help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, C.-D.
Right arrow Articles by Amrani, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, C.-D.
Right arrow Articles by Amrani, Y.
American Journal of Respiratory Cell and Molecular Biology. Vol. 28, pp. 330-338, 2003
© 2003 American Thoracic Society
DOI: 10.1165/rcmb.2002-0040OC

Bradykinin Induces Interleukin-6 Production in Human Airway Smooth Muscle Cells

Modulation by Th2 Cytokines and Dexamethasone

Chien-Da Huang, Omar Tliba, Reynold A. Panettieri, Jr. and Yassine Amrani

Department of Thoracic Medicine II, Chang Gung Memorial Hospital, Taipei, Taiwan; and Department of Medicine, Pulmonary, Allergy, and Critical Care Division, University of Pennsylvania Medical Center, Philadelphia, Pennsylvania

Address correspondence to: Dr. Yassine Amrani, University of Pennsylvania Medical Center, Pulmonary and Critical Care Division, 848 Biomedical Research Building II/III, Philadelphia, PA 19104. E-mail: amrani{at}mail.med.upenn.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Synthetic function of airway smooth muscle (ASM), defined as secretion of cytokines or chemokines, may regulate airway inflammatory responses in chronic obstructive lung diseases. Because bradykinin (BK) and interleukin (IL)-6 may play important roles in the regulation of airway inflammation, we tested whether BK induces IL-6 expression from human ASM cells. BK stimulates IL-6 release in a concentration-dependent (0.001–10 µM) and time-dependent (2–24 h) manner. The increases in IL-6 protein and total mRNA were inhibited by the selective B2 receptor antagonist HOE-140 but not by the selective B1 receptor antagonist desArg9(Leu8)-BK. Actinomycin D (a transcription inhibitor), dexamethasone, indomethacin, IL-4, and IL-13 (Th2 type cytokines) inhibited the expression of IL-6 by BK. In contrast, BK-induced IL-6 secretion was enhanced by exogenous prostaglandin E2 and salmeterol. Using immunoblot analysis, we showed that BK activates ERK1/2 and p38 mitogen-activated protein kinases (MAPK). Blocking ERK1/2 with PD98059 or p38 MAPK with SB203580 reduced BK-induced IL-6 expression. BK also activates luciferase activity in ASM cells transfected with a reporter plasmid containing AP-1 enhancer elements. BK-induced, AP-1–dependent transcription was inhibited by indomethacin and dexamethasone. Curcumin, an inhibitor of AP-1, also reduced BK-induced IL-6 expression. These data show that BK, via the B2 receptor, induces IL-6 expression in ASM cells by involving ERK1/2 and p38 MAPK signaling pathways and the AP-1 transcription factor. Moreover, IL-6 secretion by BK is sensitive to corticosteroids and is regulated by Th2-derived cytokines.

Abbreviations: activator protein-1, AP-1 • airway smooth muscle, ASM • bronchoalveolar fluid, BALF • bradykinin, BK • bovine serum albumin, BSA • cyclic adenosine monophosphate, cAMP • cyclooxygenase, COX • dimethyl sulfoxide, DMSO • extracellular signal-regulated kinase, ERK • glyceraldehyde phosphate dehydrogenase, GAPDH • interleukin, IL • mitogen-activated protein kinase, MAPK • nuclear factor {kappa}-B, NF-{kappa}B • polymerase chain reaction, PCR • prostaglandin, PG • phospholipase, PL • reverse transcription polymerase chain reaction, RT-PCR • tumor necrosis factor, TNF


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bradykinin (BK), an inflammatory nonapeptide generated from kininogens by the action of plasma and tissue kallikreins, regulates a variety of biological responses, such as vascular permeability, smooth muscle contraction, synthesis of neuropeptides, and eicosanoids. Such processes may regulate airway inflammation and bronchoconstriction in asthma (1). Most biological effects of BK are mediated by the activation of the B2 receptor, which is coupled to Gq and which activates a variety of phospholipases (PL), such as PLC, PLD, and PLA2 (2). Activation of B2 receptor can also increase cyclic adenosine monophosphate (cAMP) by stimulating cyclooxygenase (COX)-2 expression, which increases prostaglandin (PG)E2 and in turn activates an E-prostanoid receptor coupled to Gs (3, 4). The downstream signaling events mediated by B2 receptor activation remain unknown, but current evidence shows a critical role of p38 and ERK-1/2 MAPKs (5), the transcription factor nuclear factor (NF)-{kappa}B (6), and the protein kinase C (2) in regulating BK-mediated cellular function. The relevance of the B2 receptor in asthma is unclear; however, evidence suggests that antagonists of the B2 receptor modulate allergen-induced airway hyper-responsiveness and airway inflammation in animal models of asthma (1, 7). Although this observation suggests that BK may play a role in asthma, little is know about the precise mechanisms by which BK may modulate the pathogenesis of allergic asthma.

Recent evidence suggests that BK may exert proinflammatory effects in asthma by directly or indirectly acting on resident cells, such as airway smooth muscle, epithelium, neurons, and fibroblasts. Investigators have shown that BK stimulates the expression of proinflammatory cytokines, chemokines, prostanoids, and growth factors in a variety of cell types (1, 7). Using whole guinea pig lung strips, Paegelow and colleagues showed that BK stimulated the release of IL-1ß, IL-2, and IL-6 (8). The nature of the cell types involved remains unknown, but BK does stimulate the production of IL-1ß, IL-6, IL-8, and eotaxin from cultured human lung fibroblasts (5). BK may also stimulate sensory (C-fibers) and cholinergic nerves to release neuropeptides such as tachykinins with contractile and inflammatory properties (1, 9). We have shown that the activation of B2 receptor induced calcium mobilization in human and guinea pig ASM cells (10, 11). More recently, Pang and colleagues showed that BK, via B2 receptor activation, stimulated the release of PGE2, IL-8, and vascular endothelial growth factor from human ASM cells (4, 12, 13). Because BK promotes the release of proinflammatory cytokines and chemokines and potentially neuropeptides (14), BK may modulate airway inflammation in asthma.

Interleukin (IL)-6 is a pleiotropic cytokine that has an important physiologic effect in B-cell differentiation, T-cell activation, and inducing acute-phase proteins (15). In addition, concentrations of IL-6 in bronchoalveolar fluid (BALF) were found to be higher in patients with symptomatic asthma and intrinsic asthma as compared with BALF obtained from healthy subjects (16). Significant elevation in circulating IL-6 levels also occurs in asthmatic patients after inhalation of allergen (17). We and others have recently shown that ASM treated with cytokines or prostanoids secrete IL-6 (1820). In the present study, we extended these studies by investigating the effect of BK on IL-6 expression in ASM cells. We report that BK stimulates IL-6 expression in human ASM cells by activating the B2 receptor, ERK1/2, and p38 MAPKs. BK effect on IL-6 expression involves the transcription factor AP-1. Dexamethasone, salmeterol, and Th2-derived cytokines (IL-4 and IL-13) modulate BK-induced IL-6 secretion. Considering the proinflammatory properties of IL-6 in acute and chronic pathological states, these studies suggest that identifying the source and the mediators involved in IL-6 production within the airways may lead to the design of new therapeutic agents for the treatment of asthma.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ASM Cell Culture
Human trachea was obtained from lung-transplant donors in accordance with procedures approved by the University of Pennsylvania Committee on Studies Involving Human Beings at the University of Pennsylvania. ASM cells were dissected, purified, and cultured in Ham's F12 medium supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 0.1 mg/ml streptomycin (GIBCO BRL Life Technologies, Grand Island, NY) as described previously (18). ASM cells in subculture during the second through to fifth cell passages were studied. Cultured ASM cells retain native contractile protein expression, as demonstrated by indirect immunofluorescent staining for smooth muscle-specific actin, and retain functional cell-excitation coupling systems determined by fura-2 measurements of agonist-induced changes in cytosolic calcium. Unless otherwise specified, all chemicals used in this study were purchased from Sigma/Aldrich (St. Louis, MO).

Measurement of IL-6 Secretion by ASM Cells
Confluent ASM cells were growth arrested by incubating the monolayers in Ham's F12 with 0.1% bovine serum albumin (BSA) for 24 h. The concentration of IL-6 in the culture medium was determined by ELISA as described previously (18, 19). To characterize the BK receptor isotype involved in IL-6 secretion, the B1 receptor antagonist desArg9,(Leu8)-BK and the B2 receptor antagonist (HOE-140) were added 30 min before the addition of BK. In separate experiments, indomethacin or PGE2 were added 30 min before the addition of BK. The ERK1/2 MAPK inhibitor (PD98059; Calbiochem, San Diego, CA), p38 MAPK inhibitor (SB203580; Calbiochem), curcumin (Sigma, St. Louis, MO), dexamethasone, and Salmeterol (Sigma/Aldrich) were added 1 h before the addition of BK. When organic vehicles were used to dissolve inhibitors (e.g., dimethyl sulfoxide [DMSO] or ethanol), control cells were treated with similar concentrations of the vehicle alone (0.1% DMSO or 0.1% ethanol).

Sodium Dodecyl Sulfate–Polyacrylamide Gel Electrophoresis and Western Blot Analysis
Immunoblot analysis for p38 and p42/44 was performed as described previously (18). Briefly, ASM cells were washed with cold phosphate-buffered saline and resuspended in lysis buffer containing 10 mM Tris-HCl (pH 7.4), 0.5% sodium deoxycholate, 1 mM ethylenediaminetetraacetic acid, 0.5% Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride, 1 mM Na3VO4, 10 µg/ml aprotinin, and leupeptin. Proteins were analyzed on a 12.5% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and blotted onto a nitrocellulose membrane. The membranes were blocked in 3% BSA in Tris-buffered saline and incubated with a rabbit monoclonal IgG against the phosphorylated form of p38 or p42/44 (Cell Signaling, Beverly, MA). After incubation with the appropriate peroxidase-conjugated secondary antibody (Roche Molecular Biochemicals, Minneapolis, MN), the bands were visualized by the enhanced chemiluminescence system (Amersham Pharmacia Biotech, Piscataway, NJ) and autoradiographed. To ensure equal loading, the membranes were stripped and reprobed with anti-ERK 1/2 or anti-p38 MAPK antibodies.

RNA Isolation and Reverse Transcriptase Polymerase Chain Reaction
Total RNA was isolated from ASM cells using Trizol Reagent (Life Technologies, Rockville, MD) according to the manufacturer's instructions. Reverse transcriptase polymerase chain reactions (RT-PCR) were performed using specific primers. Glyceraldehyde phosphate dehydrogenase (GAPDH) (forward: 5'GCAGGGGGGAGCCAAAAGGG3'; reverse: 5'TGCCAGCCCCAGCGTCAAAG3') and IL-6 (forward: 5'CCAGCTATGAACTCCTTCTCCACAAGC3'; reverse: 5'GCTGGACTGCAGGAACTCCTTAAAGC3') were used at 200 nM each. PCR was performed for 30 cycles at 94°C denaturation, 60°C annealing, and 72°C extension using Taq DNA polymerase (Promega, Madison, WI). Reaction products were confirmed on 1% agarose (Fisher Biotech, Fair Lawn, NJ) gels with size markers (New England Biolabs, Beverly, MA). Each primer pair produced a specific size product: GAPDH, 565 base pairs (bp) and IL-6, 620 bp. The intensity of density area was analyzed using a Gel-Pro Analyzer (Silver Spring, MD). The final PCR product was expressed as the ratio of IL-6 to GAPDH used for scanning analysis.

Transfection of ASM cells, Luciferase, and ß-Galactosidase Assays
Transfection of ASM cells was performed as described previously (21) using the calcium phosphate transfection system (Gibco BRL Life Technologies). Briefly, ASM cells were plated onto 100-mm dishes at a density of 1 x 106 cells/dish for 24 h and transfected with 10 µg of AP-1 construct and 5 µg of pSV-ß-galactosidase control vector (Promega) to normalize transfection efficiencies. After transfection, cells were cultured for 36 h and growth arrested for 24 h. To examine the underlying transcriptional mechanism for BK-induced IL-6 gene expression, cells were treated with vehicle or 1 µM BK and incubated at 37°C for 16 h. To examine the effect of steroids or COX-inhibitor agents on AP-1 expression, ASM cells were stimulated with BK in the presence or absence of 10 µM dexamethasone or 10 µM indomethacin for 16 h at 37°C. Cells were harvested, and luciferase and ß-galactosidase activities were assessed according to manufacturer's instructions.

Statistics
Data are expressed as the mean ± SEM. One-way analysis of variance was used to compare mean values of more than two experimental groups. If variance among groups was noted, a Bonferroni test was used to determine significant differences between specific points within groups. Some data were also analyzed by Student's t test for paired or unpaired data. A P value of less than 0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
BK Stimulates IL-6 Production in Human ASM Cells
ASM cultures were stimulated with 1 µM BK for 0 to 24 h, and IL-6 levels in supernatants were measured by ELISA. The amount of IL-6 secretion in response to BK increased in a time-dependent manner, with a significant increase noted at 2 h (P < 0.05); maximum levels were reached at 16 h (3,095 ± 279 pg/ml, P < 0.001) (Figure 1A). BK significantly increased IL-6 secretion in a dose-dependent manner (P < 0.05 to P < 0.001), with an EC50 of 26 ± 4 nM (Figure 1B). For all subsequent experiments, modulation of IL-6 secretion was examined in ASM cells stimulated with 1 µM BK for 16 h.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 1. BK stimulates IL-6 secretion in ASM cells in a time- and concentration-dependent manner. ASM cells were incubated with 1 µM of BK (triangles) for the indicated time (A; squares, basal) or for 16 h at the indicated concentration (B). IL-6 levels in supernatants were then assessed by ELISA as described in MATERIALS AND METHODS. The results are expressed as mean ± SEM of three separate experiments. *P < 0.05, **P < 0.01, and ***P < 0.001 compared with untreated cells.

 
Activation of the B2 Receptor, but Not B1, Mediated BK-Induced IL-6 Production in Human ASM Cells
We have previously shown the involvement of the B2 receptor in BK-induced calcium responses (10, 11). Here, we investigated whether activation of the B2 receptor also regulates IL-6 secretion. Pretreating human ASM cells with HOE-140, a selective B2 receptor antagonist, significantly abrogated BK-induced IL-6 production in a concentration-dependent manner, with a significant effect at 0.1 µM and with complete inhibition at 10 µM (Figure 2A). In contrast, pretreatment of ASM cells with the B1 receptor antagonist desArg9,(Leu8)-BK (10 µM) did not affect BK-induced IL-6 secretion (Figure 2B). These data suggest that B2 receptor activation induced IL-6 production in ASM cells.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 2. Selective BK receptor antagonists abrogate BK-induced IL-6 production by ASM cells. (A) ASM cells were pretreated with the selective B2 receptor antagonist HOE-140 for 30 min and then stimulated with 1 µM BK for 16 h. (B) Cells pretreated with 10 µM of HOE-140 or the selective B1 receptor antagonist desArg9,(Leu8)-BK for 30 min and then exposed to 1 µM BK. IL-6 levels in supernatants were assessed by ELISA as described in MATERIALS AND METHODS. The results are expressed as mean ± SEM of three separate experiments. ***P < 0.001 compared with untreated cells; #P < 0.05, ##P < 0.01, and ###P < 0.001 compared with cells with BK alone.

 
BK-Induced IL-6 Secretion Requires De Novo Protein Synthesis in Human ASM Cells
To study whether the IL-6 secretion by BK may be caused by an increase in gene expression, RT-PCR analyses were performed to study the effect of BK on IL-6 mRNA levels. Semi-quantitative analysis of RT-PCR products revealed BK-induced increases in IL-6 mRNA at 30 min (Figure 3A); these increases were time dependent (data not shown). Levels of mRNA were normalized to total mRNA levels of GAPDH. The selective B2 receptor antagonist HOE-140 (10 µM) completely abrogated BK-induced increases in total IL-6 mRNA (Figure 3A). ASM cells were pretreated with 1 µg/ml actinomycin-D for 30 min and stimulated with 1 µM BK for 16 h. Actinomycin-D, a transcription inhibitor, almost completely abrogated BK-induced IL-6 production in ASM cells from 3,647 ± 101 to 379 ± 13 pg/ml in the presence of actinomycin D (Figure 3B), suggesting de novo protein synthesis was required for BK-induced IL-6 production.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. BK increases total mRNA levels of IL-6 in ASM via the B2 receptor. Growth-arrested ASM cells were treated with BK (1 µM) for 2 h in the presence or absence of HOE140 (10 µM added 30 min before). Cells were lysed, total mRNA was isolated, and RT-PCR was performed as described in MATERIALS AND METHODS using specific primers pairs to IL-6 and GAPDH. (A) Representative agarose gel showing the IL-6 PCR products stained with ethidium bromide. Below is the scanning densitometric of the two different gels with each value normalized over the mean density of the corresponding GAPDH PCR products. Data are expressed as fold increase over the basal and are representative of two independent experiments. (B) Effect of actinomycin-D (1 µg/ml added 30 min before) on BK-induced IL-6 production by ASM cells. IL-6 levels in supernatants were assessed by ELISA as described in MATERIALS AND METHODS. The results are expressed as mean ± SEM of three separate experiments. ***P < 0.001 compared with cells treated with BK alone.

 
ERK1/2 and p38 MAPKs Modulate BK-Induced IL-6 Secretion in Human ASM Cells
Current evidence suggests a potential role of p38 MAPK and ERK1/2 pathways in the regulation of IL-6 expression (18). We hypothesized that BK-induced IL-6 expression may be regulated by activation of MAPKs. p38 MAPK and ERK1/2 are activated in response to BK as determined by immunoblot analysis using specific antibodies against the activated forms of p38 and ERK1/2 (Figure 4). BK activated ERK1/2 phosphorylation as early as 1 min, and activation persisted for 30 min; p38 MAPK phosphorylation also increased as early as 1 min and was sustained for up to 15 min (Figure 4). Equal loadings were verified by the detection of total ERK 1/2 and p38 protein levels in cell samples. Using pharmacologic MAPK inhibitors, we investigated whether the activation of ERK 1/2 or p38 MAPK modulated BK-induced IL-6 production. PD98059 and SB203580 significantly inhibited BK-induced IL-6 production from ASM in a dose-dependent manner (Figure 5). PD90059 (30 µM) and SB203580 (10 µM) induced a 75% and 67% decrease in IL-6 production by BK, respectively. As previously reported in human ASM cells (22), the concentrations of PD98059 and SB203580 used here to inhibit BK-induced IL-6 secretion correlate with those found to inhibit MAPK activities using in vitro kinase assays. These data suggest that activation of p38 and ERK1/2 signaling pathways is required for BK to induce IL-6 secretion by ASM cells.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. BK activates p38 MAPK and ERK1/2. ASM cells were stimulated with 1 µM BK for the indicated time. Cells were lysed, and cytoplasmic extracts were prepared and assayed for the phosphorylated form of p38 and ERK1/2 by immunoblot analysis as described in MATERIALS AND METHODS. Results are representative of three separate blots.

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. SB203580 and PD98059 inhibit BK-induced expression of IL-6. ASM cells were stimulated with 1 µM BK in the presence or absence of the indicated concentrations of PD98059 (A) or SB203580 (B) added 1 h before. IL-6 levels in supernatants were assessed by ELISA as described in MATERIALS AND METHODS. The results are expressed as mean ± SEM of three separate experiments. ***P < 0.001 compared with untreated cells; ##P < 0.01 and ###P < 0.001 compared with cells with BK alone.

 
Activator Protein-1 Regulates BK-Induced IL-6 Secretion in Human ASM Cells
Current evidence suggests a potential role of activator protein (AP)-1 in the transcriptional regulation of IL-6 expression in different cell types (23, 24). Using a luciferase reporter construct that contains AP-1 enhancer elements allowed us to demonstrate that BK activates AP-1–dependent gene transcription (Figure 6A). To investigate the role of AP-1 in IL-6 secretion, we used curcumin as an AP-1 inhibitor (23, 25). Curcumin significantly reduced (by 67%) BK-induced IL-6 production in ASM cells, with levels decreasing from 3,242 ± 253 to 1,065 ± 63 pg/ml (Figure 6B). BK-induced, AP-1–dependent gene expression was inhibited by dexamethasone and indomethacin, with levels of AP-1 activation reduced from 3.31 ± 0.14 to 1.92 ± 0.40 (P < 0.05) and 1.59 ± 0.52 (P < 0.05) in cells treated with diluent and with dexamethasone and indomethacin, respectively. These data suggest that the AP-1–dependent pathway plays an important role in BK-induced IL-6 secretion.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 6. Activation of AP-1 regulates BK-induced IL-6 expression. (A) ASM cells transfected with AP-1-luc reporter construct were pretreated with 10 µM indomethacin (IND) for 30 min or 10 µM dexamethasone (DEX) for 1 h and then stimulated with 1 µM BK for 16 h. The results are expressed as mean ± SEM of three separate experiments. *P < 0.05 compared with untreated cells; #P < 0.05 compared with cells treated with BK alone. (B) Cells pretreated with 10 µM of curcumin for 1 h and then exposed to 1 µM BK for 16 h. IL-6 levels in supernatants were assessed by ELISA as described in MATERIALS AND METHODS. The results are expressed as mean ± SEM of three separate experiments. ***P < 0.001 compared with untreated cells; #P < 0.001 compared with cells treated with BK alone.

 
Dexamethasone Inhibits BK-Induced IL-6 Production
Steroids, potent anti-inflammatory agents, remain a cornerstone in the management of airway inflammation in patients with asthma. Recent evidence suggests that dexamethasone modulates gene expression in human ASM cells (13, 26). We investigated whether dexamethasone also alters BK-induced IL-6 expression. BK-induced IL-6 secretion was inhibited by dexamethasone in a concentration-dependent manner (Figure 7). With 1 µM dexamethasone, there was a 95% inhibition in IL-6 expression, with levels decreasing from 3,922 ± 84 to 727 ± 23 pg/ml in cells treated with BK in the absence or presence of dexamethasone, respectively.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 7. Dose-dependent effect of dexamethasone on BK-induced IL-6 production by ASM cells. Cells were pretreated with various concentration of dexamethasone for 1 h and then stimulated with 1 µM BK for 16 h. IL-6 levels in supernatants were assessed by ELISA as described in MATERIALS AND METHODS. The results are expressed as mean ± SEM of three separate experiments. ***P < 0.001 compared with untreated cells; ##P < 0.01 and ###P < 0.001 compared with cells with BK alone.

 
Salmeterol, PGE2, and Indomethacin Also Modulate BK-Induced IL-6 Secretion
We have previously shown that cAMP-elevating agents augmented cytokine-induced IL-6 secretion in human ASM cells (19). We tested whether ß2 adrenergic agonists (salmeterol) or PGE2, which increases cAMP in ASM cells, modulate BK-induced IL-6 secretion. PGE2 increased IL-6 secretion (Figure 8A) and significantly enhanced BK effects on IL-6 expression, with levels increasing from 3,100 ± 42 to 9,583 ± 175 pg/ml (P < 0.001). In a dose-dependent manner, salmeterol (0.01–1 µM) also significantly enhanced BK-induced IL-6 production (Figure 8B). These results suggest that cAMP-elevating agents modulate IL-6 expression not only in response to cytokines as previously described (19) but also in response to activation of GPCRs coupled to Gs. Because BK-induced gene expression in human ASM cells seems to involve COX-dependent pathways (13), we investigated whether indomethacin, a nonselective COX inhibitor, altered BK-induced IL-6 production. Indomethacin only partially reduced BK-induced IL-6 secretion (Figure 9). Indomethacin at 10 µM induced a 30% decrease in IL-6 response to BK. These results indicate that COX products only partially modulate IL-6 expression induced by BK.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 8. Salmeterol and PGE2 modulate BK-induced IL-6 production. Cells were pretreated with 1 µM PGE2 for 30 min (A) or with the indicated concentration of salmeterol for 1 h (B) before being stimulated with 1 µM BK for 16 h. IL-6 levels in supernatants were assessed by ELISA as described in MATERIALS AND METHODS. The results are expressed as mean ± SEM of three separate experiments. ***P < 0.001 compared with control; ###P < 0.001 compared with cells treated with BK alone.

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 9. Indomethacin partially inhibits BK-induced expression of IL-6. Cells were pretreated with the indicated concentration of indomethacin for 30 min and then exposed to 1 µM BK for 16 h. IL-6 levels in supernatants were assessed by ELISA as described in MATERIALS AND METHODS. The results are expressed as mean ± SEM of three separate experiments. ***P < 0.001 compared with control; #P < 0.05 compared with cells treated with BK alone.

 
Th2-Type Cytokines Differentially Modulate BK-Induced and Tumor Necrosis Factor {alpha}–Induced IL-6 Secretion
We investigate whether Th2-type cytokines altered BK-induced IL-6 expression. Investigators recently showed that IL-13 and IL-4 modulated the expression of a variety of proinflammatory genes in ASM cells (27, 28). IL-4 did not stimulate IL-6 expression when compared with BK and tumor necrosis factor (TNF)-{alpha}, which induced IL-6 secretion from 3,813 ± 158 to 7,555 ± 85 pg/ml (Figure 10). In co-stimulation experiments, IL-4 decreased BK-induced levels of IL-6 secretion by 23% (2,986 ± 128) while significantly enhancing TNF-{alpha}–induced IL-6 secretion by 78% (13,440 ± 251). IL-13 alone, which modestly stimulated IL-6 expression (from 366 ± 20 to 992 ± 71 pg/ml), significantly reduced BK-induced IL-6 expression by 30% (Figure 10B). In contrast to BK, IL-13 significantly enhanced TNF-{alpha}–induced IL-6 secretion by 40%. These data suggest that IL-4 and IL-13 exert differential regulatory effects on BK and TNF-{alpha}–stimulated levels of IL-6 in human ASM cells.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 10. IL-4 and IL-13 differentially regulate BK- and TNF{alpha}-induced IL-6 expression. Cells were treated with 1 µM BK or 10 ng/ml TNF{alpha} alone or in the presence of 50 ng/ml of IL-4 (A) or IL-13 (B) for 16 h. IL-6 levels in supernatants were assessed by ELISA as described in MATERIALS AND METHODS. The results are expressed as mean ± SEM of three separate experiments. *P < 0.05, ***P < 0.001 compared with basal, #P < 0.05, and ##P < 0.01 compared with cells treated with BK (1) or TNF{alpha} (2) alone.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
BK, a bronchoconstrictor nonapeptide, may regulate airway inflammation by stimulating secretion of proinflammatory mediators. The current study shows that BK, via the B2 receptor, stimulates IL-6 expression in human ASM cells by activating MAPKs (p38 and ERK1/2), AP-1–dependent pathways. Indomethacin and dexamethasone inhibited, whereas salmeterol enhanced, BK-induced IL-6 secretion. Th2 cytokines, IL-4, and IL-13 differentially regulate IL-6 expression induced by BK and TNF-{alpha}.

Our finding that B2 receptor activation modulates ASM cell function is consistent with previous studies showing that the B2 receptor is the predominant receptor mediating BK-induced cellular responses in human ASM cells. B2 receptor activation can stimulate the expression of various proinflammatory mediators, such as VEGF, IL-8, and PGE2 (4, 12, 13). In earlier studies using HOE-140, we also showed that increases in cytosolic calcium in ASM cells (10, 11) and relaxant responses in guinea pig tracheal rings (29) in response to BK were dependent on B2 receptor activation. Similarly, Hayashi and colleagues showed that B2 receptor antagonists abrogated the stimulatory effect of BK on IL-6 and IL-8 production in human lung fibroblasts (5). Because B2 antagonists provided a significant improvement in the airflow obstruction and in the late-phase inflammatory response in some patients with severe asthma (7), our findings support the notion that that B2 receptor may play a role in regulating airway inflammation and remodeling in asthma. However, the signaling pathways associated with B2 receptor that regulate IL-6 expression in ASM cells remain unknown.

In previous reports, we showed that BK stimulates phosphoinositide metabolism and calcium signals in ASM cells, demonstrating that activation of B2 receptor is at least coupled to PLC-ß via the activation of Gq (10, 11, 29). Recent evidence, however, showed that activation of B2 receptor also stimulates the induction of COX-2 and indirectly stimulates Gs via the autocrine secretion of PGE2 that activates EP receptor coupled to Gs (4). Pang and colleagues also determined that the regulation of expression of IL-8 and VEGF by BK in ASM cells was completely blocked by indomethacin, suggesting that BK regulates gene expression via COX-dependent pathways (12, 13). In contrast to their findings, however, we found that indomethacin only partially abrogated BK-induced IL-6 secretion (35%), suggesting that COX-dependent and COX-independent pathways are involved in BK-induced IL-6 production. These data show that BK differentially modulates expression of IL-6 and IL-8 in human ASM cells. Our results also confirmed previous findings (19) showing that treatment of ASM cells with cAMP-elevating agents, such as exogenous PGE2 or salmeterol, increased basal and agonist-induced IL-6 secretion. These observations may explain, at least in part, the synergistic effect in IL-6 expression when ASM cells were costimulated with BK and cAMP-elevating agents because BK stimulated PGE2 release in ASM cells (4).

We and others have shown that dexamethasone partially abrogated TNF-{alpha}–induced IL-6 expression in human ASM cells (20, 26). In our current study, dexamethasone almost completely abrogated BK-induced IL-6 secretion, with more than 95% inhibition. The suppressive effect of dexamethasone on IL-6 expression seems to be stimuli specific because dexamethasone was less effective in abrogating IL-6 production in response to TNF-{alpha} (20), suggesting that activation of cytokine receptors and of GPCRs may use different downstream pathways to regulate IL-6 gene expression. Similarly, dexamethasone completely blocked BK-induced IL-8 expression in ASM cells (13). The mechanisms by which dexamethasone regulates BK-induced gene expression remain unknown, but several hypotheses could be raised. Dexamethasone could completely abrogate the transcriptional induction of the COX-2 gene (31, 32). Therefore, it is possible that dexamethasone suppresses IL-6 expression in part by decreasing the ability of BK to produce PGE2, a key pathway in the regulation of IL-6 expression in ASM cells (19, 26). Dexamethasone may also act at the transcriptional level because steroid anti-inflammatory effects are due in part to the interaction with transcription factors such as NF-{kappa}B, AP-1 (33), and the IL-6 promoter region, which contains binding sites for C/EBP-ß, NF-{kappa}B, and AP-1 (24, 34). Because in ASM cells cytokine-induced activation of NF-{kappa}B was insensitive to dexamethasone (32) and because BK does not induce NF-{kappa}B activation (32), these data suggest that a NF-{kappa}B–independent pathway may play a role in the regulation of BK-induced IL-6 expression by dexamethasone. AP-1, c-Fos/c-Jun is another class of transcription factors that regulate inflammatory genes expression that involve IL-6 (23, 24). Using cells transfected with an AP-1 luciferase reporter, we found that BK induces AP-1–dependent gene expression. In addition, the AP-1–dependent pathway seems to be necessary for BK-induced gene expression, as demonstrated by the ability of the curcumin to abrogate BK-induced IL-6 expression. AP-1 activation by BK was found to be sensitive to dexamethasone and indomethacin, revealing at least one potential mechanism by which these pharmacologic agents regulate gene expression in human ASM cells. Our data are in agreement with previous reports in ASM (26) and in human lung (35), where AP-1 activation was significantly repressed by glucocorticoid treatment. These data suggest that induction of AP-1 is an essential transcription factor mediating the effect of BK on gene expression and that dexamethasone exerts their inhibitory effect on BK-induced IL-6 expression by possibly modulating the AP-1–dependent pathway. Additional studies are needed to characterize the mechanisms by which pharmacologic agents regulate AP-1 activation.

In human ASM cells, evidence suggests that p38 MAPK and ERK 1/2 activation regulates expression of proinflammatory genes, including IL-6, in response to TNF-{alpha} alone or in the presence of cytokines (18, 36) such as IL-13 (27) and IL-1ß (22) or growth factors such as EGF (37). The current study demonstrates that BK induces a rapid activation of ERK1/2 and p38 MAPK as shown by the increase in protein phosphorylation by immunoblot analyses. Similar kinetics of ERK1/2 and p38 MAPK activation by BK was also observed in human lung fibroblasts (5). Selective pharmacologic inhibitors revealed that ERK 1/2 and p38 MAPK pathways, in part, modulate BK-induced IL-6 expression, whereas cytokine-induced IL-6 secretion was more effectively abrogated by p38 MAPK inhibition (18). In agreement with previous findings showing the role of MAPKs in IL-6 expression (34), our data suggest that BK regulates IL-6 expression in ASM cells by activating signaling pathways that are predominantly MAPK- and steroid sensitive and that are COX-dependent and COX-independent. The nature of these pathways is being investigated.

Th2 cytokines, such as IL-4, IL-5, and IL-13, which are important mediators in the pathogenesis of asthma (38), modulate the expression of a variety of genes in human ASM cells (28). In the current study, IL-13 modestly stimulated IL-6 expression but decreased BK-induced IL-6 release while enhancing TNF-{alpha}–induced IL-6 secretion. We also found that IL-4 had similar effects by inhibiting BK-induced IL-6 response while enhancing TNF-{alpha}–induced IL-6 secretion. These findings support the notion that Th2 cytokines may functionally interact with other agonists (GPCR and cytokines) to regulate gene expression in human ASM cells. Some researchers have shown similar findings, with IL-4 and IL-13 inhibiting the release of RANTES and IL-8 induced by TNF-{alpha} and IFN-{gamma} (39, 40), whereas others have shown that IL-4– and IL-13–induced eotaxin expression was augmented by TNF-{alpha} (27). Our study establishes that IL-13 and IL-4 partially inhibit BK-induced gene expression in human ASM cells. This functional interaction among Th2 cytokines and GPCR activation may be important in the regulation of ASM hyper-contractility induced by IL-13 and IL-4 (41, 42). Additional studies will clarify whether Th2 cytokines modulate GPCR-associated signaling pathways as shown with other cytokines, such as TNF-{alpha} (26, 43).

The current study demonstrates that BK stimulated IL-6 expression in cultured ASM cells in a B2 receptor-dependent manner by activating ERK1/2 and p38 MAPK. Expression of IL-6 by BK is differentially regulated by cAMP mobilizing agents, by Th2 cytokines, and by dexamethasone. The effect of BK on IL-6 expression also involves the transcription factor AP-1, whose activation is modulated by steroids and indomethacin. These data support the hypothesis that BK not only regulates ASM contraction but may also modulate airway inflammation in asthma. Understanding the signaling mechanisms by which BK regulates gene expression in ASM cells may lead to the design of new therapeutic approaches for the treatment of asthma.


    Acknowledgments
 
This work was supported by Grants R01-HL64063 (R.A.P.), R01-HL55301 (R.A.P.), and IP50-HL67663 (R.A.P.) from the national institute of health and RG-062-N (Y.A.) from the American Lung Association. Yassine Amrani is a Parker B. Francis Fellow in Pulmonary Research. The authors thank Andrew Eszterhas and Mary McNichol for assistance in the preparation of the manuscript.

Received in original form April 13, 2002

Received in final form July 27, 2002


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Barnes, P. J. 1992. Bradykinin and asthma. Thorax 47:979–983.[Medline]
  2. Farmer, S. G., and R. M. Burch. 1992. Biochemical and molecular pharmacology of kinin receptors. Ann. Rev. Pharmacol. Toxicol. 32:511–536.[CrossRef][Medline]
  3. Pyne, N. J., D. Tolan, and S. Pyne. 1997. Bradykinin stimulates cAMP synthesis via mitogen-activated protein kinase-dependent regulation of cytosolic phospholipase A2 and prostaglandin E2 release in airway smooth muscle. Biochem. J. 328:689–694.
  4. Pang, L., and A. J. Knox. 1997. PGE2 release by bradykinin in human airway smooth muscle cells: involvement of cyclooxygenase-2 induction. Am. J. Physiol. 273:L1132–L1140.[Abstract/Free Full Text]
  5. Hayashi, R., N. Yamashita, S. Matsui, T. Fujita, J. Araya, K. Sassa, N. Arai, Y. Yoshida, T. Kashii, M. Maruyama, E. Sugiyama, and M. Kobayashi. 2000. Bradykinin stimulates IL-6 and IL-8 production by human lung fibroblasts through ERK- and p38 MAPK-dependent mechanisms. Eur. Respir. J. 16:452–458.[Abstract]
  6. Pan, Z. K., B. L. Zuraw, C. C. Lung, E. R. Prossnitz, D. D. Browning, and R. D. Ye. 1996. Bradykinin stimulates NF-kappaB activation and interleukin 1beta gene expression in cultured human fibroblasts. J. Clin. Invest. 98:2042–2049.[Medline]
  7. Proud, D. 1998. The kinin system in rhinitis and asthma. Clin. Rev. Allergy Immunol. 16:351–364.[Medline]
  8. Paegelow, I., H. Werner, G. Vietinghoff, and U. Wartner. 1995. Release of cytokines from isolated lung strips by bradykinin. Inflamm. Res. 44:306–311.[CrossRef][Medline]
  9. Maggi, C. A., A. Giachetti, R. D. Dey, and S. I. Said. 1995. Neuropeptides as regulators of airway function: vasoactive intestinal peptide and the tachykinins. Physiol. Rev. 75:277–322.[Free Full Text]
  10. Amrani, Y., A. Da Silva, O. Kassel, and C. Bronner. 1994. Biphasic increase in cytosolic free calcium induced by bradykinin and histamine in cultured tracheal smooth muscle cells: is the sustained phase artifactual? Naunyn Schmiedebergs Arch. Pharmacol. 350:662–669.[Medline]
  11. Amrani, Y., C. Magnier, J. Enouf, F. Wuytack, and C. Bronner. 1995. Ca2+ increase and Ca(2+)-influx in human tracheal smooth muscle cells: role of Ca2+ pools controlled by sarco-endoplasmic reticulum Ca(2+)-ATPase 2 isoform. Br. J. Pharmacol. 115:1204–1210.[Medline]
  12. Knox, A. J., L. Corbett, J. Stocks, E. Holland, Y. M. Zhu, and L. Pang. 2001. Human airway smooth muscle cells secrete vascular endothelial growth factor: up-regulation by bradykinin via a protein kinase C and prostanoid-dependent mechanism. FASEB J. 15:2480–2488.[Abstract/Free Full Text]
  13. Pang, L., and A. J. Knox. 1998. Bradykinin stimulates IL-8 production in cultured human airway smooth muscle cells: role of cyclooxygenase products. J. Immunol. 161:2509–2515.[Abstract/Free Full Text]
  14. Lazaar, A. L., and R. A. Panettieri, Jr. 2001. Airway smooth muscle as an immunomodulatory cell: a new target for pharmacotherapy? Curr. Opin. Pharmacol. 1:259–264.[CrossRef][Medline]
  15. Kishimoto, T. 1989. The biology of interleukin-6. Blood 74:1–10.[Free Full Text]
  16. Broide, D. H., M. Lotz, A. J. Cuomo, D. A. Coburn, E. C. Federman, and S. I. Wasserman. 1992. Cytokines in symptomatic asthma airways. J. Allergy Clin. Immunol. 89:958–967.[CrossRef][Medline]
  17. Yokoyama, A., N. Kohno, S. Fujino, H. Hamada, Y. Inoue, S. Fujioka, S. Ishida, and K. Hiwada. 1995. Circulating interleukin-6 levels in patients with bronchial asthma. Am. J. Respir. Crit. Care Med. 151:1354–1358.[Abstract]
  18. Amrani, Y., A. J. Ammit, and R. A. Panettieri, Jr. 2001. Tumor necrosis factor receptor (TNFR) 1, but not TNFR2, mediates tumor necrosis factor-alpha-induced interleukin-6 and RANTES in human airway smooth muscle cells: role of p38 and p42/44 mitogen-activated protein kinases. Mol. Pharmacol. 60:646–655.[Abstract/Free Full Text]
  19. Ammit, A., R. Hoffman, Y. Amrani, A. Lazaar, D. Hay, T. Torphy, R. Penn, and R. J. Panettieri. 2000. Tumor necrosis factor-alpha-induced secretion of RANTES and interleukin-6 from human airway smooth-muscle cells: modulation by cyclic adenosine monophosphate. Am. J. Respir. Cell Mol. Biol. 23:794–802.[Abstract/Free Full Text]
  20. McKay, S., S. J. Hirst, M. B. Haas, J. C. de Jongste, H. C. Hoogsteden, P. R. Saxena, and H. S. Sharma. 2000. Tumor necrosis factor-alpha enhances mRNA expression and secretion of interleukin-6 in cultured human airway smooth muscle cells. Am. J. Respir. Cell Mol. Biol. 23:103–111.[Abstract/Free Full Text]
  21. Krymskaya, V. P., A. J. Ammit, R. K. Hoffman, A. J. Eszterhas, and R. A. Panettieri, Jr. 2001. Activation of class IA PI3K stimulates DNA synthesis in human airway smooth muscle cells. Am. J. Physiol. 280:L1009–L1018.[Abstract/Free Full Text]
  22. Hallsworth, M., L. Moir, D. Lai, and S. Hirst. 2001. Inhibitors of mitogen-activated protein kinases differentially regulate eosinophil-activating cytokine release from human airway smooth muscle. Am. J. Respir. Crit. Care Med. 164:688–697.[Abstract/Free Full Text]
  23. Kondo, A., Y. Koshihara, and A. Togari. 2001. Signal transduction system for interleukin-6 synthesis stimulated by lipopolysaccharide in human osteoblasts. J. Interferon Cytokine Res. 21:943–950.[CrossRef][Medline]
  24. Eickelberg, O., A. Pansky, R. Mussmann, M. Bihl, M. Tamm, P. Hildebrand, A. P. Perruchoud, and M. Roth. 1999. Transforming growth factor-beta1 induces interleukin-6 expression via activating protein-1 consisting of JunD homodimers in primary human lung fibroblasts. J. Biol. Chem. 274:12933–12938.[Abstract/Free Full Text]
  25. Ahmad, M., P. Theofanidis, and R. M. Medford. 1998. Role of activating protein-1 in the regulation of the vascular cell adhesion molecule-1 gene expression by tumor necrosis factor-alpha. J. Biol. Chem. 273:4616–4621.[Abstract/Free Full Text]
  26. Ammit, A. J., A. L. Lazaar, C. Irani, G. M. O'Neill, N. D. Gordon, Y. Amrani, R. B. Penn, and R. A. Panettieri, Jr. 2002. Tumor necrosis factor-alpha -induced secretion of RANTES and interleukin-6 from human airway smooth muscle cells. Modulation by glucocorticoids and beta-agonists. Am. J. Respir. Cell Mol. Biol. 26:465–474.[Abstract/Free Full Text]
  27. Moore, P. E., T. L. Church, D. D. Chism, R. A. Panettieri, Jr., and S. A. Shore. 2002. IL-13 and IL-4 cause eotaxin release in human airway smooth muscle cells: a role for ERK. Am. J. Physiol. Lung Cell. Mol. Physiol. 282:L847–L853.[Abstract/Free Full Text]
  28. Lee, J. H., N. Kaminski, G. Dolganov, G. Grunig, L. Koth, C. Solomon, D. J. Erle, and D. Sheppard. 2001. Interleukin-13 induces dramatically different transcriptional programs in three human airway cell types. Am. J. Respir. Cell Mol. Biol. 25:474–485.[Abstract/Free Full Text]
  29. Da Silva, A., Y. Amrani, A. Trifilieff, and Y. Landry. 1995. Involvement of B2 receptors in the bradykinin-induced relaxation of guinea-pig isolated trachea. Br. J. Pharmacol. 114:103–108.[Medline]
  30. Amrani, Y., V. Krymskaya, C. Maki, and R. A. Panettieri, Jr. 1997. Mechanisms underlying TNF-alpha effects on agonist-mediated calcium homeostasis in human airway smooth muscle cells. Am. J. Physiol. 273:L1020–L1028.[Abstract/Free Full Text]
  31. Belvisi, M. G., M. A. Saunders, B. Haddadel, S. J. Hirst, M. H. Yacoub, P. J. Barnes, and J. A. Mitchell. 1997. Induction of cyclo-oxygenase-2 by cytokines in human cultured airway smooth muscle cells: novel inflammatory role of this cell type. Br. J. Pharmacol. 120:910–916.[CrossRef][Medline]
  32. Amrani, Y., A. L. Lazaar, and R. A. Panettieri, Jr. 1999. Up-Regulation of ICAM-1 by cytokines in human tracheal smooth muscle cells involves an NF-{kappa}B-dependent signaling pathway that is only partially sensitive to dexamethasone. J. Immunol. 163:2128–2134.[Abstract/Free Full Text]
  33. Barnes, P., and I. Adcock. 1998. Transcription factors and asthma. Eur. Respir. J. 12:221–234.[Abstract]
  34. Craig, R., A. Larkin, A. M. Mingo, D. J. Thuerauf, C. Andrews, P. M. McDonough, and C. C. Glembotski. 2000. p38 MAPK and NF-kappa B collaborate to induce interleukin-6 gene expression and release: evidence for a cytoprotective autocrine signaling pathway in a cardiac myocyte model system. J. Biol. Chem. 275:23814–23824.[Abstract/Free Full Text]
  35. Adcock, I. M., C. R. Brown, H. Shirasaki, and P. J. Barnes. 1994. Effects of dexamethasone on cytokine and phorbol ester stimulated c-Fos and c-Jun DNA binding and gene expression in human lung. Eur. Respir. J. 7:2117–2123.[Abstract]
  36. Hedges, J. C., C. A. Singer, and W. T. Gerthoffer. 2000. Mitogen-activated protein kinases regulate cytokine gene expression in human airway myocytes. Am. J. Respir. Cell Mol. Biol. 23:86–94.[Abstract/Free Full Text]
  37. Pascual, R. M., C. K. Billington, I. P. Hall, R. A. Panettieri, Jr., J. E. Fish, S. P. Peters, and R. B. Penn. 2001. Mechanisms of cytokine effects on G protein-coupled receptor-mediated signaling in airway smooth muscle. Am. J. Physiol. Lung Cell. Mol. Physiol. 281:L1425–L1435.[Abstract/Free Full Text]
  38. Wills-Karp, M., J. Luyimbazi, X. Xu, B. Schofield, T. Y. Neben, C. L. Karp, and D. D. Donaldson. 1998. Interleukin-13: central mediator of allergic asthma. Science 282:2258–2261.[Abstract/Free Full Text]
  39. John, M., B. T. Au, P. J. Jose, S. Lim, M. Saunders, P. J. Barnes, J. A. Mitchell, M. G. Belvisi, and K. F. Chung. 1998. Expression and release of interleukin-8 by human airway smooth muscle cells: inhibition by Th-2 cytokines and corticosteroids. Am. J. Respir. Cell Mol. Biol. 18:84–90.[Abstract/Free Full Text]
  40. John, M., S. J. Hirst, P. J. Jose, A. Robichaud, N. Berkman, C. Witt, C. H. Twort, P. J. Barnes, and K. F. Chung. 1997. Human airway smooth muscle cells express and release RANTES in response to T helper 1 cytokines: regulation by T helper 2 cytokines and corticosteroids. J. Immunol. 158:1841–1847.[Abstract]
  41. Venkayya, R., M. Lam, M. Willkom, G. Grunig, D. B. Corry, and D. J. Erle. 2002. The Th2 lymphocyte products IL-4 and IL-13 rapidly induce airway hyperresponsiveness through direct effects on resident airway cells. Am. J. Respir. Cell Mol. Biol. 26:202–208.[Abstract/Free Full Text]
  42. Laporte, J. C., P. E. Moore, S. Baraldo, M. H. Jouvin, T. L. Church, I. N. Schwartzman, R. A. Panettieri, Jr., J. P. Kinet, and S. A. Shore. 2001. Direct effects of interleukin-13 on signaling pathways for physiological responses in cultured human airway smooth muscle cells. Am. J. Respir. Crit. Care Med. 164:141–148.[Abstract/Free Full Text]
  43. MacEwan, D. J. 2002. TNF receptor subtype signalling: differences and cellular consequences. Cell. Signal. 14:477–492.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. H. Kim, D. Jain, O. Tliba, B. Yang, W. F. Jester Jr., R. A. Panettieri Jr., Y. Amrani, and E. Pure
TGF-{beta} potentiates airway smooth muscle responsiveness to bradykinin
Am J Physiol Lung Cell Mol Physiol, October 1, 2005; 289(4): L511 - L520.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Sivashanmugam, L. Tang, and Y. Daaka
Interleukin 6 Mediates the Lysophosphatidic Acid-regulated Cross-talk between Stromal and Epithelial Prostate Cancer Cells
J. Biol. Chem., May 14, 2004; 279(20): 21154 - 21159.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, C.-D.
Right arrow Articles by Amrani, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, C.-D.
Right arrow Articles by Amrani, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2003 American Thoracic Society.