help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chabot, S.
Right arrow Articles by Chignard, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chabot, S.
Right arrow Articles by Chignard, M.
American Journal of Respiratory Cell and Molecular Biology. Vol. 28, pp. 347-353, 2003
© 2003 American Thoracic Society
DOI: 10.1165/rcmb.4883

Surfactant Protein A Inhibits Lipopolysaccharide-Induced In Vivo Production of Interleukin-10 by Mononuclear Phagocytes during Lung Inflammation

Sophie Chabot, Laurent Salez, Francis X. McCormack, Lhousseine Touqui and Michel Chignard

Unité de Défense Innée et Inflammation, Unité Associée Institut Pasteur/Institut National de la Santé et de la Recherche Médicale, U485, Paris, France; and Division of Pulmonary and Critical Care Medicine, Department of Medicine, University of Cincinnati, Cincinnati, Ohio

Address correspondence to: Dr. Michel Chignard, Unité de Défense Innée et Inflammation, Unité Associée Institut Pasteur/Institut National de la Santé et de la Recherche Médicale, U485, 25 rue du Dr. Roux, 75015 Paris, France. E-mail: chignard{at}pasteur.fr


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We previously demonstrated that resident alveolar macrophages from naive mice do not synthesize interleukin (IL)-10, whereas mononuclear phagocytes (MP) recruited during the lung inflammatory process are transiently competent for IL-10 production when exposed to lipopolysaccharide (LPS) in vitro. As surfactant protein A (SP-A), a member of the collectin family, inhibits LPS-induced in vitro IL-10 formation by bone marrow–derived macrophages, we studied its effect on MP under in vivo inflammatory conditions. When mice with LPS-induced inflamed lungs were given a second intranasal LPS administration, IL-10 concentration recovered in the bronchoalveolar lavage fluids varied as a function of the time interval between the two LPS doses. Thus, IL-10 concentration increased with the number of MP up to Day 3, and then decreased to undetectable values within 24 h, despite a continued increase in the number of MP. Analysis of IL-10 mRNA from purified MP indicated that gene expression correlated with the IL-10 level in the bronchoalveolar lavage fluid. In contrast to IL-10 production, SP-A concentrations during LPS-induced inflammation decreased with a nadir at Day 3, and then increased significantly within 24 h. Furthermore, intranasal administration of exogenous SP-A to mice with LPS-induced inflamed lungs led to a repression of the IL-10 production. In summary, this study demonstrates for the first time an in vivo inhibitory role of SP-A on the anti-inflammatory activity of MP, through inhibition of IL-10 production.

Abbreviations: acethylcholinesterase, AchE • acute respiratory distress syndrome, ARDS • bronchoalveolar lavage fluid, BALF • enzyme-linked immunosorbent assay, ELISA • interleukin, IL • lipopolysaccharide, LPS • monoclonal antibody, mAb • mononuclear phagocytes, MP • phycoerythrin, PE • polymorphonuclear neutrophils, PMN • surfactant protein A, SP-A • solid phase immunoenzyme assay, SPIE-IA • tumor necrosis factor-{alpha}, TNF-{alpha}


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lipopolysaccharides (LPS), which are biologically active components of the outer membrane of gram-negative bacteria, are important inducers of septic shock and acute respiratory distress syndrome (ARDS), a lung injury state with a high mortality rate (1). LPS activates monocytes/macrophages and induces the production of a number of molecules, including cytokines such as the tumor necrosis factor-{alpha} (TNF-{alpha}), which indirectly recruits polymorphonuclear neutrophils (PMN) into the inflammatory site (2, 3). However, LPS-activated mononuclear phagocytes also produce interleukin (IL)-10 (4, 5), an anti-inflammatory cytokine (6, 7). IL-10 deactivates macrophages (8, 9), inhibits TNF-{alpha} formation (10), and reduces cellular recruitment to the lung after LPS challenge (11, 12). Donnelly and coworkers (13) have found elevated concentrations of IL-10 in the alveolar spaces of patients with ARDS compared with control subjects. In addition, they have shown an inverse correlation between the mortality rate and the IL-10 concentration in the bronchoalveolar lavage fluids (BALF), suggesting an important role for this anti-inflammatory mediator in modulating the proinflammatory response.

We previously reported that resident alveolar macrophages from mice fail to produce IL-10 in vivo and in vitro upon LPS stimulation (14). Interestingly, we also observed that during the lung inflammatory process induced by LPS, newly recruited mononuclear phagocytes are by contrast transiently competent for IL-10 production when exposed to LPS in vitro (15). Moreover, we showed that the surfactant protein A (SP-A), the most abundant of the surfactant-associated proteins, inhibits LPS-induced IL-10 production by bone marrow–derived macrophages (15). SP-A, a member of the collectin family of C-type lectins (which includes serum mannose-binding lectin, SP-D, and conglutinin [16]), is highly conserved across species, attesting to its importance in pulmonary function. Previous studies have shown that SP-A plays an important role in innate immunity by affecting the ability of alveolar macrophages to perform host defense as demonstrated in vitro for functions such as phagocytosis (17), generation of reactive oxygen species (18), and production of TNF-{alpha} (19). Based on the demonstration that the LPS-induced production of IL-10 by newly recruited mononuclear phagocytes decreases within several days in vitro (15), we hypothesized that endogenous SP-A could repress IL-10 synthesis.

The present study examines the possible involvement of SP-A in the regulation of in vivo IL-10 production in a mouse model of LPS-induced lung inflammation that mimics ARDS. We show that the IL-10 production by newly recruited monocytes is transient and inversely correlated with the SP-A concentration in the BALF. We further show that the in vivo administration of exogenous SP-A inhibits IL-10 production. Our results demonstrate for the first time an in vivo role of SP-A on the modulation of IL-10 production during lung inflammation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents
LPS (Escherichia coli O55:B5) was from Sigma-Aldrich (St. Louis, MO). Human SP-A was isolated from the lung washings of patients with alveolar proteinosis by a modification of the method of Suwabe and colleagues (20), which includes a serial sedimentation of the surfactant pellet in the presence of 1 mM Ca2+, elution with EDTA and adsorption to mannose-sepharose. The level of LPS associated with the SP-A was 140 pg LPS/µg SP-A. Diff-Quik products were from Dade Behring (Paris, France) and the tetramethylbenzidine substrate was from Kirkegaard-Perry-Laboratories (Gaithersburg, MD). Rat anti-murine TNF-{alpha} monoclonal Ab (mAb), MP6-XT3 and MP6-XT22, and the anti-murine IL-10 mAb, JES-2A5, were kind gifts of M. A. Nahori (Institut Pasteur, Paris, France), and these same mAb conjugated with acethylcholinesterase (AchE) were prepared by C. Creminon (Commissariat à l'Energie Atomique, Saclay, France). R-phycoerythrin(PE)-conjugated rat anti-mouse Ly-6G (Gr-1) and Ly-6C mAb (RB6–8C5) was from PharMingen (San Diego, CA). The anti-granulocyte mAb RB6–8C5 was prepared as previously described (21). Recombinant murine IL-10 and TNF-{alpha} was obtained from Immugenex (Los Angeles, CA).

Administration of LPS, SP-A, or RB6–8C5 to Mice
Seven-week-old male C57Bl/6 mice weighing 25–30 g, provided by the Centre d'Elevage R. Janvier (Le Genest St. Isle, France), were lightly anesthetized by ether inhalation and intranasally inoculated with 330 µg/kg of sonicated LPS or 3 µg of SP-A dissolved in 50 µl of saline. In some experiments, mice were treated intravenously with the mAb RB6–8C5 at a concentration of 10 µg/mice 24 h before LPS challenge, and at a concentration of 5 µg/mice 24 h before BALF collection. Mice were cared for in accordance with Pasteur Institut guidelines in compliance with the European animal welfare regulations.

Collection of BALF
At different time intervals, animals were killed by an intraperitoneal administration of a lethal dose of sodium pentobarbital (Sanofi, Libourne, France). The trachea of each mouse was cannulated, and bronchoalveolar lavage was performed with a syringe by multiple cycles of instillation and aspiration with unitary 0.5 ml saline to provide either 1 ml of BALF for cytokine determination or 4 ml of BALF for cell isolation. There were no significant differences in the total volume of saline infused into the lungs or in the volume recovered after the lavage procedure among any experimental groups. Collected cells were counted (Coulter Electronics Limited, Luton, UK) and cell differential counts were determined after cytospin centrifugation and staining with Diff-Quik products. Cytokine concentrations were measured in the cell-free BALF obtained after centrifugation (300 x g for 15 min).

Measurement of Immunoreactive IL-10 Content of Supernatants by Immunoenzyme Assay
Concentrations of IL-10 were determined by a solid phase immunoenzyme assay (SPIE-IA) (22, 23) as previously described (14). Briefly, the SPIE-IA is an immunometric assay using the same anti-murine IL-10 (JES-2A5) mAb for both capture and revelation steps. Assays were performed in 96-well microtiter plates (MaxiSorp; Nunc, Roskilde, Denmark), coated with 10 µg/ml purified JES-2A5. For the immunologic capture, 100 µl of IL-10 standards (15.6–2,000 pg/ml) or samples were added to coated plates for 18 h at 4°C. This was followed by epitope immobilization and epitope release. Thus, after washing the plates (phosphate buffer 10 mM, pH 7.4, 0.1% Tween 20), a 0.25% glutaraldehyde solution (100 µl) was added into each well, and the reaction was allowed to proceed for 5 min at 20°C while stirring. Wells were then washed, and 100 µl/well of a 10 mg/ml borane–trimethylamine complex solution containing 1 N HCl was added for an additional 5 min while shaking. Finally, after a washing step, the binding of the labeled antibody was performed by adding 100 µl/well of the JES-2A5-AchE conjugate at the concentration of 10 Ellman U/ml for 18 h at 4°C. For measurements of the solid-phase bound enzyme activity, plates were extensively washed and solid-phase bound AchE activity was determined colorimetrically by adding 200 µl of Ellman's medium. Absorbance was read at 405 nm. The lower limit of detection of this assay is ~ 10 pg IL-10/ml sample.

Measurement of Immunoreactive TNF-{alpha} Content of Supernatants by Enzyme Immunometric Assay
Levels of TNF-{alpha} in the BALF and cell supernatants were also determined by an enzyme immunometric assay as previously described (14). Immunometric assays were performed in 96-well microtiter plates (MaxiSorp; Nunc), coated with 10 µg/ml anti–TNF-{alpha} mAb, MP6-XT3. The one-step procedure used for immunometric assays involved the simultaneous addition of 100 µl of TNF-{alpha} standards (7.8–1,000 pg/ml) or samples, and 100 µl of the anti–TNF-{alpha} mAb, MP6-XT22-AchE conjugate, at the concentration of 10 Ellman U/ml. The following steps were performed exactly as described for IL-10. The lower limit of detection of this assay is ~ 15 pg TNF-{alpha}/ml sample.

Measurement of Immunoreactive SP-A Content of Supernatants
SP-A level in the BALF was determined by enzyme-linked immunosorbent assay (ELISA) as previously described (24). Briefly, ELISA was performed in 96-well microtiter plates, coated overnight at room temperature with 10 µg/ml of anti–SP-A polyclonal Ab diluted in 0.1 M NaHCO3. To block nonspecific binding, plates were incubated 30 min at room temperature with a solution of 3% dry milk, 1% triton in phosphate-buffered saline. For immunologic capture, 100 µl of native rat SP-A standards (156.25–20,000 pg/ml) or samples serial dilutions were loaded. Following an incubation at 37°C for 1.5 h, plates were washed three times, and 100 µl of a 20 µl/ml solution of anti-SP-A Ab coupled to horseradish peroxidase was added to each well. Then plates were incubated for an additional 1.5 h at 37°C. After the last wash, 100 µl of tetramethylbenzidine substrate were added to each well. Plates were then placed in the dark for 15 min, and the reaction was stopped by adding 100 µl of sulfuric-acid-2N. Plates were read at 450 nm with an automatic microplate reader.

Isolation of Mononuclear Cells from BALF
Cells from BALF were counted and incubated 30 min at 4°C at the appropriate ratios with PE-conjugated RB6–8C5 mAb that selectively binds PMN and eosinophils. Cells were washed twice and incubated with MACS anti-PE microbeads (Miltenyi Biotec, Bergish Gladbach, Germany) for 15 min at 4°C. After washing, cells were resuspended in 5 ml of phosphate-buffered saline/0.5% fetal calf serum, and mononuclear cells were isolated by passing the Ab-coated cell suspensions through a column on an AutoMACS magnetic cell separator. Mononuclear cells were counted and used for mRNA extraction.

mRNA Extraction and RT-PCR for TNF-{alpha}, IL-10, and ß-Actin
Total RNA were isolated from purified mononuclear cells according to the method described by Chomczynski and Sacchi (25). cDNA were produced by incubating 5 µg of total RNA, 0.5 µg hexamers as primers (Institut Pasteur, Paris, France), 20 U RNasin (Promega France, Charbonnières, France), 200 U M-MTLV reverse transcriptase RNase H- (Promega), and 0.5 mM dNTP in a total volume of 25 µl in the manufacturer's buffer, for 1 h at 42°C. Intron-differential RT-PCR was performed using specific primers for TNF-{alpha} (sense, AAGCCTGTAGCCCACGTCGTAGCA; antisense, CCTTGGGGCAGGGGCTCTTGACGG), for IL-10 (sense, CTGGACAACATACTGCTAACCGAC; antisense, ATTCATTCATGGCCTTGTAGACACC) and for ß-actin (sense, GGACTCCTATGTGGGTGACGAGG; antisense, GGGAGAGCATAGCCCTCGTAGAT) as control. Amplifications were performed on a Peltier thermal cycler apparatus type 200 (MJ Research, Watertown, MA). For a 100 µl-reaction, 5 µl of cDNA (serial dilutions), primers (100 mM each), dNTP (0.2 mM each), MgCl2 (0.8 mM), and Eurobiotaq polymerase (2.5 U) (Eurobio, Les Ulis, France) in the manufacturer's buffer were used. The thermocycling protocol was as follows: 95°C for 3 min, then 38 cycles of: denaturation at 95°C for 45 s, annealing at 62°C (ß-actin and IL-10) or 64°C (TNF-{alpha}) for 45 s, and extension at 72°C for 45 s, then a final incubation at 72°C for 7 min. Amplification products were resolved on a 1.5% agarose gel containing 0.5 µg/ml ethidium bromide. Gels were recorded after amplification with an Ultra-Lum system (Ultra-Lum Inc., Carson, CA) under UV light, and semi-quantification was achieved using ImageQuant on a Storm (Molecular Dynamics, Sunnyvale, CA). Serial dilutions for each time point (data not shown) verified that PCR was performed in the linear phase of the amplification reactions. In all cases, experiments were performed with a pool of cells collected from several mice, as indicated in the legends of the figures.

Statistical Analysis
Results were expressed as means ± SEM for the indicated number of independently performed experiments. Comparisons between values were analyzed by the Student's t test for unpaired data and P values of less than 0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Time Course of LPS-Induced Cell Recruitment, and IL-10 and TNF-{alpha} Productions in Inflamed Lungs of Mice
We have previously shown that during the lung inflammatory process induced by LPS, newly recruited mononuclear phagocytes are transiently competent for IL-10 production when exposed to LPS in vitro (15). We wanted to test this competence under in vivo conditions. A first administration of LPS was performed to induce the recruitment of inflammatory cells such as mononuclear cells and PMN. As observed in Figure 1, PMN number increased significantly with a peak at 24 h followed by a decrease to the basal level by Day 4. T cells were only observed at Days 3 and 4. Analysis of monocyte and macrophage populations revealed that their numbers increased steadily from Day 0 to Day 4. On this basis, a unique second intranasal administration of LPS was performed at different time points for the purpose of inducing in vivo activation of recruited mononuclear cells. Production of IL-10 and TNF-{alpha} were measured 6 h later by evaluating their concentrations in the BALF. The time-course of IL-10 production (Figure 2) increased steadily up to Day 3, and then decreased so abruptly that IL-10 was undetectable in the BALF of mice that received the secondary LPS administration at Day 4. To verify that 6 h after the second LPS instillation is a sufficient time to measure IL-10 in the BALF, we performed kinetic experiments up to 24 h in mice which received the secondary LPS administration at Day 3. IL-10 production increased steadily and reached a maximum value 6 h after the second LPS challenge (15 min, 25.2 ± 14.8 pg/ml; 1 h, 66.5 ± 23.8 pg/ml; 3 h, 174.7 ± 37.5 pg/ml; 6 h, 207.9 ± 37.9 pg/ml; and 24 h, 184.3 ± 24.1 pg/ml, mean ± SEM, n = 5).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1. Differential cell accumulation in the lung airways as a function of time after intranasal instillation of LPS to mice. Mice received 330 µg/kg LPS intranasally, and BALF were collected at different time intervals thereafter. PMN (squares), macrophages/monocytes (diamonds), and T cells (triangles) were counted after cytocentrifugation and hematoxylin/eosin staining. Results are expressed as the mean ± SEM obtained from three distinct animals for each time point.

 


View larger version (27K):
[in this window]
[in a new window]
 
Figure 2. Time course of LPS-induced IL-10 (diamonds) and TNF-{alpha} (squares) productions in inflamed lungs of mice. Following the first intranasal instillation of 330 µg/kg LPS at Day 0 (inflamed mice), a unique secondary challenge of LPS (330 µg/kg) was administrated intranasally at different time intervals between Day 1 and Day 7. After 6 h, BALF were collected and cytokines were assayed in the cell-free supernatants. Results are expressed as the mean ± SEM obtained from three distinct animals for each time point.

 
Contrasting to time course of IL-10 production, the BALF TNF-{alpha} concentration displayed no significant variation until Day 5, after which it declined progressively. It is important to note that LPS administration to naive mice did not induce IL-10 production (see Day 0), indicating that resident cells are incompetent for the synthesis of IL-10. Furthermore, PMN did not account for the IL-10 production. Indeed, when mice were pretreated with a mAb (RB6–8C5) that selectively binds and depletes mouse PMN (21), we observed no significant difference for IL-10 production between treated (167 ± 45 pg/ml) and control mice (190 ± 26 pg/ml) at Day 3 (mean ± SEM, n = 3, P > 0.05). These results are consistent with our previous report (15), and indicate that newly recruited monocytes are responsible for the IL-10 production observed in inflamed lungs.

IL-10 and TNF-{alpha} mRNA Expression by Mononuclear Cells after LPS-Induced Lung Inflammation
To know whether the absence of IL-10 detection in BALF at Day 4 resulted from a degradation of the protein or from modulation of transcription, IL-10 mRNA were evaluated. As shown in Figure 3, LPS administration to inflamed lungs induced IL-10 mRNA expression by mononuclear cells at Day 3 (P < 0.02, Day 0 versus Day 3, n = 3) and this expression was considerably decreased at Day 4 (P < 0.04, Day 3 versus Day 4, n = 3). By contrast, TNF-{alpha} mRNA expression did not significantly vary between Days 0, 3, and 4. These data are indicative of bimodal transcriptional regulation of the expression of the mononuclear phagocyte IL-10 gene during the course of the inflammatory process.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 3. TNF-{alpha} and IL-10 mRNA expression by mononuclear phagocytes after LPS-induced lung inflammation. Following the intranasal administration of 330 µg/kg LPS (inflamed mice), a unique second challenge of LPS (330 µg/kg) was administrated intranasally at Day 3 or Day 4. Cells from BALF were collected 6 h later and mononuclear cells were selected by an AutoMACS magnetic cell separator. Total cellular mRNA were extracted and subjected to RT-PCR (see MATERIALS AND METHODS). (A) Electrophoresed and ethidium bromide–stained IL-10, TNF-{alpha}, and ß-actin mRNA amplification products obtained from each indicated time point. (B) Specific IL-10, TNF-{alpha}, and ß-actin DNA-PCR products were quantified by densitometry analysis, and ratio of IL-10 or TNF-{alpha} to ß-actin calculated. Results are expressed as the mean ± SEM obtained from three separate experiments each performed with a pool of cells collected from three mice for each time point. * P < 0.04 and **P < 0.02.

 
SP-A Concentration in the BALF after Intranasal Administration of LPS
At Day 4, there was no more IL-10 detectable in BALF, although the influx of monocytes which produce IL-10 was maximal at this time. Our previous report showed that SP-A, an alveolar protein with known immunomodulatory activities, dramatically inhibits LPS-induced IL-10 formation by bone marrow–derived macrophages (15). These data suggested a possible role for SP-A in the in vivo regulation of IL-10 production in our inflammatory model. To verify this hypothesis, we first measured the SP-A concentration in BALF as a function of time after one administration of LPS, to evaluate the quantity of SP-A at the time of the second LPS administration. As shown in Figure 4, SP-A concentration decreased slowly until Day 3 (P < 0.04, Day 0 versus Day 3, n = 6) and then increased significantly at Day 4 through Day 7 (P < 0.008, Day 3 versus Day 4, n = 6). These findings clearly show that SP-A and IL-10 concentrations vary conversely, suggesting a relationship between the repression of IL-10 production by monocytes and the increase of SP-A level in the airspaces.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. SP-A concentration in the BALF after intranasal administration of LPS. BALF were collected each day after a single intranasal administration of LPS (330 µg/kg) and SP-A concentrations were determined by ELISA in cell-free supernatants of the BALF as described in MATERIALS AND METHODS. Results are means ± SEM (n = 6). * P < 0.04 and **P < 0.008.

 
Intranasal Administration of SP-A Inhibits LPS-Induced IL-10 Production in Inflamed Lungs
To demonstrate the possible involvement of SP-A in the inhibition of IL-10 production at Day 4, mice pretreated with LPS received 3 µg SP-A intranasally at Days 1 and 2 before being challenged on Day 3 with intranasal LPS for the induction of IL-10 production. Compared with control, there was a significant decrease of IL-10 production in mice that received SP-A, whereas TNF-{alpha} production was the same (Figure 5). Total cells and PMN counts were similar between the two mouse groups (data not shown). Collectively, these data indicate that exogenous SP-A specifically represses IL-10 production.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 5. Intranasal administration of SP-A inhibits LPS-induced IL-10 production in inflamed lungs of mice. Mice received LPS (330 µg/kg), and 24 h and 48 h later SP-A (3 µg; striped bars) or saline (open bars), and finally, 72 h later, LPS (330 µg/kg), all given intranasally. BALF were collected 6 h after the last LPS administration. Cytokines were assayed in cell-free supernatants of the BALF. Results are means ± SEM (n = 3). *SP-A–treated group with value significantly different (P < 0.02) from the saline group.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Innate host defense is characterized by a fine balance between an effective inflammatory response and the maintenance of tissue integrity. Monocytes/macrophages are the main cells responsible for maintaining this equilibrium. In fact, these cells release a variety of proinflammatory molecules, including TNF-{alpha}, as well as anti-inflammatory mediators such as IL-10. Reciprocal interactions between these two cytokines control the inflammatory response. Thus, TNF-{alpha} plays a role in the induction of IL-10 production by stimulated monocytes (26), and IL-10 inhibits TNF-{alpha} formation (10). Accordingly, the study of IL-10 production is essential to the understanding of the regulation of the inflammatory process.

We previously demonstrated that the administration of LPS in the airways of mice triggers the production of IL-10 inefficiently, but induces the recruitment of inflammatory cells, including PMN and mononuclear phagocytes, which are competent to synthesize IL-10 in vitro upon LPS challenge (15). Here, we show that a second in vivo administration of LPS which mimics the persistence of an inflammatory stimulus, between Days 1 and 3, triggers in vivo IL-10 production by the newly recruited inflammatory cells. PMN are not thought to produce IL-10 (27), although Romani and coworkers (28) have reported that these cells are able to secrete IL-10 in a candidiasis model. To rule out PMN as a potential source of IL-10 in our model, mice were depleted from PMN before LPS treatment (21). Under these conditions, IL-10 was still detectable with similar concentrations and kinetics. In addition, cells collected from the airways at Day 3 expressed IL-10 mRNA even after the removal of PMN by AutoMACS magnetic cell separator (see MATERIALS AND METHODS). Concerning T cells, it is well known that they produce IL-10 (29). Nonetheless, in the present study, T cells were not detected in the airways between Day 0 and Day 2. They appeared at Day 3 and their number increased slightly at Day 4, whereas IL-10 was found at Days 1 and 2 but not at Day 4. Thus, we conclude that in our inflammatory model recruited monocytes are the main source for IL-10 synthesis, which is in agreement with our previous data (15).

During the three first days of LPS-induced lung inflammation, IL-10 production increased steadily upon LPS secondary challenge, along with the number of mononuclear phagocytes. Surprisingly, the IL-10 level decreased abruptly between Days 3 and 4, even as the monocyte number continued to increase. We previously demonstrated that SP-A, the most abundant surfactant protein in the lung, inhibits the in vitro production of IL-10 by LPS-stimulated bone marrow–derived macrophages (15), cells which, like newly recruited monocytes, were never in contact with SP-A. The present study investigated the involvement of SP-A in the in vivo inhibition of IL-10 synthesis during lung inflammation. First, we observed an inverse relationship between the repression of IL-10 production by monocytes and the increase of SP-A level in the BALF between Days 3 and 4. McIntosh and colleagues (30) also showed an increase of SP-A levels in lavage fluid of LPS-treated rats. They concluded that this upregulation might be a protective response for the lung. Several mechanisms could potentially account for the SP-A level augmentation. One possibility is that the metabolism of SP-A is altered, either through a decrease of its uptake or an increase of its secretion. A study by Sugahara and coworkers (31) showed an increase of SP-A protein and mRNA production by type II cells from Day 3 to Day 7 after an intratracheal administration of LPS to rodents. This increase in SP-A levels was associated with the proliferation of alveolar epithelial cells. Under our experimental conditions, we could not exclude the possibility that the modulation of the SP-A concentration was due to the presence of PMN. Indeed, PMN secrete numerous serine proteinases (32, 33) and reactive oxygen free radicals (34) that degrade SP-A. To test this hypothesis, we removed PMN with the mAb RB6–8C5, and measured SP-A concentrations in LPS-challenged mice. We did not find a significant difference between RB6–8C5-treated and control mice (data not shown), thus ruling out a possible role of PMN in the modification of SP-A level in BALF.

We further showed that the in vivo administration of exogenous SP-A inhibits IL-10 production, and we hypothesized that this effect was due to an interaction of SP-A with newly recruited monocytes. Indeed, it is known that SP-A binds to monocytes (35) and that this binding is greater than that observed with in vitro differentiated alveolar macrophages (36). Monocytes migrate to the lung and enter the alveoli, where they come into contact with surfactant and differentiate into alveolar macrophages (37). This differentiation pathway consists of changes in the cell surface expression of adhesion molecules (38), disappearance of high-affinity binding of the complement component C3 through the C3 receptor (39), and changes in the response of the cells to various extracellular and intracellular signals, including glucocorticoid-induced eicosanoid inhibition (40). Mechanisms involved in this maturation are not known, although it has been postulated that surfactant proteins may provide a vital differentiation signal (41). In fact, SP-A increases the expression of monocyte cell surface markers that play important roles in innate immunity such as CD14 which binds LPS, CD11b which is involved in iC3b binding, and ICAM-1 (CD54) (42). These data provide compelling evidence that SP-A is able to modify the phenotype of monocyte. Therefore, we speculate that intranasally administrated SP-A binds to recruited monocytes and modulates cellular programs which result in the loss of their IL-10 production capacity.

In this in vivo inflammatory model, exogenous SP-A administration has no effect on TNF-{alpha} level measured in BALF. This is surprising, because it has been demonstrated that SP-A inhibits in vitro production of TNF-{alpha} by macrophages stimulated by LPS (43). Moreover, SP-A gene-targeted mice produced significantly more TNF-{alpha} than wild-type mice after intratracheal administration of LPS (44), suggesting an in vivo inhibitory effect of SP-A on TNF-{alpha} production. However, SP-A has also been reported to induce the production of TNF-{alpha} (4547) by a mechanism which may involve the Toll-like receptor (48). Some possible explanations for these disparate findings are that SP-A effects vary with the type of the effector cell, the state of cell activation, or the type of insult.

Also, it is of note that the cellular sources and intracellular signaling pathways accounting for TNF-{alpha} and IL-10 production are distinct. Indeed, TNF-{alpha} is produced by a variety of cells, including alveolar macrophages and monocytes, whereas IL-10, as demonstrated in this study, is only synthesized by newly recruited monocytes. Moreover, it is known that the TNF-{alpha} gene is regulated by NF-{kappa}B, whereas IL-10 synthesis appears to occur through an NF-{kappa}B–independent pathway (50). Given these considerations, we propose that SP-A differentially regulates TNF-{alpha} and IL-10 production.

In summary, this study shows that newly recruited monocytes transiently synthesize the anti-inflammatory cytokine IL-10 in vivo. We further show that the SP-A level in BALF of LPS-treated mice, following a slight decrease, begins to increase progressively at a point that is precisely correlated with the precipitous loss of IL-10 production by monocytes. Moreover, intranasal administration of exogenous SP-A to mice with inflamed lungs represses IL-10 production. We thus demonstrate the in vivo inhibitory role of SP-A on IL-10 production by newly recruited monocytes during lung inflammation. It is of note that, as in our animal model, the concentration of IL-10 is significantly higher at Days 1 and 3 than at Day 7 in patients suffering from ARDS (51). We propose that the inhibition of IL-10 production by SP-A provides a proinflammatory stimulus that enhances the efficient clearance of inhaled pathogens through multiple pathways of the innate host defense.


    Acknowledgments
 
S.C. was supported by a grant from Ministère de la Recherche, and F.X.M. by NIH grant HL 61612.

Received in original form April 18, 2002

Received in final form August 20, 2002


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Nicholas, T. E., I. R. Doyle, and A. D. Bersten. 1997. Surfactant replacement therapy in ARDS: white knight or noise in the system? Thorax 52:195–197.[Abstract]
  2. Tracey, K. J., and A. Cerami. 1993. Tumor necrosis factor: an updated review of its biology. Crit. Care Med. 21:S415–S422.[Medline]
  3. Strieter, R. M., S. L. Kunkel, and R. C. Bone. 1993. Role of tumor necrosis factor-alpha in disease states and inflammation. Crit. Care Med. 21:S447–S463.[Medline]
  4. Strassmann, G., V. Patil-Koota, F. Finkelman, M. Fong, and T. Kambayashi. 1994. Evidence for the involvement of interleukin 10 in the differential deactivation of murine peritoneal macrophages by prostaglandin E2. J. Exp. Med. 180:2365–2370.[Abstract/Free Full Text]
  5. Platzer, C., C. Meisel, K. Vogt, M. Platzer, and H. D. Volk. 1995. Up-regulation of monocytic IL-10 by tumor necrosis factor-alpha and cAMP elevating drugs. Int. Immunol. 7:517–523.[Abstract/Free Full Text]
  6. Moore, K. W., A. O'Garra, R. de Waal Malefyt, P. Vieira, and T. R. Mosmann. 1993. Interleukin-10. Annu. Rev. Immunol. 11:165–190.[CrossRef][Medline]
  7. Lalani, I., K. Bhol, and A. R. Ahmed. 1997. Interleukin-10: biology, role in inflammation and autoimmunity. Ann. Allergy Asthma Immunol. 79:469–483.[Medline]
  8. Fiorentino, D. F., A. Zlotnik, T. R. Mosmann, M. Howard, and A. O'Garra. 1991. IL-10 inhibits cytokine production by activated macrophages. J. Immunol. 147:3815–3822.[Abstract]
  9. Bogdan, C., Y. Vodovotz, and C. Nathan. 1991. Macrophage deactivation by interleukin 10. J. Exp. Med. 174:1549–1555.[Abstract/Free Full Text]
  10. Gerard, C., C. Bruyns, A. Marchant, D. Abramowicz, P. Vandenabeele, A. Delvaux, W. Fiers, M. Goldman, and T. Velu. 1993. Interleukin 10 reduces the release of tumor necrosis factor and prevents lethality in experimental endotoxemia. J. Exp. Med. 177:547–550.[Abstract/Free Full Text]
  11. Rogy, M. A., T. Auffenberg, N. J. Espat, R. Philip, D. Remick, G. K. Wollenberg, E. M. Copeland III, and L. L. Moldawer. 1995. Human tumor necrosis factor receptor (p55) and interleukin 10 gene transfer in the mouse reduces mortality to lethal endotoxemia and also attenuates local inflammatory responses. J. Exp. Med. 181:2289–2293.[Abstract/Free Full Text]
  12. Pajkrt, D., L. Camoglio, M. C. Tiel-van Buul, K. de Bruin, D. L. Cutler, M. B. Affrime, G. Rikken, T. van der Poll, J. W. ten Cate, and S. J. van Deventer. 1997. Attenuation of proinflammatory response by recombinant human IL-10 in human endotoxemia: effect of timing of recombinant human IL-10 administration. J. Immunol. 158:3971–3977.[Abstract]
  13. Donnelly, S. C., R. M. Strieter, P. T. Reid, S. L. Kunkel, M. D. Burdick, I. Armstrong, A. Mackenzie, and C. Haslett. 1996. The association between mortality rates and decreased concentrations of interleukin-10 and interleukin-1 receptor antagonist in the lung fluids of patients with the adult respiratory distress syndrome. Ann. Intern. Med. 125:191–196.[Abstract/Free Full Text]
  14. Salez, L., M. Singer, V. Balloy, C. Creminon, and M. Chignard. 2000. Lack of IL-10 synthesis by murine alveolar macrophages upon lipopolysaccharide exposure: comparison with peritoneal macrophages. J. Leukoc. Biol. 67:545–552.[Abstract]
  15. Salez, L., V. Balloy, N. van Rooijen, M. Lebastard, L. Touqui, F. X. McCormack, and M. Chignard. 2001. Surfactant protein A suppresses lipopolysaccharide-induced IL-10 production by murine macrophages. J. Immunol. 166:6376–6382.[Abstract/Free Full Text]
  16. Day, A. J. 1994. The C-type carbohydrate recognition domain (CRD) superfamily. Biochem. Soc. Trans. 22:83–88.[Medline]
  17. Tenner, A. J., S. L. Robinson, J. Borchelt, and J. R. Wright. 1989. Human pulmonary surfactant protein (SP-A), a protein structurally homologous to C1q, can enhance FcR- and CR1-mediated phagocytosis. J. Biol. Chem. 264:13923–13928.[Abstract/Free Full Text]
  18. van Iwaarden, F., B. Welmers, J. Verhoef, H. P. Haagsman, and L. M. van Golde. 1990. Pulmonary surfactant protein A enhances the host-defense mechanism of rat alveolar macrophages. Am. J. Respir. Cell Mol. Biol. 2:91–98.
  19. Kremlev, S. G., and D. S. Phelps. 1994. Surfactant protein A stimulation of inflammatory cytokine and immunoglobulin production. Am. J. Physiol. 267:L712–L719.[Abstract/Free Full Text]
  20. Suwabe, A., R. J. Mason, and D. R. Voelker. 1996. Calcium dependent association of surfactant protein A with pulmonary surfactant: application to simple surfactant protein A purification. Arch. Biochem. Biophys. 327:285–291.[CrossRef][Medline]
  21. Chignard, M., and V. Balloy. 2000. Neutrophil recruitment and increased permeability during acute lung injury induced by lipopolysaccharide. Am. J. Physiol. 279:L1083–L1090.
  22. Pradelles, P., J. Grassi, C. Creminon, B. Boutten, and S. Mamas. 1994. Immunometric assay of low molecular weight haptens containing primary amino groups. Anal. Chem. 66:16–22.[Medline]
  23. Etienne, E., C. Creminon, J. Grassi, D. Grouselle, J. Roland, and P. Pradelles. 1996. Enzyme immunometric assay of thyroliberin (TRH). J. Immunol. Methods 198:79–85.[CrossRef][Medline]
  24. McCormack, F. X., J. H. Fisher, A. Suwabe, D. L. Smith, J. M. Shannon, and D. R. Voelker. 1990. Expression and characterization of rat surfactant protein A synthesized in Chinese hamster ovary cells. Biochim. Biophys. Acta 1087:190–198.[Medline]
  25. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156–159.[Medline]
  26. Wanidworanun, C., and W. Strober. 1993. Predominant role of tumor necrosis factor-alpha in human monocyte IL-10 synthesis. J. Immunol. 151:6853–6861.[Abstract]
  27. Cassatella, M. A. 1999. Neutrophil-derived proteins: selling cytokines by the pound. Adv. Immunol. 73:369–509.[Medline]
  28. Romani, L., A. Mencacci, E. Cenci, R. Spaccapelo, G. Del Sero, I. Nicoletti, G. Trinchieri, F. Bistoni, and P. Puccetti. 1997. Neutrophil production of IL-12 and IL-10 in candidiasis and efficacy of IL-12 therapy in neutropenic mice. J. Immunol. 158:5349–5356.[Abstract]
  29. Malefyt, R. W. 1998. Interleukin-10. In Cytokines. A. R. Mire-Sluis and R. Thorpe, editors. Academic Press, London. 151–155.
  30. McIntosh, J. C., A. H. Swyers, J. H. Fisher, and J. R. Wright. 1996. Surfactant proteins A and D increase in response to intratracheal lipopolysaccharide. Am. J. Respir. Cell Mol. Biol. 15:509–519.[Abstract]
  31. Sugahara, K., K. Iyama, K. Sano, Y. Kuroki, T. Akino, and M. Matsumoto. 1996. Overexpression of surfactant protein SP-A, SP-B, and SP-C mRNA in rat lungs with lipopolysaccharide-induced injury. Lab. Invest. 74:209–220.[Medline]
  32. Schochett, P., R. Mora, L. Mark, M. Butler, and E. P. Ingenito. 1999. Calcium-dependent degradation of surfactant protein A by activated neutrophils due to serine proteases. Exp. Lung Res. 25:595–616.[CrossRef][Medline]
  33. Ryan, S. F., Y. Ghassibi, and D. F. Liau. 1991. Effects of activated polymorphonuclear leukocytes upon pulmonary surfactant in vitro. Am. J. Respir. Cell Mol. Biol. 4:33–41.
  34. Mark, L., and E. P. Ingenito. 1999. Surfactant function and composition after free radical exposure generated by transition metals. Am. J. Physiol. 276:L491–L500.[Abstract/Free Full Text]
  35. Geertsma, M. F., P. H. Nibbering, H. P. Haagsman, M. R. Daha, and R. van Furth. 1994. Binding of surfactant protein A to C1q receptors mediates phagocytosis of Staphylococcus aureus by monocytes. Am. J. Physiol. 267:L578–L584.[Abstract/Free Full Text]
  36. Chroneos Z, S. Faske, B. Strub, J. A. Reed, M. Yoshida, B. C. Trapnell, and J. A. Whitsett. 2000. Expression of surfactant protein A receptor, SP-R210 is regulated during macrophage differentiation. Am. J. Respir. Crit. Care Med. 161:A246. (Abstr.)
  37. van oud Alblas, A. B., and R. van Furth. 1979. Origin, Kinetics, and characteristics of pulmonary macrophages in the normal steady state. J. Exp. Med. 149:1504–1518.[Abstract/Free Full Text]
  38. Prieto, J., A. Eklund, and M. Patarroyo. 1994. Regulated expression of integrins and other adhesion molecules during differentiation of monocytes into macrophages. Cell. Immunol. 156:191–211.[CrossRef][Medline]
  39. Coonrod, J. D., and K. Yoneda. 1983. Effect of rat alveolar lining material on macrophage receptors. J. Immunol. 130:2589–2596.[Abstract]
  40. De Caterina, R., R. Sicari, D. Giannessi, P. L. Paggiaro, P. Paoletti, G. Lazzerini, W. Bernini, E. Solito, and L. Parente. 1993. Macrophage-specific eicosanoid synthesis inhibition and lipocortin-1 induction by glucocorticoids. J. Appl. Physiol. 75:2368–2375.[Abstract/Free Full Text]
  41. Tino, M. J., and J. R. Wright. 1999. Surfactant proteins A and D specifically stimulate directed actin-based responses in alveolar macrophages. Am. J. Physiol. 276:L164–L174.
  42. Kremlev, S. G., and D. S. Phelps. 1997. Effect of SP-A and surfactant lipids on expression of cell surface markers in the THP-1 monocytic cell line. Am. J. Physiol. 272:L1070–L1077.[Abstract/Free Full Text]
  43. McIntosh, J. C., S. Mervin-Blake, E. Conner, and J. R. Wright. 1996. Surfactant protein A protects growing cells and reduces TNF-alpha activity from LPS-stimulated macrophages. Am. J. Physiol. 271:L310–L319.[Abstract/Free Full Text]
  44. Borron, P., J. C. McIntosh, T. R. Korfhagen, J. A. Whitsett, J. Taylor, and J. R. Wright. 2000. Surfactant-associated protein A inhibits LPS-induced cytokine and nitric oxide production in vivo. Am. J. Physiol. Lung Cell. Mol. Physiol. 278:L840–L847.[Abstract/Free Full Text]
  45. Weikert, L. F., J. P. Lopez, R. Abdolrasulnia, Z. C. Chroneos, and V. L. Shepherd. 2000. Surfactant protein A enhances mycobacterial killing by rat macrophages through a nitric oxide-dependent pathway. Am. J. Physiol. Lung Cell. Mol. Physiol. 279:L216–L223.[Abstract/Free Full Text]
  46. Barr, F. E., H. Pedigo, T. R. Johnson, and V. L. Shepherd. 2000. Surfactant protein-A enhances uptake of respiratory syncytial virus by monocytes and U937 macrophages. Am. J. Respir. Cell Mol. Biol. 23:586–592.[Abstract/Free Full Text]
  47. Kremlev, S. G., T. M. Umstead, and D. S. Phelps. 1997. Surfactant protein A regulates cytokine production in the monocytic cell line THP-1. Am. J. Physiol. 272:L996–1004.[Abstract/Free Full Text]
  48. Guillot, L., V. Balloy, F. X. McCormack, D. T. Golenbock, M. Chignard, and M. Si-Tahar. 2002. Cutting edge: the immunostimulatory activity of the lung surfactant protein-A involves Toll-like receptor 4. J. Immunol. 168:5989–5992.[Abstract/Free Full Text]
  49. Bondeson, J., K. A. Browne, F. M. Brennan, B. M. Foxwell, and M. Feldmann. 1999. Selective regulation of cytokine induction by adenoviral gene transfer of IkappaBalpha into human macrophages: lipopolysaccharide-induced, but not zymosan-induced, proinflammatory cytokines are inhibited, but IL-10 is nuclear factor-kappaB independent. J. Immunol. 162:2939–2945.[Abstract/Free Full Text]
  50. Park, W. Y., R. B. Goodman, K. P. Steinberg, J. T. Ruzinski, F. Radella II, D. R. Park, J. Pugin, S. J. Skerrett, L. D. Hudson, and T. R. Martin. 2001. Cytokine balance in the lungs of patients with acute respiratory distress syndrome. Am. J. Respir. Crit. Care Med. 164:1896–1903.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
B. Samten, J. C. Townsend, Z. Sever-Chroneos, V. Pasquinelli, P. F. Barnes, and Z. C. Chroneos
An antibody against the surfactant protein A (SP-A)-binding domain of the SP-A receptor inhibits T cell-mediated immune responses to Mycobacterium tuberculosis
J. Leukoc. Biol., July 1, 2008; 84(1): 115 - 123.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chabot, S.
Right arrow Articles by Chignard, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chabot, S.
Right arrow Articles by Chignard, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2003 American Thoracic Society.