene MK and PG-M/versican gene expression in GRhypo and GRWT mouse lung. (A) Representative autoradiographs from Northern hybridization analyses of RNA (18 µg) extracted from lung tissue of GRWT, GRhypo+, and GRhypo (survivors and nonsurvivors) mice (n = 3) at fetal days 16.5 and 18.5 and neonatal day 1 (MK, midkine; SPC, surfactant protein C; CC10, Clara cell secretory protein). (B) Quantitation of changes in mRNA expression in Northern hybridization analyses of total RNA from GRWT, GRhypo+, and GRhypo (survivors and nonsurvivors) mice at fetal days 16.5 and 18.5 and neonatal day 1. Hybridizing bands were quantified by laser densitometry and amounts of RNA loaded were normalized to the 18S ribosomal band or to the ß-actin band for each sample and expressed as mean ± SE. Equal amounts of total RNA (18 µg) isolated from GRhypo or GRWT mouse lung were electrophoresed, blotted, and hybridized as described in MATERIALS AND METHODS. Filled circles, WT; open circles, HZ; filled triangles, HMsurv; open triangles, HMnonsurv.

 
MK RNA and Protein Expression in Developing GRNULL versus GRWT mice: In Situ Hybridization and Immunohistochemistry
To further characterize the effects of GR deficiency on MK expression, we next carried out immunohistochemistry and in situ hybridization studies. Because these studies were focused on MK expression during the fetal period (when we could not establish which embryos would be "survivors" and which would succumb at birth), we elected to study the GRnull mouse lung. In these mice, all homozygotes would be expected to exhibit a similar phenotype (presumably identical) to that of the GRhypo nonsurvivors.

Robust MK mRNA expression was detected throughout the lung at fetal day 16.5 in both GRnull and GRWT mice (Figure 2A) . At fetal day 17.5, before significant differences in morphology of GRWT and GRnull lungs are observed by light microscopy, we found dramatic downregulation of MK expression in GRWT but not GRnull lungs, in agreement with our microarray data (Figure 2A). At neonatal day 1, differences in MK protein expression in the lung were still apparent between GRWT and GRnull mice (Figure 3) , even though lung MK mRNA levels in both GRWT and GRnull mice were markedly decreased at this time in comparison to fetal day 16.5 (Figure 2A).



View larger version (76K):
[in this window]
[in a new window]
 
Figure 2. In situ hybridization illustrating increased MK mRNA expression in fetal lung of GRnull mice. (A) Robust midkine mRNA expression is observed at fetal day 16.5 in both GRnull and GRWT mouse lung. At day 17.5, a dramatic downregulation of midkine expression is observed in GRWT but not GRnull lungs. In immediately newborn mice, midkine mRNA levels were decreased to a similar extent in GRnull and GRWT mice. (B) PG-M/versican mRNA expression is observed at fetal day 16.5 in GRnull and GRWT mouse lung. Beginning at fetal day 17.5, PG-M/versican mRNA is downregulated in the lungs of GRWT mice and is essentially undetectable in these mice at neonatal day 1. In GRnull mice, lung levels of PG-M/versican do not appear to decrease at day 17.5, and remain above that of GRWT mice at neonatal day 1.

 


View larger version (72K):
[in this window]
[in a new window]
 
Figure 3. Increased midkine immunoreactivity in immediately newborn GRnull mice. GRnull lung demonstrates diffuse MK immunoreactivity in proximal and distal lung compartments. GRWT mice exhibit MK immunoreactivity in large airways, but expression is largely absent in most lung of the parenchyma. Images collected at x100 magnification.

 
Similarly, PG-M /versican mRNA is downregulated in the lungs of GRWT mice beginning at fetal day 17.5 and is essentially undetectable at neonatal day 1 (Figure 2B). In GRnull mice, lung levels of PG-M /versican do not appear to decrease at day 17.5, and remain above that of GRWT mice at neonatal day 1.

GRnull lungs at neonatal day 1 exhibited diffuse MK immunoreactivity in proximal and distal lung compartments (Figure 3). GRWT mice exhibit MK immunoreactivity in large airways, but expression is largely absent in most lung parenchyma. GRnull mice displayed immature lung morphology, consistent with previous reports (22).

Effect of cortisol and RA on MK RNA expression in primary rat lung cell culture at fetal day 21
In order to further characterize the effects of GC and RA on MK expression in late gestation lung, we then exposed rat fetal lung epithelial cells and adjacent fibroblasts (adjacent to the epithelium) in primary culture to either 10-7 M cortisol or 10-5 M RA for 24 hours and measured the effects of each agent on MK expression on Northern blots. Figure 4 illustrates the developmental profile of MK expression in rat fetal lung epithelial cells and adjacent fibroblasts in late gestation. MK expression is downregulated in late gestation in both epithelial cells and fibroblasts. MK expression was higher in the epithelium than in the mesenchyme until fetal day 21. No change in MK expression was observed at fetal days 18-20 when cells were exposed to cortisol (data not shown). By contrast, at day 21, MK expression in both fetal lung epithelial cells and adjacent fibroblasts was subject to regulation by both dexamethasone and RA (Figure 5A, 5B) . At fetal day 21 lung epithelial cells exposed to 10-7 M cortisol expressed 54% of control MK mRNA (Figure 5C). A reverse effect on MK expression was observed when these cells were exposed to 10-5 M RA. Exposure to RA led to 23-40% stimulation of MK RNA expression (Figure 5C). Similarly, exposure of day 21 fibroblasts to dexamethasone led to MK expression levels of 65% of control; and exposure to RA led to 70% stimulation of MK expression (Figure 5C).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. Developmental profile of MK expression in primary cultures of rat fetal lung epithelial cells and fibroblasts in late gestation. Quantitation of changes in mRNA expression following Northern hybridization analyses of total RNA isolated from primary rat lung epithelial cells (filled circles) or adjacent fibroblasts (open circles) at fetal days 18 through 21 (n = 3). Hybridizing bands were quantified by laser densitometry. The amounts of RNA loaded were normalized to the 18S ribosomal band for each sample and expressed as mean ± SE.

 


View larger version (44K):
[in this window]
[in a new window]
 
Figure 5. Midkine expression is upregulated by retinoic acid and downregulated by glucocorticoid in primary rat lung epithelial cells and fibroblasts at fetal day 21. (A) Representative autoradiographs from Northern hybridization analyses of RNA (18 µg) isolated from primary rat lung epithelial cells or adjacent fibroblasts at fetal days 18 and 20 and exposed to cortisol (10-7 M) or RA (10-5 M) as described in MATERIALS AND METHODS. An equal volume of the solvent (DMSO) in which the hormone was dissolved was added to the control medium. (B) Quantitation of changes in mRNA expression in Northern hybridization analyses of total RNA isolated from primary rat lung epithelial cells or adjacent fibroblasts at fetal day 21 and exposed to cortisol (10-7 M) or RA (10-5 M). Hybridizing bands were quantified by laser densitometry. The amounts of RNA loaded were normalized to the 18S ribosomal band for each sample and expressed as mean ± SE.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Glucocorticoid (GC)-GR signaling regulates complex mesenchymal–epithelial interactions that are essential to both airway branching morphogenesis and the timely onset of terminal lung differentiation. Deficiency of terminal lung differentiation is a leading cause of neonatal morbidity and mortality (respiratory distress syndrome) with sequelae that can extend into adulthood (bronchopulmonary dysplasia). Absence of a functional GR is also associated with fatal neonatal respiratory insufficiency in mice congenitally severely deficient in GR. In this study we analyze mice with two distinct disruptions of the GR gene. In the first, insertion of a neomycin cassette into the second exon created a "hypomorphic" allele. Mice homozygous for the hypo allele (GRhypo) express an aberrant truncated GC-binding GR but are profoundly GC-resistant (2123). The other disruption consists of a deletion of the second exon, leading to a complete inactivation of the gene (GRnull) (22, 27). The requirement for GC-GR stimulation in lung development is confirmed by the observation of a similarly severe lung phenotype in mice carrying a targeted mutation in the corticotrophin-releasing hormone (CRH-/-) gene that are born of CRH knockout mothers (no trans-placental GC stimulation) (26).

All GRnull (27) mice, and most GRhypo mice (21, 24, 25) display marked respiratory distress and die within hours of birth. The lungs of fetal GRhypo mice are histologically immature from gestational day 16.5 to term. Lungs of newborns dying at birth display immature morphology (hypercellular septae, reduced airway branching) and widespread atelectasis (24). The molecular mechanisms of lung maturation that distinguish the survivors (GRsurv) from those who die at birth (GRnsurv) remain unclear. We hypothesized that rescue of GRhypo mice may reflect sufficient residual GR activity during a critical window of development—or the activation of an alternate pathway for GC stimulation of essential events in lung maturation.

A systematic approach to identifying GR targets would allow us to answer several outstanding questions about the role of GC-GR in triggering downstream events in fetal lung maturation. For example, although GR functions as both an activator and repressor of transcription, a global view of GR transcriptional activity has not been possible. It is also unclear whether the targets activated in the context of lung airway branching are the same as, overlapping, or distinct from those essential to terminal lung differentiation. Both GC and RA are associated with multiple effects on lung development involving both branching morphogenesis and terminal differentiation of the distal lung. However, to date it has not been possible to identify potential sites of overlapping regulation of specific gene expression, and hence integration of the regulatory effects of GC and RA.

Comparative analysis of developmentally and hormonally modulated gene expression provides important insight into biologic processes. Historically, such studies depended on manipulation of the system and analysis of one gene at a time. The advent of microarray technologies has made it possible to monitor simultaneously the expression pattern of thousands of genes (3335). Large-scale gene expression measurement techniques also provide a unique opportunity to gain insight into biologic processes under normal and pathologic conditions. The analysis is quantitative and specifically identifies comparative differences in gene expression. The DNA microarray chip technology provides a global view of gene expression that also has the potential to reveal complex or multiple patterns of gene regulation that were previously unrecognizable.

We used hybridization to cDNA microarrays to assess changes in lung RNA expression at fetal day 18 (GRhypo-18) and neonatal day 1 (GRsurv and GRnsurv) in GRhypo mice and at neonatal day 1 in GRnull mice. The preponderance of specific changes in expression involved genes with a role in cell signaling and cell communication, inflammatory response, and steroid metabolism. Among these were the retinoic acid response gene MK and its chondroitin sulfate binding partner, the PG-M/versican protein. Both MK and PG-M/versican showed significantly increased RNA expression in all three GRhypo groups as well as in the GRnull group. To verify gene induction by an independent method, we carried out Northern analysis. Results of Northern analysis were entirely consistent with microarray results, showing increased MK and PG-M/versican expression in all GRhypo mice at neonatal day 1 and at fetal day 18. We then compared expression of MK and PG-M/versican at fetal day 16.5.

Mitsiadis and coworkers (19) showed that in embryonic mouse, endoderm-derived tracheal epithelium and its adjacent mesenchyme exhibit strong MK immunoreactivity from day 13–16.5, following which the expression decreases dramatically. MK protein was expressed in differentiating bronchial epithelial cells but was diminished or absent in fully differentiated cells (19). Our results (Northern analysis, Figure 1) confirm earlier findings showing decreased MK expression in GRWT mouse lung after fetal day 16.5. Moreover, at fetal day 16.5, expression of MK in GRhypo mice was diminished relative to that of GRWT, suggesting that MK expression is not subject to GC regulation in the pseudoglandular stage of fetal mouse lung development.

To further characterize the effects of GR deficiency on MK and PG-M/versican expression we next carried out immunohistochemical and in situ hybridization studies. Because these studies were focused on MK expression during the fetal period (when we could not establish which embryos would be "survivors" and which would succumb at birth), we elected to study the GRnull mouse lung. Both MK and PG-M/versican gene expression was significantly downregulated by GC between fetal day 16.5 and fetal day 17.5 in GRWT mice. This process likely reflects GC acceleration of differentiation of the lung parenchyma, rather than an absolute requirement of GC for MK or PG-M/versican suppression, because GRnull mice also suppressed both transcripts at birth. The continued robust expression of MK protein in GRnull lung suggested that MK protein expression could still contribute to the dysmature lung development observed in the GRnull mouse at birth. Presumably the half-life of functional MK protein in the lung is significantly longer than that of the MK mRNA transcripts. Indeed, earlier work has revealed that expression of MK transcripts is not always consistent with distribution of MK protein in developing tissues (19).

Mesenchymal–epithelial interactions during development involve reciprocal inductive stimuli that are critically important to cell proliferation, differentiation, and tissue morphogenesis. The elucidation of the molecular mechanisms that govern these events is essential to advancing our understanding of basic developmental processes. Our studies suggest that MK may play an important regulatory role in mesenchymal–epithelial interactions in lung organogenesis and terminal lung differentiation. The appearance of MK in organs undergoing branching morphogenesis is concomitant with epithelial differentiation, suggesting that MK may be involved in the differentiation process of epithelial cell lineages (19).

MK distribution has been specifically localized to basement membranes in developing organs, including the lung (19). The effects of MK on the expression of ECM components, collagens, and proteoglycans have been studied in dermal fibroblasts (36). MK stimulated both collagen and proteoglycan synthesis in a dose- and time-dependent manner (36). Because collagen and GAG are major components of ECM, MK may be a potent stimulator of ECM formation. The interaction of growth factors with proteoglycans is also important in regulating signaling interactions. PG-M/versican isolated from day 13 mouse embryos bound MK with a Kd of 1.0 nm (14). In vitro, the development of embryonic mouse lung explants is inhibited by digestion with heparatinase (37). Enzyme-treated explants were inhibited in branching morphogenesis and mesenchymal tissue was thin relative to control day 13 explants. Addition of MK had a limited effect on restoring branching but restored development of mesenchymal tissue. Binding of proteoglycan to MK may thus serve to modulate MK growth enhancing properties by concentrating MK protein to the cell periphery or by competing with binding to signaling receptors (14). The role of MK in signaling mechanisms is supported by recent studies demonstrating the association of MK with several cellular phosphorylation systems. MK stimulates tyrosine phosphorylation of several cellular proteins. Crosstalk between MK and the JAK kinase pathway is likely to be an important mechanism in regulation of cell proliferation, differentiation, and development.

Our studies contribute to an emerging model for the role of MK in the developing mouse lung. In the pseudoglandular lung, RA-responsive MK stimulates epithelial branching morphogenesis via tyrosine kinase signaling pathways, which are in turn modulated by MK interactions with PG-M/versican and other proteins. Later in gestation, GC serves to downregulate both MK and PG-M/versican proteins. Downregulation of MK and PG-M/versican is associated with ECM remodeling and terminal differentiation of the distal lung. Consistent with this model, we have demonstrated that GC downregulates and RA upregulates MK in day 21 fetal rat lung epithelial cells and adjacent fibroblasts in primary culture. We suggest that MK may represent a direct link between GCs and RA in modulation of fetal lung development, providing a potential site of integration of their regulator effects.


    Acknowledgments
 
This work was supported by grants from the Canadian Institutes of Health Research (CIHR) to F.K. and N.B.S. R.S. and T.J.H. are respectively the recipients of a fellowship and a Clinician-Scientist award from the CIHR. GeneChips were provided by Bristol Myers Squibb, Millennium Pharmaceuticals Inc., and Affymetrix. The authors thank Katia Nadeau and Jack Lan for expert technical assistance.

Received in original form April 16, 2002

Received in final form July 24, 2002


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Whitsett, J. 1998. A lungful of transcription factors. Nat. Genet. 20:7–8.[CrossRef][Medline]
  2. Minoo, P., and R. J. King. 1994. Epithelial-mesenchymal interactions in lung development. Annu. Rev. Physiol. 56:13–45.[CrossRef][Medline]
  3. Rolland, G., J. Xu, A. K. Tanswell, and M. Post. 1998. Ontogeny of extracellular matrix gene expression by rat lung cells at late fetal gestation. Biol. Neonate 73:112–120.[CrossRef][Medline]
  4. McGowan, S. E. 1992. Extracellular matrix and the regulation of lung development and repair. FASEB J. 6:2895–2904.[Abstract]
  5. Adams, J. C., and F. M. Watt. 1993. Regulation of development and differentiation by the extracellular matrix. Development 117:1183–1198.[Medline]
  6. Malpel, S., C. Mendelsohn, and W. V. Cardoso. 2000. Regulation of retinoic acid signaling during lung morphogenesis. Dev. Suppl. 127:3057–3067.
  7. Chytil, F. 1996. Retinoids in lung development. FASEB J. 10:986–992.[Abstract]
  8. Venkatesh, V. C., and P. L. Ballard. 1991. Glucocorticoids and gene expression. Am. J. Respir. Cell Mol. Biol. 4:301–303.
  9. Ballard, P. L. 1989. Hormonal regulation of pulmonary surfactant. Endocr. Rev. 10:165–181.[Medline]
  10. Cardoso, W. V., M. C. Williams, S. A. Mitsialis, M. Joyce-Brady, A. K. Rishi, and J. S. Brody. 1995. Retinoic acid induces changes in the pattern of airway branching and alters epithelial cell differentiation in the developing lung in vitro. Am. J. Respir. Cell Mol. Biol. 12:464–476.[Abstract]
  11. Oshika, E., S. Liu, G. Singh, G. K. Michalopoulos, H. Shinozuka, and S. L. Katyal. 1998. Antagonistic effects of dexamethasone and retinoic acid on rat lung morphogenesis. Pediatr. Res. 43:315–324.[Medline]
  12. Xu, Z. X., C. J. Viviano, and S. A. Rooney. 1995. Glucocorticoid stimulation of fatty-acid synthase gene transcription in fetal lung: antagonism by retinoic acid. Am. J. Physiol. 268:L683–L690.[Abstract/Free Full Text]
  13. Qiu, L., C. R. Escalante, A. K. Aggarwal, P. D. Wilson, and C. R. Burrow. 2000. Monomeric midkine induces tumor cell proliferation in the absence of cell-surface proteoglycan binding. Biochem. 39:5977–5987.[CrossRef][Medline]
  14. Zou, K., H. Muramatsu, S. Ikematsu, S. Sakuma, R. H. Salama, T. Shinomura, K. Kimata, and T. Muramatsu. 2000. A heparin-binding growth factor, midkine, binds to a chondroitin sulfate proteoglycan, PG-N/versican. Eur. J. Biochem. 267:4046–4053.[Medline]
  15. Debs, R., M. Pian, K. Gaensler, J. Clements, D. S. Friend, and L. Dobbs. 1992. Prolonged transgene expression in rodent lung cells. Am. J. Respir. Cell Mol. Biol. 7:406–413.
  16. Matsubara, S., M. Tomomura, K. Kadomatsu, and T. Muramatsu. 1990. Structure of a retinoic acid-responsive gene, MK, which is transiently activated during the differentiation of embryonal carcinoma cells and the mid-gestation period of mouse embryogenesis. J. Biol. Chem. 265:9441–9443.[Abstract/Free Full Text]
  17. Mitsiadis, T. A., T. Muramatsu, H. Muramatsu, and I. Thesleff. 1995. Midkine (MK), a heparin-binding growth/differentiation factor, is regulated by retinoic acid and epithelial-mesenchymal interactions in the developing mouse tooth, and affects cell proliferation and morphogenesis. J. Cell Biol. 129:267–281.[Abstract/Free Full Text]
  18. Qi, M., S. Ikematsu, N. Maeda, K. Ichihara-Tanaka, S. Sakuma, M. Noda, T. Muramatsu, and K. Kadomatsu. 2001. Haptotactic migration induced by midkine. Involvement of protein-tyrosine phosphatase zeta. Mitogen-activated protein kinase, and phosphatidylinositol 3-kinase. J. Biol. Chem. 276:15868–15875.[Abstract/Free Full Text]
  19. Mitsiadis, T. A., M. Salmivirta, T. Muramatsu, H. Muramatsu, H. Rauvala, E. Lehtonen, M. Jalkanen, and I. Thesleff. 1995. Expression of the heparin-binding cytokines, midkine (MK) and HB-GAM (pleiotrophin) is associated with epithelial-mesenchymal interactions during fetal development and organogenesis. Development 121:37–51.[Abstract]
  20. Ratovitski, E. A., P. T. Kotzbauer, J. Milbrandt, C. J. Lowenstein, and C. R. Burrow. 1998. Midkine induces tumor cell proliferation and binds to a high affinity signaling receptor associated with JAK tyrosine kinases. J. Biol. Chem. 273:3654–3660.[Abstract/Free Full Text]
  21. Kellendonk, C., F. Tronche, H. M. Reichardt, and G. Schutz. 1999. Mutagenesis of the glucocorticoid receptor in mice. J. Steroid Biochem. Mol. Biol. 69:253–259.[CrossRef][Medline]
  22. Tronche, F., C. Kellendonk, H. M. Reichardt, and G. Schutz. 1998. Genetic dissection of glucocorticoid receptor function in mice. Curr. Opinion Genet. Devel. 8:532–538.[CrossRef][Medline]
  23. Cole, T. J., K. Myles, J. F. Purton, P. S. Brereton, N. M. Solomon, D. I. Godfrey, and J. W. Funder. 2001. GRKO mice express an aberrant dexamethasone-binding glucocorticoid receptor, but are profoundly glucocorticoid resistant. Mol. Cell. Endocrinol. 173:193–202.[CrossRef][Medline]
  24. Cole, T. J., J. A. Blendy, A. P. Monaghan, K. Krieglstein, W. Schmid, A. Aguzzi, G. Fantuzzi, E. Hummler, K. Unsicker, and G. Schutz. 1995. Targeted disruption of the glucocorticoid receptor gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Devel. 9:1608–1621.[Abstract/Free Full Text]
  25. Brix, L. A., A. C. Barnett, R. G. Duggleby, B. Leggett, and M. E. McManus. 1999. Analysis of the substrate specificity of human sulfotransferases SULT1A1 and SULT1A3: site-directed mutagenesis and kinetic studies. Biochem. 38:10474–10479.[CrossRef][Medline]
  26. Muglia, L., L. Jacobson, P. Dikkes, and J. A. Majzoub. 1995. Corticotropin-releasing hormone deficiency reveals major fetal, but not adult glucocorticoid need. Nature 373:427–432.[CrossRef][Medline]
  27. Brewer, J. A., O. Kanagawa, B. P. Sleckman, and L. J. Muglia. Thymocyte apoptosis induced by T cell activation is mediated by glucocorticoids. J. Immunol. (in press)
  28. Novak, J. P., R. Sladek, and T. J. Hudson. 2002. Characterization of variability in large-scale gene expression data: implications for study design. Genomics 79:104–113.[CrossRef][Medline]
  29. Muglia, L. M., M. L. Schaefer, S. K. Vogt, G. Gurtner, A. Imamura, and L. J. Muglia. 1999. The 5'-flanking region of the mouse adenylyl cyclase type VIII gene imparts tissue-specific expression in transgenic mice. J. Neurosci. 19:2051–2058.[Abstract/Free Full Text]
  30. Sweezey, N., C. Mawdsley, F. Ghibu, L. Song, S. Buch, A. Moore, T. Antakly, and M. Post. 1995. Differential regulation of glucocorticoid receptor expression by ligand in fetal rat lung cells. Pediatr. Res. 38:506–512.[Medline]
  31. MacLeod, R. J., J. R. Hamilton, H. Kopelman, and N. B. Sweezey. 1994. Developmental differences of cystic fibrosis transmembrane conductance regulator functional expression in isolated rat fetal distal airway epithelial cells. Pediatr. Res. 35:45–49.[Medline]
  32. Caniggia, I., I. Tseu, R. N. Han, B. T. Smith, K. Tanswell, and M. Post. 1991. Spatial and temporal differences in fibroblast behavior in fetal rat lung. Am. J. Physiol. 261:L424–L433.[Abstract/Free Full Text]
  33. Dansithong, W., S. Paul, Y. Kojima, K. Kamiya, and T. Shinozawa. 2001. A simple method for midkine purification by affinity chromatography with a heavy chain variable domain (VH) fragment of antibody. J. Biochem. Biophys. Methods 48:77–84.[CrossRef][Medline]
  34. Iyer, V. R., M. B. Eisen, D. T. Ross, G. Schuler, T. Moore, J. C. Lee, J. M. Trent, L. M. Staudt, J. Hudson, Jr., M. S. Boguski, D. Lashkari, D. Shalon, D. Botstein, and P. O. Brown. 1999. The transcriptional program in the response of human fibroblasts to serum. Science 283:83–87.[Abstract/Free Full Text]
  35. Tamayo, P., D. Slonim, J. Mesirov, Q. Zhu, S. Kitareewan, E. Dmitrovsky, E. S. Lander, and T. R. Golub. 1999. Interpreting patterns of gene expression with self-organizing maps: methods and application to hematopoietic differentiation. Proc. Natl. Acad. Sci. USA 96:2907–2912.[Abstract/Free Full Text]
  36. Yamada, H., T. Inazumi, S. Tajima, H. Muramatsu, and T. Muramatsu. 1997. Stimulation of collagen expression and glycosaminoglycan synthesis by midkine in human skin fibroblasts. Arch. Dermatol. Res. 289:429–433.[CrossRef][Medline]
  37. Toriyama, K., H. Muramatsu, T. Hoshino, S. Torii, and T. Muramatsu. 1997. Evaluation of heparin-binding growth factors in rescuing morphogenesis of heparitinase-treated mouse embryonic lung explants. Differentiation 61:161–167.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Physiol. GenomicsHome page
O. Boucherat, M.-L. Franco-Montoya, C. Thibault, R. Incitti, B. Chailley-Heu, C. Delacourt, and J. R. Bourbon
Gene expression profiling in lung fibroblasts reveals new players in alveolarization
Physiol Genomics, December 19, 2007; 32(1): 128 - 141.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. D. Bird, K. H. Tan, P. F. Olsson, M. Zieba, S. J. Flecknoe, D. R. Liddicoat, R. Mollard, S. B. Hooper, and T. J. Cole
Identification of glucocorticoid-regulated genes that control cell proliferation during murine respiratory development
J. Physiol., November 15, 2007; 585(1): 187 - 201.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. K. Lovgren, M. Kovarova, and B. H. Koller
cPGES/p23 Is Required for Glucocorticoid Receptor Function and Embryonic Growth but Not Prostaglandin E2 Synthesis
Mol. Cell. Biol., June 15, 2007; 27(12): 4416 - 4430.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
T. Weng, Z. Chen, N. Jin, L. Gao, and L. Liu
Gene expression profiling identifies regulatory pathways involved in the late stage of rat fetal lung development
Am J Physiol Lung Cell Mol Physiol, November 1, 2006; 291(5): L1027 - L1037.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
G. Steele-Perkins, C. Plachez, K. G. Butz, G. Yang, C. J. Bachurski, S. L. Kinsman, E. D. Litwack, L. J. Richards, and R. M. Gronostajski
The Transcription Factor Gene Nfib Is Essential for both Lung Maturation and Brain Development
Mol. Cell. Biol., January 15, 2005; 25(2): 685 - 698.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. R. Reynolds, M. L. Mucenski, T. D. Le Cras, W. C. Nichols, and J. A. Whitsett
Midkine Is Regulated by Hypoxia and Causes Pulmonary Vascular Remodeling
J. Biol. Chem., August 27, 2004; 279(35): 37124 - 37132.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
T. J. Cole, N. M. Solomon, R. Van Driel, J. A. Monk, D. Bird, S. J. Richardson, R. J. Dilley, and S. B. Hooper
Altered Epithelial Cell Proportions in the Fetal Lung of Glucocorticoid Receptor Null Mice
Am. J. Respir. Cell Mol. Biol., May 1, 2004; 30(5): 613 - 619.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
E. E. Morrisey and R. C. Savani
Midkine: A Potential Bridge between Glucocorticoid and Retinoid Effects on Lung Vascular Development
Am. J. Respir. Cell Mol. Biol., January 1, 2003; 28(1): 5 - 8.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kaplan, F.
Right arrow Articles by Sweezey, N. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaplan, F.
Right arrow Articles by Sweezey, N. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2003 American Thoracic Society.