American Journal of Respiratory Cell and Molecular Biology. Vol. 28, pp. 410-419, 2003
© 2003 American Thoracic Society DOI: 10.1165/rcmb.2002-0032OC
Leukotrienes Mediate Murine Bronchopulmonary Hyperreactivity, Inflammation, and Part of Mucosal Metaplasia and Tissue Injury Induced by Recombinant Murine Interleukin-13
B. Boris Vargaftig and
Monique Singer
Unité de Pharmacologie Cellulaire, Unité Associée Institut Pasteur-INSERM U485, Paris, France
Address correspondence to: Monique Singer, Unité de Pharmacologie Cellulaire, Unité Associée Institut Pasteur-INSERM U485, Institut Pasteur 25, rue du Dr Roux, 75015 Paris, France. E-mail: msinger{at}pasteur.fr
 |
Abstract
|
|---|
Interleukin (IL)-13 induces bronchopulmonary hyperreactivity (BHR), eosinophilic inflammation, and mucus accumulation in the murine airways. To investigate the potential role of leukotrienes (LT) in mediating these effects, we studied the ability of IL-13 to induce the expression of 5-lipoxygenase (5-LO), we compared the effects of IL-13 and of various leukotrienes on different biological parameters and the interference by the 5-LO inhibitor zileuton (orally, 50 mg/kg, 3 times a day for 3 days), and by some antagonists. The cysteinyl (Cys)-LTs LTC4, LTD4, LTE4, and LTB4, (1 µg/d for 3 d, instilled intratracheally) induced BHR, cell recruitment, fibroblast growth, and mucus production and release into the airways. After the intratracheal instillation of recombinant murine (rm) IL-13, Cys-LT increased in the bronchoalveolar lavage fluid (BALF) at 15 min, followed by lower amounts at 36 h. Zileuton inhibited LT production in the BALF, eosinophil and neutrophil sequestration in the lungs, and their passage into the BALF. Zileuton and the Cys-LT-receptor antagonist (ra) LY171883 or MK-571, or the LTB4-ra PH-163 (at 310, 515, and 10 mg/kg, respectively, administered intratracheally), inhibited BHR by recombinant murine IL-13. Airways mucus after recombinant murine IL-13challenge was reduced by zileuton and by LY171883, MK-571, and PH-163. LT also induced the vascular endothelium remodelling and collagen deposition. Overall, our results demonstrate the major involvement of LT in the effects of IL-13 on the lung.
Abbreviations: smooth muscle -actin, -SMA bronchoalveolar lavage fluid, BALF bronchopulmonary hyperreactivity, BHR bromodeoxyuridine, BrdU cysteinyl leukotrienes (LTC4, LTD4, LTE4), Cys-LT dimethyl sulfoxide, DMSO eosinoperoxidase, EPO immunocytochemistry, ICC leukotrienes, LT methacholine, Mch myeloperoxidase, MPO receptor antagonist, ra recombinant murine, rm
 |
Introduction
|
|---|
The cysteinyl-leukotrienes (Cys-LTC4, -LTD4, and -LTE4), and LTB4 are important mediators of inflammation and asthma (18). They induce bronchoconstriction (5, 6), inflammatory cell recruitment (1), plasma extravasion, and edema (10). They also increase mucus release from human airways in vitro (11, 12) and reduce ciliary function, promoting bronchial obstruction.
Lipoxygenase products play a role in the development of murine lung eosinophilic inflammation and allergy (4, 1322), and accordingly, lipoxygenase inhibitors prevent lung eosinophilia, inflammation, and allergy. These drugs have been developed to treat asthma (3, 1320). The interactions between the LT, which are released early after antigenic provocation, and the interleukins (IL), which are produced and released later, are poorly understood. IL-13 is a major cytokine involved in allergen-induced bronchopulmonary hyperreactivity (BHR) and mucus accumulation in different mouse strains (2326). We suggested recently that the effects of recombinant murine (rm) IL-13 may involve secondary mediators and that LT account for some of those mediators (23). Indeed, we show here that LT are released rapidly after the intra-pulmonary administration of rmIL-13 to mice. This finding led us to study the consequences of this release using specific inhibitors and antagonists. The results of the present results confirm our hypothesis that LT mediate several effects of IL-13 and, accordingly, might be relevant to diseases in which the latter is generated.
 |
Materials and Methods
|
|---|
Animals, Immunization and Materials
Male BP2 mice (Centre d'Elevage R. Janvier, Le Genest St. Isle, France), aged 68 wk, were anaesthetized with xylazine 12% (20 mg/kg) and ketamine 500 (45 mg/kg) (both from Sigma, St Louis, MO) and groups of five were challenged intratracheally with rmIL13 (4 µg, kindly provided by Dr. A. Minty, Sanofi Elf Biorecherches, Labège, France) in 50 µl of endotoxin-free 0.9% NaCl (saline) or with the Cys-LT, LTC4, LTD4, LTE4, or with LTB4 (all from Cayman Chemical, Ann Arbor, MI), 1µg or 1µg/d for 3 d or solvent as a control. Saline, rmIL-13 or LT, or drugs were administred via a temporary cannula introduced into the trachea through the oral cavity under light anesthesia, with the animal suspended vertically, which allows a better view of the trachea. Groups of mice were treated separately with the specific 5-lipoxygenase inhibitor zileuton (Zyflo, Abbott, Chicago, IL) (16, 17) given orally 1 h before then 6 h after challenge, and thereafter either twice a day at 70 mg/kg, or three times a day at 50 mg/kg, up to 24 h (for BHR) or 72 h (for BHR and mucus accumulation). The chemical component of zileuton, ICI 230 487 (Abbott), available in small amounts, was also injected intravenously at 35 mg/kg (13, 14). Two receptor antagonists for Cys-LT1-ra (both from Cayman Chemical) were instilled intratracheally: LY 171,883 or Tomelukast (16), (1-<2-hydroxy-3-propyl-4-(1H-tetrazol-5-yl) butoxy>phenyl>ethanone; or the MK-571 (17), (3-{(2-(7-chloro-2-quinolinyl)ethenyl)phenyl)}{3-dimethylamino)-3-oxopropyl)thio)methyl)thio)}-(E)-propanoic acid, sodium salt, kept as a stock solution at 10 mg/ml in saline. A stock solution of LY 171,883 in dimethyl sulfoxide (DMSO) at 25 mg/ml was used to prepare a final dilution in saline; the controls were saline (DMSO, mixed at equivalent volumes). LY 171,883 and MK-571 were instilled intratracheally at 1, (3 or) 5, 15, or 50 mg/kg corresponding to 25, 75 (or 125), 375, 1,250 µg/mouse, and 44, 220, 660, 2,200 µg/mouse, respectively, diluted in saline. The LTB4-receptor antagonist PH-163 (19), (sodium (1S*,3S*)-1-Hydroxy-3-{(3R*S*,E)-3-hydroxy-7-phenyl-1-hepten-1-yl}-1-cyclohexane acetate, was instilled intratracheally at 1, 3, 10 or 30 mg/kg (33, 100, 330, and 990 µg/mouse, respectively).
Dexamethasone (sodium salt, Sigma) was injected intravenously at 1.25 mg/kg (at 18 and 1 h before and 6, 24, and 48 h after challenge) (23). Mice were killed 24 or 72 h after challenge with rmIL-13 or LT.
To evaluate cell proliferation in vivo, bromodeoxyuridine (BrdU) (Sigma) was injected intraperitoneally at 120 mg/kg (27) 1 h before and at 50 mg/kg 1 h after the intratracheal challenge, and subsequently twice a day at 50 mg/kg until animals were killed.
Evaluation of BHR
Basal resistance of the airways and BHR were assessed in unrestrained conscious animals by barometric plethysmography (Buxco Electronics Inc., Troy, NY). The use of the intratracheal route for delivering IL-13 or LT short-cuts the upper airways. Indeed, the latters' reactivity is included in the assessment with the Buxco system. Bronchial reactivity was evaluated using noncumulative methacholine challenges (23, 28, 30). Briefly, mice were placed in a Buxco chamber and respiratory parameters were measured after methacholine aerosol inhalation for 90 s at 60 mM (Nebulizor Type LS light; System Assistance Medical, Le Ledat, France). Resistance was calculated according to the manufacturer's recommendations as: Penh (enhanced pause) = (expiratory time/relaxation time) - 1) x peak expiratory flow/peak inspiratory flow. For graphic representation, cumulative areas under the curve were used.
Bronchoalveolar Lavage Fluid
Mice were anesthetized intraperitoneally with urethane (45 mg/30 g body wt) and the trachea was incised and cannulated. Bronchoalveolar lavage fluid (BALF) was collected with 0.5 ml followed by 2 x 1 ml of saline containing EDTA (0.005 M), phenylmethylsulfoxide (0.005 M), dithiothreitol (0.005 M) (all from Sigma). The total number of nucleated cells was determined automatically with a Coulter counter, and cytospins were prepared and colored with Diff Quick (Baxter Dade AG, Duedingen, Switzerland) for differential cell count.
Determination of Cys-LT and LTB4 in the BALF by ELISA, and of MUC5AC Proteins Evaluated by ELISA
Fresh, cell-free BALF, or nitrogen-congelated cell-free BALF kept for less than 72 h were used. In some samples, a known quantity of the specific LT (LTC4 or LTB4 used as internal standards) was added before congelation to verify the integrity of the samples during the time. The quantification (pg/ml) was achieved by EIA according to the manufacturer's instructions (Enzyme immunoassay kit for Cys-LT or for LTB4 ; Cayman Chemicals, Ann Arbor, MI) as compared with a standard curve for LTB4 or Cys-LT.
MUC5AC was determined by ELISA as previously described (23).
Quantitative Reverse Transcription-Polymerase Chain Reaction
Lungs were isolated and washed with saline via the pulmonary artery. Dispersion was performed with an Ultraturrax (T25 Janke and Kunkel; IKAR-Labortechnik, Germany) for 30 s in the RNeasy Lysis buffer from the RNeasy Mini kit (Quiagen, Hilden, Germany) used for RNA extraction.
Intron-differential reverse transcription-polymerase chain reaction (RT-PCR) was performed for lungs, using specific primers for 5-LO (sequence from Genbank (NLBI, Bethesda, MD) L42198): 5' TACATCGAGTTCCCATGTTACCGC (282306); 3' CGATGCCATCCAGTAGCTCGTAAT (881857); and ß-actin as a control: 5' ACTCCTATGTGGGTGACGAGG and 3' GGGAGAGCATAGCCCTCGTAGAT.
The cDNA were obtained as previously described (23, 30, 31). PCR was performed at 63°C for annealing. Standards for ß-actin were prepared as previously described (31) and the specific PCR product for 5-LO was purified on an agarose gel. The corresponding DNA band was excised with a razor blade and then purified on a column (Ultrafree-DA (Amicon); Millipore Corp., Bedford, MA). The specificity of PCR products was verified by enzymatic digestion. The copy number was calculated according to the optical density and the purified DNA was serially diluted to obtain the appropriate standard containing 0 to 1 million copies. The copy number of the sample was calculated relative to the standard after PCR amplification on the LightCycler System (Roche Molecular Biochemicals, Mannheim, Germany) for 5-LO and for ß-actin independently, on the same cDNA preparation. The results are given as a ratio 5-LO/ß-actin copies.
MUC5AC mRNA was determined as described previously (23).
Determination of Lung Myeloperoxidase or Eosinoperoxidase Activities
Lungs were isolated and thoroughly washed with saline via the pulmonary artery, then homogenized with a Potter for 1 min at 4°C. After centrifugation, myeloperoxidase (MPO) and eosinoperoxidase (EPO) activities were determined (23, 30).
Histology
The lungs were flushed to remove blood, then inflated with optimum cutting temperature medium (Sakura FineTek, Torrance, CA) half-diluted in saline. For paraffin inclusion, the lungs were immersed in 10% formaldehyde PBS overnight at 4°C and then processed to paraffin wax. Sections 5 µm in thickness were stained with periodic acidSchiff/haematoxilin for mucins. Collagen was visualized by the van Gieson acidic-picrofuschine staining technique (32).
Quantification of mucins and collagen was achieved using the Optilab Software Version 2.1 (GRASTEK, Nirmande, France) by evaluating the labeled areas and/or by counting the labeled/nonlabeled particles (for mucus).
Immunohistochemistry
Smooth muscle -actin ( -SMC) (33, 34) was determined by immunohistochemistry. To do so, an anti -SMC monoclonal antibody produced in mice was applied to deparaffined lung sections followed by a biotin-conjugated antimouse antibody (Dako, Trappes, France) (after neutralization of endogen peroxidase by O.3% H2O2) and then a streptavidinperoxidase antibody (Dako) revealed by 3-amino-9-ethylcarbazole (Sigma). Slides were counterstained by haematoxilin Gill-2 (Shandon, Pittsburg, PA). Quantification was achieved using the Optilab System. Micrographs were performed under white or polarized light, which highlightened striated structures.
Cell Proliferation in Vivo
Immunodetection of cell-incorporated BrdU (27) was performed in the lung sections with the streptavidinbiotin system for BrdUr staining (Oncogene Research Products, Boston, MA) using a biotinylated antiBrdU antibody amplified by the streptavidinperoxidase system. BrdU was revealed by a diaminobenzidine tetrahydrochloride mixture, providing a dark-brown precipitate. The dark-brown positive nuclei in the bronchial epithelium were counted under the microscope using a grid at 400x magnification at different time points (6, 24, 72, and 96 h) after challenge, without counterstain. Results are given as a percentage of positive nuclei out of total nuclei per millimeter of basement membrane.
Secretion Assays
At 72 h after challenge with rmIL-13 or ovalbumin (i.e., on lungs full of mucus [23]), LT or rmIL-13 were instilled intratracheally to test their ability to trigger secretion. BALF was collected 3060 min. later to determine MUC5AC by ELISA, and lungs were analyzed by histology.
Statistical Analysis
All results are presented as means ± standard deviation (n = 5). Significance levels were calculated using one way analysis of variance followed by Scheffe's test, using SPSS 6.1 software (SPSS Inc., Chicago, IL) (significance between data at P < 0.05).
 |
Results
|
|---|
To investigate the LT involvement in rmIL-13induced cell recruitment, BHR, mucus accumulation, and remodelling, we first studied the kinetics of LT production after the intratracheal instillation of rmIL-13, then inhibited the 5-lipoxygenase responsible for their synthesis or prevented the LT signal with specific receptor antagonists. In separate experiments, LT were instilled intratracheally and their effects were reduced with the corresponding receptor antagonist.
Effects of the Intratracheal Challenge with rmIL-13 on the Lung Expression of 5-lipoxygenase mRNA and on LT Release into the BALF; Drug Modulation
Lungs from immunized and saline-challenged or unchallenged mice showed only traces of mRNA for 5-LO, which appeared progressively after rmIL-13 instillation and persisted for at least 72 h (Figure 1A). Zileuton significantly downregulated the expression of mRNA for 5-LO at different time points (Figure 1B).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 1. (A) Time-dependent induction of 5-LO after the intratracheal instillation of saline (S) or rmIL-13 (L13), evaluated by quantitative RT-PCR (5-LO copies/ß-actin copies, LightCycler system). (B) Inhibition by zileuton (Z) and dexamethasone (Dex) of 5-LO mRNA expression in the lungs of immunized BP2 mice, 24 h after saline (S) or rmIL-13 (IL-13) challenge. Zileuton was administred orally at 50 mg/kg, three times a day for 3 d, and dexamethasone was used at 1.25 mg/kg, 1 h before challenge, then daily intraperitoneally injections were administered for 3 d (23). *P < 0,05, n = 5.
|
|
The 5-LO products Cys-LT (LTC4, D4, E4) and LTB4 accumulated in the BALF after rmIL-13 instillation (Figure 2A). LT production was reduced by zileuton at 15 min (for Cys-LT) or at 6 h (for Cys-LT and LTB4) (Figure 2B, other time points not shown), validating our experimental conditions.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 2. (A) Time-dependent release of leukotrienes (LT) into the BALF of BP2 mice after the intratracheal instillation of rmIL-13. Schematic representation for controls at each time point, which include LTB4 or Cys-LT saline controls. (B) Inhibition by zileuton, and by dexamethasone (doses, see Figure 1) of the 5-LO products Cys-LT (high level of expression at 15 min) and LTB4 (at 6 h). *Statistical significance was calculated with the appropriate control (n = 5).
|
|
Dexamethasone inhibited rmIL-13induced expression of 5-LO mRNA (at 72 h, Figure 1B) and, as a consequence, the release of LT into the BALF (Figure 2B).
Induction of BHR by LT and Their Involvement in rmIL-13induced BHR; Drug Modulation
The intratracheal instillation of LTC4 or of LTB4 (1 µg/d for 3 d) induced BHR to methacholine 24 h after the last instillation. Under the same conditions, LTD4 and LTE4 were more efficient (Figure 3A).

View larger version (25K):
[in this window]
[in a new window]
|
Figure 3. Bronchopulmonary hyperreactivity (BHR) to methacholine (in terms of area under the curve (AUC) induced 3 d after the intratracheal instillation of (A) 1 µg/day for 3 d of LTB4 or LTC4, LTD4, LTE4; (B) saline (Sal), or drug+sal (Zil+sal or ICI+sal), or rmIL-13 (IL-13)(4 µg); zileuton (Zil.) was administred orally at 50 mg/kg, three times a day for 3 d, and ICI 230 487 (ICI) was injected intraperitoneally at 35 mg/kg, once a day for 3 d. *P < 0.05, n = 5.
|
|
To investigate whether LT are involved in rmIL-13induced BHR, zileuton was given orally at 15, 35, 50, and 70 mg/kg, twice a day. A dose-dependent inhibition of BHR was obtained (data not shown), with a maximal inhibition at 70 mg/kg twice a day, or 50 mg/kg three times a day (or at higher doses, not shown) (Figure 3B). ICI 230 487 (the chemical material contained in zileuton), injected intravenously at 35 mg/kg, which is the manufacturer-recommended dose for specific 5-LO inhibition in mice, drastically reduced BHR by rmIL-13 (Figure 3B).
The mediator role of LT was confirmed using receptor antagonists. Thus, the LTD4-ra LY 171883, instilled intratracheally 1 h before and 6 h after challenge with rmIL-13, dose-dependently inhibited BHR evaluated 24 or 72 h later (Figure 4A). Efficacy was obtained at 3 mg/kg (125 µg/mouse)lower doses were inactive. The LTD4-ra MK-571 also markedly reduced BHR at 5 mg/kg (220 µg/mouse) (Figure 4B) under the same conditions.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 4. Inhibition of BHR to methacholine by the Cys-LT-ra and LTD4-receptor antagonists LY171883 (A) or MK-571 (B), or by the LTB4 receptor antagonist PH-163 (C), 72 h after saline (Sal), or rmIL-13 (IL-13, 4 µg) intratracheal challenges. *P < 0.05, n = 5.
|
|
Instilled intratracheally at 10 mg/kg (330 µg/mouse), the LTB4 receptor antagonist PH-163 reduced BHR 24 and 72 h after rmIL-13 challenge (Figure 4C).
AT 72 h after rmIL-13, both Cys-LTra (LY 171,883 and MK-571) also inhibited BHR (not shown), in agreement with the elevated Cys-LT expression at that time (Figure 2A).
Implication of LT in rmIL-13induced Cell Recruitment and Drug Modulation
To study the involvement of LT in cell recruitment, single instillations of LTB4, LTC4, LTD4, or LTE4 (at 1 or 2 µg) were performed and failed to substantially recruit cells into the BALF at 24 or 72 h, whereas repeated administrations of 1 µg/d for 3 d were found to be effective (Table 1). Other cells found in the BALF were macrophages, stable in number and mostly activated, showing vacuoles and relaxed chromatin, as compared with that from control BALF, which contained only nonactivated macrophages.
View this table:
[in this window]
[in a new window]
|
TABLE 1 Cell populations recruited into the bronchalveolar lavage fluid 24 h after the third challenge with either of the leukotrienes at 1 µg/d for 3 d.
|
|
In contrast, zileuton blocked the rmIL-13induced recruitment of eosinophils into the lungs (measured by EPO) and reduced that of neutrophils (measured by MPO). As a consequence, their release into the BALF was blocked as well (Figure 5A and 5B). Both LTD4-ra inhibited BALF eosinophils, whereas the LTB4-ra inhibited BALF neutrophils (and eosinophils to a lesser extent) after rmIL-13 (not shown).

View larger version (43K):
[in this window]
[in a new window]
|
Figure 5. Inhibition by zileuton of eosinoperoxydase (EPO) and myeloperoxydase (MPO) in lung tissue, after saline (Sal) or rmIL-13 intratracheal challenges. *P < 0,05, n = 5.
|
|
Involvement of LT in Mucus Synthesis/Accumulation, and in Mucus Secretion after rmIL-13
rmIL-13 induces mucus accumulation in the airways (2325), and here we demonstrate that LT mediate this effect. Indeed, zileuton dose-dependently inhibited mucus accumulation in the lungs after rmIL-13 challenge, as shown by RT-PCR (Figure 6A), by ELISA for MUC5AC (Figure 6B) and by histology (Figure 7C, and Table 2). The dose providing an optimal effect was 50 mg/kg, three times a day for 3 d (23). The LTD4-receptor antagonists LY 171,883 or MK-571 also dose-dependently inhibited MUC5AC gene induction at 15 mg/kg (Figure 6A) and MUC5AC protein production at 15 mg/kg (Figure 6B), as confirmed by histology (Figure 7D and Table II). Similar observations were made after the administration of LTB4-ra PH-163 at 10 mg/kg (Figures 6A, 6B, and 8J [a]) 72 h after challenge.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 6. MUC5AC mRNA in the lungs (A, C) and MUC5AC proteins released in the BALF (B, D, E) 72 h after rmIL-13 (A, B). Interference of zileuton (Zil., orally administred (a:10 mg/kg, b: 50 mg/kg, three times a day for 3 d), or of the receptor antagonists for Cys-LT MK-571 (MK [a:1 mg/kg, b: 15 mg/kg]), or of the LTB4ra PH-163 (PH, a: 1 mg/kg, b:10 mg/kg). MUC5AC determination after LTC4 or LTD4 intratracheal instillation (C, D), with the LTD4-ra MK-571 given before LTD4, and after rmIL-13 with or without LTC4 or LTD4 intratracheal instillation (E) (to test secretion). Results: (A, B): the 5-LO inhibitor zileuton, or receptor antagonists for LT dose-dependently reduced MUC5AC synthesis (A) and production (B). (C, D): LT induce MUC5AC synthesis (C), and MUC5AC proteins produced are released in the BALF (D). (E): LT instilled intratracheally (on airways full of mucus, 72 h after the intratracheal instillation of rmIL-13) promote MUC5AC protein release into the BALF. *P < 0,05, n = 5.
|
|

View larger version (103K):
[in this window]
[in a new window]
|
Figure 7. Periodic acid-Schiff staining of neutral mucins in the airways (bright pink, counterstained with haematoxylin in purple), collected 72 h after the intratracheal instillation of saline (A), rmIL-13 (4 µg) (B), zileuton (dose, see Figure 1) + rmIL-13 (C), LY171883 (15 mg/kg) + rmIL-13 (D), release of mucus into the lumen of the airways after the intratracheal instillation of LTC4 (3 x 1 µg) (E), LTB4 (3 x 1 µg) (F), LTD4 (3 x 1 µg) (G). Secretion of mucus after the intratracheal instillation of LTD4 (H) 72 h after OVA. Note: in A, B, C, and D, rmIL-13 induces hypertrophy of the epithelial cells and mucus accumulation in the airways, which are inhibited by leukotriene inhibition or antagonism, and in E, F, G, H that LT induce mucus release into the lumen of the bronchioles and mucus secretion. After LTB4, fibroblast-like cells appeared (Fb) at endothelium level. The bar represents 100 µm.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 2 Quantification by the Optilab system of periodic acid-Schiffstained mucus in the airways (in terms of labeled areas or particles), for collagen deposition after acidic picrofuscine, and for immunocytochemistry of smooth muscle -actin in the airways and vessels. Bromodeoxyuridine-labeled cells, hand counted, are also noted.
|
|

View larger version (82K):
[in this window]
[in a new window]
|
Figure 8. Lung tissue remodelling after rmIL-13, and role of LT; (A) cell proliferation around the airways by immunodetection of BrdU-containing nuclei 72 h after rmIL-13, with haematoxylin counterstain: a few nuclei of mucin producing cells are positive (A, arrow b, dark brown precipitate), as well as some cells under the epithelium (A, arrow c), at the site of collagen deposition (B, arrow b, data not shown). Alveolar macrophages (A, arrow a) are also labeled.(B, C, D), Collagen deposition around the airways and vessels induced by the intratracheal instillation of rmIL-13, identified by van Gieson acidic picrofuschine acid staining. Collagen induces an hypertrophy of the tissues around the bronchioles and a reduction of the diameter of the lumen (B, arrow a and b), and is observed in the vessels associated to an hypertrophy around the endothelium (D, arrow a). Zileuton (C) reduces collagen deposition around the airways (C, arrow b) and in the vessels (C, arrow a), as well as hypertrophy of the tissue. (E, F, G, H, I, J) Remodelling of the vascular endothelium (E, G) and airways (F, H) after rmIL-13, identified by -SMA immunocytochemistry: smooth muscle cells remodelling ( -SMApositive) and fibroblast-like cell proliferation ( -SMAnegative) in the lumen of vessels, producing fibrills and fibers of collagen promoting vascular obstruction, are observed under polarized light (E arrow b). Dexamethasone reduced the effects of rmIL-13 on these formations (G [v]: vessel, periodic acid-Schiff staining), as did zileuton (not shown) and Cys-LT-ra LY171883 (I, arrow b), and LTB4-ra PH-163 (J [v] :vessel, periodic acid-Schiff staining). (F) Smooth muscle cells (SMC) thickening around the airways (F, arrow a): IL-13 also promoted SMC hypertrophy, with no fibers of collagen under polarized light. -SMA labeling was reduced by zileuton (H, arrow a, polarized light), but no particular BrdU labeling was observed at this level (A). Data are representative of 3 experiments. The bar represents 100 µm.
|
|
Alternatively, LT alone induced the expression of the MUC5AC gene, because the intratracheal instillation of LTC4 or LTD4 revealed an 8- to 10-fold increase in the corresponding mRNA as compared with control tissue (Figure 6C). Moreover, LTD4-induced expression was reduced by the LTD4-ra MK-571 (Figure 6C). The intratracheal instillation of each of the LT (Figure 6D) also increased the MUC5AC proteins measured in the BALF by ELISA, LTD4 and LTE4 being the most efficient. LTD4-induced MUC5AC protein was also reduced by the LTD4-ra (Figure 6D). By contrast, only a marginal mucus accumulation was observed in the epithelial cells of the airways (Figures 7E, 7F, and 7G) after the intratracheal instillation of LT. Because ELISA revealed elevated levels of MUC5AC in the BALF, it is likely that the mucus produced is immediately released into the BALF upon its production.
To assess whether they induce mucus secretion (in addition to promoting its synthesis), LT were instilled intratracheally into mice after airways had been filled with mucus (i.e., 72 h after rmIL-13). Under these conditions, elevated levels of MUC5AC were measured in the corresponding BALF by ELISA (Figure 6E) and histology showed that epithelial cells had completely released their mucus content (Figure 7Fa). Thus, in addition to stimulating mucus synthesis, LT are indeed potent secretagogues. This property was not shared by IL-13, because only traces of MUC5AC were recovered in the BALF collected 30 min after its intratracheal instillation under the same conditions (not shown) or 72 h after ovalbumin administration (Figure 6E). Accordingly, no acidic mucins were recovered (23) and the airways remained full of mucus, based on histology data (23) (Figure 7B).
Relationship between Mucus Induction or Remodelling and Cell Proliferation; Role of LT
At 72 h after the intratracheal instillation of 4 µg of rmIL-13, only a few labeled nuclei at the basal pole of mucus-producing cells were observed using BrdU labeling (2 ± 2% in saline versus 5 ± 3% after rmIL-13). After 3 instillations of rmIL-13 (4 µg the first day then 1 µg/d for 2 d), the number of labeled nuclei increased (8 ± 3%) (Figure 8A [b]) (n = 4), showing only a moderate cell proliferation. Accordingly, the intense mucus-cell metaplasia observed 72 h after challenge with rmIL-13 is not or is only marginally dependent on cell proliferation.
Furthermore, because no proliferation of mucin-producing cells was observed after LT instillation, it was determined that the latter are not involved in mucus cell proliferation.
After rmIL-13 challenge, BrdU-labeled nuclei were also observed in the vascular endothelium (not shown) at the site where smooth muscle cells ( -SMApositive) acquired a fibroblast-like phenotype (proliferating and -SMAnegative) (Figure 8E). In addition, alveolar macrophages also showed marked labeling, possibly related to their morphologic alterations observed in the BALF.
The intratracheal instillation of LT failed to induce epithelial mucin-producing cell proliferation in the bronchioles, also observed through BrdU labeling. However, LT induced a slight thickening of the endothelium of some vessels, perivascular edema, and signs of tissue disorganization. In addition, LTB4 promoted fibroblast-like cell growth at the endothelium level (Figure 7F), which was prevented by PH-163 (not shown).
Collagen Deposition in the Airways and in the Vessels, Vascular Remodelling after rmIL-13; Role of LT
As early as 72 h after the intratracheal challenge, rmIL-13 induced collagen deposition around the bronchioles, highlighted by van Gieson acidic picrofuschine staining (Figure 8B), as well as DNA synthesis at the same site, as evaluated by BrdU labeling (Figure 8A arrow c). At the endothelium level, smooth muscle cells ( -SMApositive) were undergoing remodelling (with a filamentous appearance under polarized light) (Figure 8E [a]). Fibroblast-like cells appeared inside the vessels ( -SMA negative cells, proliferating) (Figure 8E [b]). Striated structures observed with polarized light (Figure 8E), evoking fibrills and fibers of collagen (Figure 8D [b]), were present around the proliferating cells and obstructed the vessels (Figure 8E, arrow b). Zileuton reduced these formations, as well as collagen deposition in the airways and in the vessels (Figure 8C), reducing vascular and airways obstruction. Results after quantification with the Optilab system are summarized in Table 2.
Dexamethasone (5 mg/kg/day) (Figure 8G), the LTB4-ra PH-163 (30 mg/kg, 990 µg/mouse) (Figure 8J [v]) or zileuton (Table 2) reduced the local proliferation of the fibroblast-like cells and collagen deposition in the airways. Edema observed in some perivascular zones was also suppressed by dexamethasone and reduced by zileuton (not shown).
Smooth Muscle Thickening around the Airways
The thickening of smooth muscle cells around the airways induced by rmIL-13 challenge, as observed by -SMA immunocytochemistry (Figure 8F, arrow a), was also reduced by zileuton (Figure 8H, arrow a, and Table 2). No clear augmentation of BrdU-labeled cells was observed at this site (Figure 8A; data not shown), suggesting little or no cell proliferation, but rather cell hypertrophy and remodelling.
 |
Discussion
|
|---|
LT participation in human asthma, and specifically in bronchial hyperreactivity, has been widely documented (2, 3, 5, 6, 18). Accordingly, drugs preventing LT synthesis or antagonizing their effects were developed as a treatment and became useful tools for studying their role in animal models (22, 23). Because some of the intense effects of IL-13 on airways and lungs seemed to be indirect (23), we investigated whether LT mediate its effects. We targeted the 5-lipoxygenase responsible for LT synthesis and demonstrated the expression of its specific mRNA, the generation of its products, and its inhibition by the 5-LO inhibitor zileuton and by specific receptor antagonists. In a second step, we demonstrated the direct effects of LT on BHR, lung inflammation, mucus cell metaplasia, and remodelling.
The 5-LO inhibitor zileuton was first used because it inhibits the initial 5-lipoxygenase-dependent transformation of arachidonic acid via this pathway, providing Cys-LT (by LTC4-synthase) or LTB4 (by LTA4-hydrolase) (3, 8, 18). Two types of Cys-LT receptors have been described: Cys-LT1 and Cys-LT2 (2, 18), which recognize LTD4/LTE4 and LTC4, respectively. Since LTC4 is rapidly metabolized in vivo by -glutamyl transpeptidases into the more stable metabolites LTD4 and LTE4 (18), LTD4-receptor antagonists were used (LY 171,883 and MK-571) (16, 17). The specific antagonist PH-163 was used against LTB4 (19).
LT Are Expressed and Generated in the Lungs after Provocations with rmIL-13
5-lipoxygenase mRNA were time-dependently expressed in the lungs (Figure 1A), after intratracheal instillation of rmIL-13, as were the LT themselves (Figure 2A). Zileuton selectively and reversibly inhibits 5-LO activity by complexing the iron molecule of its active site (13, 14). Accordingly, inhibition by zileuton of the expression of mRNA for 5-LO was unexpected (Figure 1B), suggesting either a negative regulation of the expression of the enzyme (4) or a reduced recruitment of leukocytes after zileuton (Figure 5), providing less 5-LO.
Dexamethasone, which inhibits eosinophil and neutrophil recruitment in the murine model (23, 35), inhibited 5-LO expression (Figure 1B) and, as a consequence, LT production after rmIL-13 challenges (Figure 2B). These effects agree with the recognized properties of glucocorticosteroids (36).
LT Induce BHR and Mediate the Effects of rmIL-13
In humans, LT are potent bronchoconstrictor agents (5, 6) and here we show the ability of each LT, particularly LTD4, the most stable among Cys-LT, to induce BHR in mice (Figure 3A). Zileuton drastically reduced BHR induced by rmIL-13, as did the LTD4 receptor antagonists, indicating that LT alone can mediate BHR induced by rmIL-13.
LT Promote Cell Recruitment and Inflammation
The participation of LT in the recruitment of inflammatory cells was confirmed using zileuton, which reduced the eosinophil and neutrophil numbers in the BALF and their respective sequestration into the lungs triggered by rmIL-13 (Figure 5). LTB4 displayed in vivo chemotactic activity on neutrophils, which migrated into the BALF and only moderately attracted eosinophils. By contrast, LTC4 attracted eosinophils and some lymphocytes (see RESULTS). These observations agree with the fact that 5-LOdeficient mice display reduced cellular response to challenge (37).
Cys-LT and LTB4 Are Involved in rmIL-13induced Mucus Production and Release
LT induced mucus release but little metaplasia of the airways epithelial cells. Nevertheless, it induces mucus synthesis/production as shown by MUC5AC mRNA expression in the absence of accumulation. By contrast, rmIL-13 induced a strong hyperplasia and metaplasia of mucus cells, with mucus accumulation (23) and without secretion. In this scheme, IL-13 sets the scenario for chronic mucus accumulation, whereas LT promote production and immediate secretion of mucus. This might be relevant in pathologies such as cystic fibrosis, because high levels of IL-13 and LTB4 have been described in the BALF of patients with cystic fibrosis. LTB4 observed in the epithelial lining fluid (38) might thus favor mucus secretion, and possibly airways obstruction by lack of mucus removal, because LT are also known to reduce mucociliary clearence.
Multiple doses of LT are needed in vitro to induce measurable mucus release into the culture medium (12). Because of the limited effects of LT alone in vivo, when compared with their clear implication in mucus cell metaplasia after rmIL-13 (as indicated by the effectiveness of zileuton or of the LT receptor antagonists), it is likely that LT do not directly mediate mucus accumulation after rmIL-13. LT may cooperate with chemokines (39), and (40) or cytokines (2326, 41), operate as cofactors, or induce direct signal transduction, possibly via the transactivation of epidermal growth factor receptor (42); LT may therefore be necessary for the biological response observed.
Mucus Cell Metaplasia Is Poorly Related to Cell Proliferation in the Acute Model of Allergy
rmIL-13 challenges failed to induce acute epithelial proliferation in the bronchioles, as evaluated with BrdU (48% of BrdU-labeled cellsaccording to the stimulationversus 70% of periodic acid-Schiffpositive cells (23). Accordingly, cell proliferation does not account for the intense mucus-cell metaplasia observed 72 h after rmIL-13.
LT Promote Tissue Remodelling and Injury after rmIL-13
Instilled intratracheally, the LT as well as rmIL-13 (23) activated alveolar macrophages found in the BALF, which contained large vacuoles and relaxed chromatine (23, 43). Being activated, macrophages may produce 5-LO and its associated protein, 5-LO-activating factor as previously described (3), as well as inflammatory cytokines, such as IL-13, which participate in remodelling (9, 43, 44).
As early as 72 h after three instillations of LT, tissue remodeling, including edema, hypertrophy, and disorganization of the tissue were observed in association with the presence of fibroblast-like cells in the endothelium (Figure 7F, arrow b) and with edema between airways (a) and endothelium (b) (Figure 7F, a and b, respectively). Fibroblast proliferation was observed in vessels by rmIL-13 instillation (Figure 8G), and was partially reduced by dexamethasone, and more clearly by the LTB4-receptor antagonist PH-163 (Figure 8J [v]), and by zileuton (data not shown), suggesting LT involvement in remodelling after rmIL-13 challenge (9). Since the 5-LO expression is observed at the vascular endothelium level by in situ hybridization (45), and IL-13 induces tissue fibrosis via the activation of TGF-ß1 (46), which also produces 5-LO (46, 47), these observations support the involvement of LT in remodelling by rmIL-13.
In conclusion, we have demonstrated that the pulmonary effects of IL-13, including BHR, eosinophilic inflammation, neutrophilia, edema, mucus-cells metaplasia, remodelling with fibroblast proliferation, and collagen deposition involve LT, because inhibitors of their formation and Cys-LT1-ra or LTB4-ra were suppressive. IL-13 also promoted cell growth in the vascular endothelium, as well as tissue injury and fibrosis as in humans (47); these effects were attenuated by dexamethasone and LT inhibitors, underlining the physiopathologic potential of LT released by IL-13. Since LT promote mucus secretion in vivo, they might exert a role in mucus clearance or promote bronchial obstruction in disease, according to the specific conditions. LT are thus a major mediator of the in vivo effects of IL-13, in addition to their involvement in biological loops of regulation (39). Our results support the increasing interest of anti-LT in therapeutics against BHR and inflammation which might be further investigated. Further studies are needed to better understand the mechanisms responsible for mucus accumulation and release and those responsible for long-term processes such as remodelling and fibrosis.
 |
Acknowledgments
|
|---|
The authors thank Drs. J. P. Girard, C. Bonne, and P. Hullot from the Laboratoire de Chimie Biomoléculaire et Physiologie, CNRS ESA 5074 (Université de Montpellier I, Faculté de Pharmacie, France) for providing the LTB4-ra PH-163 and its isomer, Dr. M. Huerre for histopathologic advice, P. Ave and N. Wusher (Unité d'Histopathologie, Institut Pasteur, France) for technical advice, Dr. A. Minty (Sanofi Elf Biorecherches, Labège, France) for rmIL-13, and Dr. L. Touqui for helpful discussions. The anti -SMA monoclonal antibody (Dako) was kindly provided by the laboratory of Prof. M. Buckingham (Institut Pasteur Paris, France). The Optilab system was provided by Dr. B. Hurtrel (Institut Pasteur, Paris, France).
Received in original form March 15, 2002
Received in final form September 16, 2002
 |
References
|
|---|
- Ford-Hutchinson, A., M. A. Bray, and M. V. Doig. 1980. Leukotriene B: a potent chemokinetic and aggregating substance released from polymorphonuclear leukocytes. Nature 286:264265.[CrossRef][Medline]
- Busse, W. 1998. The role and contribution of leukotrienes in asthma. Ann. Allergy Asthma Immunol. 81:1729.[Medline]
- O'Byrne, P. M., E. Israel, and J. M. Drazen. 1997. Antileukotrienes in the treatment of asthma. Ann. Intern. Med. 127:472480.[Abstract/Free Full Text]
- Henderson, W. R., D. B. Lewis, R. K. Albert, Y. Zhang, W. J. E. Lamm, G. K. S. Chiang, F. Jones, P. Eriksen, Y. Tien, M. Jonas, and E. Chi. 1996. The importance of leukotrienes in airway inflammation in a mouse model of asthma. J. Exp. Med. 184:14831494.[Abstract/Free Full Text]
- Dahlén, S. E., P. Hedqvist, S. Hammarstrom, and B. Samuelsson. 1980. Leukotrienes are potent constrictors of human bronchi. Nature 288:484486.[CrossRef][Medline]
- Dahén, S. E., G. Hansson, P. Hedqvist, T. Björk, E. Granström, and B. Dahlén. 1983. Allergen challenge of lung tissue from asthmatics elicts bronchial contraction that correlates with release of leukotrienes C4, D4, and E4. Proc. Natl. Acad. Sci. USA 80:17121716.[Abstract/Free Full Text]
- Ford-Hutchinson, A. W. 1990. Leukotriene B4 in inflammation. Crit. Rev. Immunol. 10:112.[Medline]
- Lam, B. K. 1997. Biochemical and molecular characterization of LTC4 synthase. ACI International 9:35.
- Peters-Golden, M. 1998. Molecular mechanisms of leukotriene synthesis: the changing paradigm. Clin. Exp. Allergy 28:10591065.[CrossRef][Medline]
- Dahlén, S. E., J. Bjork, and P. Hedqvist. 1981. Leukotrienes promote plasma leakage and leukocyte adhesion in postcapillary veinules : in vivo effects with relevance to the acute inflammatory response. Proc. Natl. Acad. Sci. USA 78:38873891.[Abstract/Free Full Text]
- Marom, Z., J. H. Shelhamer, and M. Bach. 1982. Slow-reacting substances, leukotrienes C4 and D4, increase the release of mucus from human airways in vitro. Am. Rev. Respir. Dis. 126:449454.[Medline]
- Kim, K. C., J. Nassiri, and J. S. Brody. 1989. Mechanisms of airway Goblet Cell mucin release : studies with cultured tracheal surface epithelial cells. Am. J. Respir. Cell Mol. Biol. 1:137143.
- McGill, K. A., and W. W. Busse. 1996. Zileuton. Lancet. 348:519524.[CrossRef][Medline]
- Carter, G.W., P. R. Young, D. H. Albert, J. Bouska, R. Dyer, R. L. Bell, J. B. Summers, and D. W. Brooks. 1991. 5-Lipoxygenase inhibitory activity of zileuton. J. Pharmacol. Exp. Ther. 256:929937.[Abstract/Free Full Text]
- Tamaoki, J., M. Kondo, N. Sakai, J. Nakata, H. Takemura, A. Nagai, T. Takizawa, and K. Konno. 1997. Leukotriene antagonist prevents exacerbation of asthma during reduction of high-dose inhaled corticosteroid. Am. J. Respir. Crit. Care Med 155:12351240.[Abstract]
- Fleisch, J. H., L. E. Rinkema, K. D. Haisch, D. Swanson-Bean, T. Goodson, P. P. K. Ho, and W. S. Marshall. 1984. LY171883,1-<2-hydroxy-3-propyl-4-(1H-Tetrazol-5-yl) Butoxy>Phenyl>Ethanone, an orally active leukotriene D4 antagonist. J. Pharmacol. Exp. Ther. 233:148157.
- Jones, T. R., R. Zamboni, M. Belley, E. Champion, L. Charette, A. W. Ford-Hutchinson, R. Frenette, J. Y. Gauthier, S. Leger, and P. Masson. 1989. Pharmacology of L-600,711 (MK-571): a novel potent and selective leukotriene D4 receptor antagonist. Can. J. Physiol. Pharmacol. 67:1728.[Medline]
- Aharony, D. 1998. Pharmacology of leukotriene receptor antagonists. Am. J. Respir. Crit. Care Med. 157(Suppl):S214S219.[Medline]
- Hullot, P., J. M. Poudrel, A. Muller, R. Escale, J. C. Rossi, J. P. Girard, and J. C. Bonne. 1997. Synthesis and biochemical/pharmacological profile of the novel leukotriene B4 receptor antagonist sodium (1S*,3S*)-1-Hydroxy-3-{(3R*S*,E)-3-hydroxy-7-phenyl-1-hepten-1yl}-1-cyclohexane acetate. Arzneim. Forsch. 47:5158.[Medline]
- Girard, J. P., and C. Bonne. 1997. Leukotriene B4 antagonists and the search for novel anti-inflammatory agents. Rheumatoid Arthritis.1:353363.
- Trifilieff, A., A. El-Hashim, and C. Bertrand. 2000. Time course of inflammatory and remodelling events in a murine model of asthma: effect of steroid treatment. Am. J. Physiol. Lung Cell. Mol. Physiol. 279:L1120L1128.[Abstract/Free Full Text]
- Zuany-Amorim, C., B. B. Vargaftig, J. Maclouf, and M. Pretolani. 1994. Strain-dependency of leukotriene C4 generation from isolated lungs of immunized mice. Br. J. Pharmacol. 112:12301236.[Medline]
- Singer, M., J. Lefort, and B. B. Vargaftig. 2002. Granulocyte depletion and dexamethasone differentially modulate airways hyperreactivity, inflammation mucus accumulation and secretion induced by rmIL-13 or antigen. Am. J. Respir. Cell Mol. Biol. 26:111.[Free Full Text]
- Wills-Karp, M., J. Luyimbazi, X. Xu, B. Schofield, T. Y. Neben, C. L. Karp, and D. D. Donaldson. 1998. Interleukin-13: central mediator of allergic asthma. Science 282:22582261.[Abstract/Free Full Text]
- Grünig, G., M. Warnock, A. E. Wakil, R. Venkayya, F. Brombacher, D. M. Rennick, D. Sheppard, M. Mohrs, D. D. Donaldson, R. M. Locksley, and D. B. Corry. 1998. Requirement for IL-13 independently of IL-4 in experimental asthma. Science 282:22612263.[Abstract/Free Full Text]
- Walter, D. M., J. J. McIntire, G. Berry, A. N. J. McKenzie, D. D. Donaldson, R. DeKruyff, and D. T. Umetsu. 2001. Critical role of IL-13 in the developement of allergen-induced airway hyperreactivity. J. Immunol. 167:46684675.[Abstract/Free Full Text]
- Newberry, R. D., W. F. Stenson, and R. G. Lorenz. 1999. Cyclooxygenase-2-dependent arachidonic acid metabolites are essential modulators of the intestinal immune response to dietary antigen. Nat. Med. 5:900906.[CrossRef][Medline]
- Hammelmann, E., K. Takeda, A. Haczku, G. Cieslewicz, L. Schultz, Q. Hamid, Z. Xing, J. Gauldie, and E. W. Gelfand. 2000. Interleukin-5 but not immunoglobulin E reconstitutes airway inflammation and airway hyperresponsiveness in IL-4 deficient mice. Am. J. Respir. Cell Mol. Biol. 23:327334.[Abstract/Free Full Text]
- Hailé, S., J. Lefort, D. Joseph, P. Gounon, M. Huerre, and B. B. Vargaftig. 1999. Mucous-cell metaplasia and inflammatory-cell recruitment are dissociated in allergic mice after antibody-and drug-dependent cell depletion in a murine model of asthma. Am. J. Respir. Cell Mol. Biol. 20:112.[Abstract/Free Full Text]
- Lefort, J., M. Singer, D. Leduc, P. Renesto, M. A. Nahori, M. Huerre, C. Creminon, M. Chignard, and B. B. Vargaftig. 1998. Systemic administration of endotoxin induces bronchopulmonary hyperreactivity dissociated from TNF-
formation and neutrophil sequestration into the murine lungs. J. Immunol. 161:474480.[Abstract/Free Full Text]
- Colle, J.H., Falanga, P., Singer, M., Hevin, B., and Milon, G. 1997. Quantification of messenger RNA by competitive RT-PCR: a simplified read out assay. J. Immunol. Meth. 210:175184.[CrossRef][Medline]
- Ganter, P., and G. Jolles. 1970: Histochimie normale et pathologique, T2. Gauthier-Villars, Paris. p. 14241425.
- Richter, A., S. M. Puddicombe, J. L. Lordan, F. Bucchieri, S. J. Wilson, R. Djukanovic, G. Dent, S. T. Holgate, and D. E. Davies. 2001. The contribution of (IL)-4 and IL-13 to the epithelial-mesenchymal tropic unit in asthma. Am. J. Respir. Cell Mol. Biol. 25:385391.[Abstract/Free Full Text]
- Adams, S. L. 1989. Collagen gene expression. Am. J. Respir. Cell Mol. Biol. 1:161168.
- Eum, S-Y, S. Hailé, J. Lefort, M. Huerre, B. B. Vargaftig. 1995. Eosinophil recruitment into the respiratory epithelium after antigenic challenge in hyper-IgE mice is accompagnied by interleukin 5-dependent bronchial hyperresponsiveness. Proc. Natl. Acad. Sci. USA. 92:12,29012,294.[Abstract/Free Full Text]
- Barnes, P. J. 1996. Molecular mechanisms of steroid action in asthma. J. Allergy Clin. Immunol. 97:159168.[CrossRef][Medline]
- Funk, C. D. 1999. in Molecular and cellular basis of inflammation. Eds. Serhan, C.N. and Ward, P.A. (Humana, Totowa, NJ), 109125.
- Konstant, M. W., R. W. Walenga, K. A. Hillard, and J. B. Hillard. 1993. Leukotriene B4 markedly elevated in the epithelial lining fluid of patients with Cystic Fibrosis. Am. Rev. Respir. Dis. 148:896901.[Medline]
- Vargaftig, B. B., and M. Singer. 2003. Leukotrienes, IL-13 and chemokines cooperate for BHR and mucipare metaplasia in allergic mouse lungs. Am. J. Physiol. (Lung Cell. Mol. Physiol.) 284:L260L269.[Abstract/Free Full Text]
- Klein, A., A. Talvani, P. M. R. Silva, M. A. Martins, T. N. C. Wells, A. Proudfoot, N. W. Luckacs, and M. M. Teixeira. 2001. Stem cell factor-induced Leukotriene B4 production cooperates with eotaxin to mediate the recruitment of eosinophils during allergic pleuresy in mice. J. Immunol. 167:524531.[Abstract/Free Full Text]
- Basbaum, C., H. Lemjabbar, M. Longphre, D. Li, E. Gensch, and N. McNamara. 1999. Control of mucin transcription by diverse injury-induced signalling pathways. Am. J. Respir. Crit. Care Med. 160:S44S48.[Abstract/Free Full Text]
- Shim, J. J., K. Dabbagh, I. F. Ueki, T. Dao-Pick, P. R. Burgel, K. Takeyama, D. Cheng-Wei Tam, and J. A. Nadel. 2001. IL-13 induces mucin production by stimulating epidermal growth factor receptors and by activating neutrophils. Am. J. Physiol. (Lung Cell. Mol. Physiol.) 280:L134L140.
- Zhu, Z., R. J. Homer, Z. Wang, Q. Chen, G. P. Geba, J. Wang, Y. Zhang, and J. A. Elias. 1999. Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities and eotaxin production. J. Clin. Invest. 103:779788.[Medline]
- Lee, C. G., R. J. Homer, Z. Zhu, S. Lanone, X. Wang, V. Koteliansky, J. M. Shipley, P. Gotwals, P. Noble, Q. Chen, R. M. Senior, and J. A. Elias. 2001. Interleukin-13 induces tissus fibrosis by selectively stimulating and activating transforming growth factor-ß1. J. Exp. Med. 194:809821.[Abstract/Free Full Text]
- Chu, S. J., L. O. Tang, E. Watney, E. Chi, and W. Henderson. 2000. In situ amplification of 5-lipoxygenase-activating protein in allergic airway inflammation and inhibition by leukotriene blockade. J. Immunol. 1635:46404648.
- Spanbrook, R. S., M. Hildner, A. Köhler, A. Müller, F. Zinti, H. Kühn, O. Rädmark, B. Samuelsson, and A. J. R. Habenicht. 2001. IL-4 determines eicosanoid formation in dendritic cells by down-regulation of 5-lipoxygenase and up-regulation of 15-lipoxygenase 1 expression. Proc. Natl. Acad. Sci. USA 98:51525157.[Abstract/Free Full Text]
- Hancock, A., L. Armstrong, R. Gama, and A. Millar. 1998. Production of IL-13 by alveolar macrophages from normal and fibrotic lung. Am. J. Respir. Cell Mol. Biol. 18:6065.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
E. Daley, C. Emson, C. Guignabert, R. de Waal Malefyt, J. Louten, V. P. Kurup, C. Hogaboam, L. Taraseviciene-Stewart, N. F. Voelkel, M. Rabinovitch, et al.
Pulmonary arterial remodeling induced by a Th2 immune response
J. Exp. Med.,
February 18, 2008;
205(2):
361 - 372.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-Y. Nam, Y.-H. Kim, J.-S. Do, Y.-H. Choi, H.-J. Seo, H.-K. Yi, P.-H. Hwang, C.-H. Song, H.-K. Lee, J.-S. Kim, et al.
CD30 supports lung inflammation
Int. Immunol.,
February 1, 2008;
20(2):
177 - 184.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. H. Walters, D. W. Reid, D. P. Johns, and C. Ward
Nonpharmacological and pharmacological interventions to prevent or reduce airway remodelling
Eur. Respir. J.,
September 1, 2007;
30(3):
574 - 588.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Bao, S. Lim, W. Liao, Y. Lin, C. Thiemermann, B. P. Leung, and W. S. F. Wong
Glycogen Synthase Kinase-3beta Inhibition Attenuates Asthma in Mice
Am. J. Respir. Crit. Care Med.,
September 1, 2007;
176(5):
431 - 438.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Parameswaran, K. Radford, A. Fanat, J. Stephen, C. Bonnans, B. D. Levy, L. J. Janssen, and P. G. Cox
Modulation of Human Airway Smooth Muscle Migration by Lipid Mediators and Th-2 Cytokines
Am. J. Respir. Cell Mol. Biol.,
August 1, 2007;
37(2):
240 - 247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. C. Thomas, A. S. Sabnis, M. E. Johansen, D. L. Lanza, P. J. Moos, G. S. Yost, and C. A. Reilly
Transient Receptor Potential Vanilloid 1 Agonists Cause Endoplasmic Reticulum Stress and Cell Death in Human Lung Cells
J. Pharmacol. Exp. Ther.,
June 1, 2007;
321(3):
830 - 838.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. R. Henderson Jr., E. Y. Chi, J. G. Bollinger, Y.-t. Tien, X. Ye, L. Castelli, Y. P. Rubtsov, A. G. Singer, G. K.S. Chiang, T. Nevalainen, et al.
Importance of group X-secreted phospholipase A2 in allergen-induced airway inflammation and remodeling in a mouse asthma model
J. Exp. Med.,
April 16, 2007;
204(4):
865 - 877.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. M. Shim, Z. Zhu, T. Zheng, C. G. Lee, R. J. Homer, B. Ma, and J. A. Elias
Role of 5-Lipoxygenase in IL-13-Induced Pulmonary Inflammation and Remodeling
J. Immunol.,
August 1, 2006;
177(3):
1918 - 1924.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. N. Lama, H. Harada, L. N. Badri, A. Flint, C. M. Hogaboam, A. McKenzie, F. J. Martinez, G. B. Toews, B. B. Moore, and D. J. Pinsky
Obligatory Role for Interleukin-13 in Obstructive Lesion Development in Airway Allografts
Am. J. Pathol.,
July 1, 2006;
169(1):
47 - 60.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Nakano, H. Inoue, S. Fukuyama, K. Matsumoto, M. Matsumura, M. Tsuda, T. Matsumoto, H. Aizawa, and Y. Nakanishi
Niflumic Acid Suppresses Interleukin-13-induced Asthma Phenotypes
Am. J. Respir. Crit. Care Med.,
June 1, 2006;
173(11):
1216 - 1221.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Yamashita, H. Tashimo, H. Ishida, Y. Matsuo, H. Tamauchi, M. Terashima, I. Yoshiwara, S. Habu, and K. Ohta
Involvement of GATA-3-dependent Th2 lymphocyte activation in airway hyperresponsiveness
Am J Physiol Lung Cell Mol Physiol,
June 1, 2006;
290(6):
L1045 - L1051.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. S. Lee, H. K. Lee, J. S. Hayflick, Y. C. Lee, and K. D. Puri
Inhibition of phosphoinositide 3-kinase {delta} attenuates allergic airway inflammation and hyperresponsiveness in murine asthma model
FASEB J,
March 1, 2006;
20(3):
455 - 465.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Pope, N. Zimmermann, K. F. Stringer, M. L. Karow, and M. E. Rothenberg
The Eotaxin Chemokines and CCR3 Are Fundamental Regulators of Allergen-Induced Pulmonary Eosinophilia
J. Immunol.,
October 15, 2005;
175(8):
5341 - 5350.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Miyahara, K. Takeda, S. Miyahara, S. Matsubara, T. Koya, A. Joetham, E. Krishnan, A. Dakhama, B. Haribabu, and E. W. Gelfand
Requirement for Leukotriene B4 Rec | |