Published ahead of print on January 10, 2003, doi:10.1165/rcmb.2002-0119OC
American Journal of Respiratory Cell and Molecular Biology. Vol. 28, pp. 746-753, 2003
© 2003 American Thoracic Society DOI: 10.1165/rcmb.2002-0119OC
Neutrophil DNA Contributes to the Antielastase Barrier during Acute Lung Inflammation
Viviane Balloy,
Jean-Michel Sallenave,
Bruno Crestani,
Monique Dehoux and
Michel Chignard
Unité de Défense Innée et Inflammation, INSERM E336, Institut Pasteur, Paris, France; Rayne Laboratory, Centre of Inflammation Research, Edinburgh University Medical School, Edinburgh, Scotland, United Kingdom; and Unité Inserm U408, Faculté de Médecine Xavier Bichat, Paris, France
Address correspondence to: Dr. Michel Chignard, Défense Innée et Inflammation, INSERM E336, Institut Pasteur, 25 rue du Dr. Roux, 75015 Paris, France. E-mail: chignard{at}pasteur.fr
 |
Abstract
|
|---|
During acute lung inflammation, the airspaces are invaded by circulating neutrophils. These may then injure tissues through the release of elastase. Different natural specific inhibitors such as 1-proteinase inhibitor, secretory leukocyte proteinase inhibitor, and elafin are nonetheless able to counteract the enzymatic activity of elastase. The present study was undertaken to assess the role of these different inhibitors in the intrinsic antielastase barrier during lipopolysaccharide-induced lung inflammation in mice. Upon intranasal administration of lipopolysaccharide to mice, the antielastase activity recovered from bronchoalveolar lavage fluids (BALF) increases progressively up to 48 h (7-fold) and returns to the basal level within 72 h. By contrast, when the same experiments are performed with neutropenic mice (pretreatment with an antigranulocyte antibody, or vinblastine), the increase is almost totally absent. Ultrafiltration of BALF through 100 kD cutoff membranes shows that the activity remains in the retentate, thus ruling out a role for native 1-proteinase inhibitor, secretory leukocyte proteinase inhibitor, and elafin. Gel filtration and fraction analysis show that the material eluted with a Mr of 600 kD. Agarose gel electrophoresis and ethidium bromide staining reveal that the activity corresponds to the presence a large amount of DNA. Interestingly, DNase treatment of the active fraction suppresses the antielastase activity. Analysis of BALF from patients with acute lung inflammation shows the presence of DNA with antielastase activity. We therefore concluded that during acute lung inflammation, the recruitment of neutrophils in the airspaces accounts for the increased presence of DNA, which in turn contributes to the antielastase barrier.
Abbreviations: 1-protease inhibitor, 1-PI acute respiratory distress syndrome, ARDS bronchoalveolar lavage fluid(s), BALF bovine serum albumin, BSA enhanced chemiluminescence, ECL lipopolysaccharide, LPS monoclonal antibody, mAb phosphate-buffered saline, PBS secretory leukocyte proteinase inhibitor, SLPI
 |
Introduction
|
|---|
More than a century ago, Metchnikoff recognized that neutrophils can create autologous injury to lung tissue. Since then, a large number of studies have confirmed that neutrophils play a major role in the onset and progression of acute lung injury in both the clinical setting and experimental animal models (14). In human lung inflammation such as in the acute respiratory distress syndrome (ARDS), the burden of neutrophils constitutes the main threat (5, 6). Neutrophils are mostly harmful through the release of their serine proteinases, particularly elastase (2, 7, 8). Human leukocyte elastase exerts a strong tissue-damaging activity by hydrolyzing most extracellular matrix components such as elastin, fibronectin, proteoglycan, and collagen, and also by affecting the integrity of the endoepithelial barrier (911). Indeed, increased elastase activity has been found in the bronchoalveolar lavage fluids (BALF) in patients with ARDS (12). This prompted studies that showed that the use of structurally different elastase inhibitors was beneficial in models of acute lung inflammation (13).
Indeed, the body produces different natural specific inhibitors to counteract the biological destructive activity of elastase (14, 15). In lungs, one can consider two groups (16): the early or alarm inhibitors such as the secretory leukocyte proteinase inhibitor (SLPI) and elafin, and the secondary or acute-phase inhibitors such as 1-proteinase inhibitor ( 1-PI). Interestingly, the levels of 1-PI, SLPI, and elafin are augmented in ARDS (17). The present study was undertaken to assess the role of these different inhibitors in the intrinsic antielastase barrier during LPS-induced lung inflammation in mice.
 |
Materials and Methods
|
|---|
Materials
Seven-week-old male C57Bl/6 mice were provided by the Centre d'Elevage R. Janvier (Le Genest Saint-Isle, France). Lipopolysaccharide (LPS) (Escherichia coli 055/B5) was from Difco Laboratories (Detroit, MI). Sodium dodecyl sulfate, IgG, catalase, thyroglobulin, bovine serum albumin (BSA), and N-methoxysuccinyl-Ala-Ala-Pro-Val pNitroanilide were from Sigma Chemical (St. Louis, MO), and Bradford reagent was from Bio-Rad S.A. (Ivry sur Seine, France). Amicon cell, Centricon filter, membrane filtration, and kit calibration of low molecular weight were obtained from Millipore Corporation (Bedford, MA). Pentobarbital came from Sanofi (Libourne, France). Sephacryl-300 HR, Vistra green reagent and enhanced chemiluminescence (ECL) were supplied by Amersham Pharmacia Biotech (Buckinghamshire, UK). DNA ladder and agarose were from Gibco-Life Technologies (Cergy Pontoise, France). Trizol reagent was from Invitrogen Life Technologies (Cergy Pontoise, France) and all reagents for reverse transcription were supplied by Promega (Lyon, France).
DNase was from Roche Diagnostics (Meylan, France) and ferritin from Serva (Heidelberg, Germany). Rabbit polyclonal antibody to human leukocyte elastase was from Biogenesis (Poole, UK), and rabbit polyclonal antibody to rat 1-PI was a gift from Dr. A. Bouten (Hôpital Xavier Bichat, Paris, France).
Human leukocyte elastase was purified from human neutrophils as previously described (18). A crude sample of mouse elastase was prepared as described below.
Preparation of the Antigranulocyte Monoclonal Antibody
RB68C5 (anti-Ly-6G) is a rat IgG2b monoclonal antibody (mAb) (19) that binds selectively to and depletes mouse neutrophils and eosinophils, but not lymphocytes or macrophages (20). This antigranulocyte mAb was purified from ascitic fluids (the cloned hybridomas was kindly provided by Dr. G. Milon, Institut Pasteur) through precipitation with 45% saturated ammonium sulfate (vol/vol). Following dialysis at 4°C against phosphate-buffered saline (PBS), IgG were filtered (0.22 µm) and then stored at 4°C at a final concentration of 5 mg/ml. One intraperitoneal administration of 200 µg of IgGs led within 24 h to a complete absence of circulating neutrophils in mice, which lasted for 5 d (data not shown). In some experiments, performed 72 h before LPS treatment, mice were depleted of neutrophils by an intravenous administration of the antineoplastic agent vinblastine (5 mg/kg). At the time of LPS administration, neutrophils were absent from the circulating blood.
LPS Administration and Collection of BALF
LPS dissolved in saline was administered intranasally (330 µg/kg of body weight). Mice were slightly anesthetized with diethyl ether and received 50 µl of the LPS solution directly into their nostrils. At different time intervals, mice were killed by an intrapeitoneal administration of a lethal dose of pentobarbital sodium (12 mg/mouse). Tracheas were cannulated, and lungs were washed eight times with 0.5 ml of PBS to provide 4 ml of BALF. Cell-free BALF obtained after centrifugation (300 x g for 15 min) were stored frozen at -20°C. In some experiments, DNase was given intranasally to mice (500 or 2,000 U per animal), 3 h before BALF collections.
Preparation of Crude Mouse Leukocyte Elastase
To prepare mouse leukocyte elastase, mice were challenged with LPS (330 µg/kg) and BALF were performed 24 h later. The whole cell population of the BALF, which routinely contains 90% of neutrophils, was washed once with PBS, resuspended in PBS (5 x 106 cells/ml), preincubated for 5 min with 5 µg/ml cytochalasin B, and then activated with 1µM fMLP. Cell degranulation was allowed to proceed for 10 min, and supernatants were recovered after centrifugation at 300 x g for 15 min. The elastase activity present in the medium was determined using the specific synthetic substrate N-methoxysuccinyl-Ala-Ala-Pro-Val pNitroanilide (1 mM, final concentration). Hydrolysis of this substrate was monitored following the optical density at 410 nm.
Measurement of Antielastase Activity in BALF
The antielastase activity contained in total BALF or BALF chromatography fractions was evaluated spectrophotometrically by following the elastase-mediated hydrolysis of N-methoxysuccinyl-Ala-Ala-Pro-Val pNitroanilide at 410 nm. Total BALF or BALF chromatography fractions were incubated with elastase (8 nM) for 5 min at 37°C in 0.5 ml of PBS with BSA 0.02% (pH 7.4) before addition of the substrate (1 mM). For each sample, an activityvolume curve was established and the volume (V) corresponding to 50% inhibition of elastase activity was calculated from the curve. The volume needed to inhibit 1 µM elastase was extrapolated and considered to contain 1 U of antielastase activity. In some experiments, samples were preincubated with DNase (200 U/ml) for 15 min at 37°C before testing their elastase inhibitory activity.
Analysis of SLPI-Specific mRNA
Lungs from control and RB68C5-treated mice were collected 48 h after LPS-induced acute lung inflammation and frozen in liquid nitrogen, and RNA was isolated using the Trizol reagent according to the manufacturer's instructions. One microliter (300 ng) of RNA was used, and reverse transcription (enough for 20 reactions) was performed in a final volume of 404 µl (master mix for 20 reactions), containing 3 mM MgCl2, 20 µl of a oligo dT 15 mer (0.5 µg/µl), 8 µl of RNAsin (320 U), 20 µl of mouse moloney reverse transcriptase (200 units/µl), 10 mM dNTP, and PCR buffer (1x). After 45 min at 37°C, the reaction was stopped by heat inactivation at 95°C for 5 min. An aliquot of 20 µl of the above mixture was used for the PCR reaction in a final volume of 100 µl, containing 1.6 mM MgCl2, 10 ng/µl of each SLPI primers (which span 3 introns; forward primer 5' GCTCTAGAGCTTCACCATGAAGTCC TGCGG 3'; reverse primer: 5' GGAATTCCTTTGCATAGAGAAATGAATGCG 3'), 0.5 ng/ml of each GAPDH primers (forward primer: 5' TGCATCCTGCACCACCAACT 3'; reverse primer: 5' AACACGGAAGGCCATGCCAG 3'), and Taq polymerase (5 U/µl). The reaction was allowed to proceed for 30 s at 94°C, 30 s at 60°C, and 60 s at 72°C (30 cycles) in an M. J. Research DNA Engine PTC-200 PCR machine (M.J. Research, Waltham, MA), and gave rise to a 673-bp PCR reaction product that was resolved on a 1% agarose gel, which was stained post-electrophoresis with 1x Vistra green reagent for 20 min at room temperature. Bands were visualized by direct fluorescence on a "Storm phosphoimager" (Molecular Dynamics, Amersham Pharmacia Biotech, Little Chalfont, UK). Densitometry was performed using the ImageQuant software and signal intensities were determined for SLPI and GAPDH bands.
SDS-PAGE and Immunoblot Analysis of 1-PI
Cell-free BALF were incubated with Laemmli's PAGE sample buffer (containing 2% SDS and no reducing agent) for 15 min at 100°C. Aliquots (30 µl) were applied to 10% polyacrylamide slab gel, and electrophoresis was performed. Proteins were then electrotransferred to a nitrocellulose membrane, and the 1-PI band was immunoprobed with a 1:500 dilution of a rabbit specific antibody followed by a 1:10,000 dilution of a donkey anti-rabbit IgG antibody conjugated to horseradish peroxidase. Immunoblots were developed by ECL kit (Amersham Life Science, Amersham, UK).
Ultrafiltration
Each individual BALF was ultrafiltrated using Centricon filter devices equiped with a YM-100 (molecular size cutoff: 100 kD) membrane and centrifuged at 1,000 x g. Antielastase activity was then measured in both the retentate and the filtrate.
Gel filtration
BALF from 20 mice were pooled and concentrated 40-fold in an Amicon filtration cell with a YM-10 membrane (molecular size cutoff: 10 kD). The concentrate was applied to a Sephacryl S-300 High Resolution column (1.7 x 100 cm) equilibrated with PBS pH 7.4 and calibrated with standard markers (thyroglobulin 669 kD, ferritin 440 kD, catalase 232 kD, IgG 150 kD, BSA 67 kD, ovalbumin 43 kD, chymotrypsinogen A 25 kD). The column was run with PBS at a flow rate of 12 ml/h, and 4-ml fractions were collected. Elution of proteins was monitored at 280 nm. Fractions were tested for their antielastase activity. Two peaks were identified from BALF of LPS-challenged control mice. Fractions containing antielastase activities with high (E1) and low (E2) molecular weight were pooled separately, and their total protein concentration was measured by the Bradford method using ovalbumin (ICN Biochemical, Aurora, OH) as standard.
Agarose Gel Electrophoresis and Immunoblot Analysis of Human Leukocyte Elastase
For the assessment of E1 DNA content, E1 fractions were incubated with or without 200 U/ml DNase for 15 min at 37°C. For the assessment of DNAelastase complexes, E1 fractions were incubated with 1 µM human leukocyte elastase for 5 min at 37°C. Aliquots (40 µl) were then subjected to electrophoresis on a 1% agarose slab gel containing 0.5 µg/ml ethidium bromide. Gel photographs were taken after amplification with ultra-Lum system (Ultra-Lum, Carson, CA) under UV light. A 1-kbp DNA ladder was used as standard.
After transfer to a nitrocellulose membrane (Schleicher and Schuell, Dassel, Germany) and baking at 80°C for 1 h for optimal DNA binding, the membrane was immunoprobed with a 1:1,00 dilution of an anti-human neutrophil elastase rabbit specific antibody followed by a 1:10,000 dilution of a donkey anti-rabbit IgG antibody conjugated to horseradish peroxidase. Immunoblots were developed by ECL kit (Amersham Life Sciences).
Human Studies
BALF were collected from nine mechanically ventilated patients with acute lung injury and processed as previously described (21). BALF analysis revealed a prominent neutrophilia. None of the BALF were infected as assessed by bacterial culture. The local ethical committee of Paris-Bichat University Hospital approved the study protocol.
Statistical Analysis
All results are expressed as means ± SEM. Differences between the data were analyzed by Student's unpaired t test. A P value < 0.05 was considered significant.
 |
Results
|
|---|
Antielastase Activity Increases in BALF after LPS-Induced Acute Lung Inflammation
We have previously shown that the intranasal administration of LPS (330 µg/kg) induces neutrophil recruitment and increases vascular permeability in mice (22, 23). During the course of the latter experiments, we observed a progressive increase of the BALF antielastase activity, which peaked at 48 h (tested against a crude preparation of murine elastase) (Figure 1A). At that time point, the magnitude of the increase was 7-fold that of the basal level. An inhibitory activity of BALF was also observed against human neutrophil elastase and cathepsin G (data not shown), showing that inhibitors present in BALF are active against several serine proteinases. However, throughout the following experiments, the BALF antiproteinase activity was tested against purified human elastase.


View larger version (74K):
[in this window]
[in a new window]
|
Figure 1. Antielastase activity in the BALF of mice following LPS-induced acute lung inflammation. (A) Time course of the antielastase activity in BALF following LPS administration to mice. BALF were collected at different time intervals after intranasal administration of LPS. Antielastase activities present in the cell-free fluids were quantified against a crude preparation of mouse leukocyte elastase. Results are means ± SEM of 49 different BALF. (B) Relationship between the antielastase activity and the number of neutrophils in BALF following intranasal administration of LPS. The antielastase activity was plotted versus the number of PMN recovered for each individual BALF over the time course experiment (see A).
|
|
Relationship between the Antielastase Activity and the Presence of Neutrophils
Interestingly, the variation of the antielastase activity follows exactly the kinetic of neutrophil migration into the airspaces as observed in previous experiments (22). As shown in Figure 1B, a significant correlation was observed between neutrophil numbers and the antielastase activity in BALF. To assess the relationship between neutrophils and antielastase activity, mice were depleted of neutrophils by a pretreatment with an antigranulocyte antibody (RB68C5), before the intranasal administration of LPS. Under these experimental conditions, the increase of antielastase activity was almost totally abolished. It is of note that the used antibody is largely specific for granulocytic cells, although low levels of Ly-6G, the targeted epitope, are expressed on dendritic cells (24), antigen-presenting cells (25), and macrophages (26). To confirm our finding, mice were pretreated with another neutrophil-depleting agent, vinblastine, 96 h before LPS administration. As for mice treated with RB68C5, there was only a small increase in the antielastase activity 48 h after LPS administration (Figure 2). It is noteworthy that the antielastase activity recovered from the cellfree BALF was identical whether obtained from BALF upon centrifugation or 0.45 µm filtration, i.e., 4.99 ± 0.22 and 4.72 ± 0.44 arbitrary units (means ± sem; n = 4) respectively. This ruled out a possible artifact of sample handling as centrifugation of the BALF could have artificially induced DNA release from neutrophils.

View larger version (44K):
[in this window]
[in a new window]
|
Figure 2. Effect of a depletion of circulating neutrophils on the antielastase activity in the BALF of mice 48 h after LPS treatment. BALF were collected from naive mice (Control) or from 48-h LPS-challenged control mice (Control + LPS). BALF were also collected 48 h after LPS challenge to mice rendered neutropenic by a pretreatment with either an antigranulocyte antibody (RB6 + LPS) or vinblastine (vinblastine + LPS). Antielastase activities present in cell-free fluids were quantified against purified human leukocyte elastase. Results are means ± SEM of 57 different BALF.
|
|
Role of 1-PI and SLPI
We have previously shown that the increase of vascular permeability is of the same magnitude at 48 h for both normal or neutropenic mice (23). We therefore hypothesized that the increase in antielastase activity associated with neutrophilia was due not to a molecule originating from passive transfer from the blood compartment, but instead from the inflamed lungseither from inflammatory cells or from lung structural cells. Two antiproteinase candidates were thus considered, SLPI and elafin, because their human homologs are both produced by macrophages (27), neutrophils (28), and also by epithelial cells upon activation by two early inflammatory cytokines, tumor necrosis factor- and interleukin-1ß (29). The archetypal elastase inhibitor, 1-PI, was also a possible candidate because it is synthesized by LPS-activated alveolar macrophages (30) and lung epithelial cells (29, 3133), and more importantly in the present context, by neutrophils (34).
Because murine elafin has not yet been identified, we analyzed the potential role of both SLPI and 1-PI. Interestingly, although mice SLPI mRNA was easily detected in lung extracts, it is obvious from Figure 3 that its expression was not significantly changed in both normal and neutropenic mice. We then analyzed the potential contribution of 1-PI to BALF antielastase activity. Nadziejko and coworkers (35) and our own studies (not shown) have found that antielastase activities of human SLPI and human elafin, but not of human 1-PI, were resistant to hexadecyltrimethyl ammonium bromide treatments. Incubation of BALF with the above cationic detergent abolished its antielastase activity, suggesting a participation of 1-PI in this process. The presence of the latter in BALF collected from control mice 48 h after LPS was thus checked by Western blot analysis and was found to be increased compared with basal levels (Figure 4). This result indicated that 1-PI participated in the increase of the antielastase activity of BALF. Nonetheless, specific 1-PI mRNA were not detected in extracts of whole lungs collected from mice under any experimental conditions (data not shown), suggesting that the protein originated most probably from plasma exudation due to the increase of vascular permeability, which occurs indifferently in control and neutropenic animals (23), and not from a synthesis by recruited neutrophils. Confirming this, Western blot analysis also revealed that the increased amounts of recovered 1-PI were identical whether mice were neutropenic or not (Figure 4). As a whole, these data suggest that 1-PI probably plays a role (see Figure 2 in the difference observed between the antielastase activities recovered from LPS-challenged neutropenic mice and control mice), but does not account for the large increase of the neutrophil-dependent antielastase activity following LPS-induced acute lung inflammation.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 3. Effect of neutrophil depletion on the expression of SLPI mRNA in whole lungs 48 h after LPS-induced acute lung inflammation. Lungs and RNA from LPS-treated wild-type mice (n = 4) and mice treated with LPS and the RB6 antibody (n = 4) were obtained as described in MATERIALS AND METHODS. RT-PCR was performed using forward and reverse primers for mSLPI and GAPDH, and the PCR mixture was loaded on a 1% agarose gel. The gel was stained post-electrophoresis with Vistra green reagent, and fluorescence was analyzed on a "Storm phosphoimager." Lanes 14: RT-PCR from lungs of four different mice treated with LPS + RB6. Lanes 58: RT-PCR from lungs of four different mice treated with LPS. Lane M: molecular weight markers (Promega).
|
|
Purification of the Antielastase Activity Recovered from the BALF of Mice Challenged with LPS
Because neither SLPI nor 1-PI as native molecules seemed to play a role in the increase of antielastase activity observed in our model, ultrafiltration of the BALF (cutoff of 30 kD) was performed to estimate the molecular weight of the molecule(s) responsible for the differential activity in LPS-treated normal and neutropenic mice.
The retentate of BALF collected 48 h after LPS administration in control mice contained most of the antielastase activity (data not shown). This result confirmed the lack of involvement of native SLPI in this activity. Other membranes with different cutoffs were then tested: surprisingly, similar results were obtained with membranes with cutoff up to a 100 kD, supporting also the absence of 1-PI (52 kD). Thus, an inhibitory activity of 104.8 units ± 15.8 was recovered in the retentates (> 100 000) obtained from BALF of control mice (mean ± SEM, n = 4). By contrast, when BALF of neutropenic mice were processed and ultrafiltrated, the value fell to 20.2 ± 3.1 (mean ± SEM, n = 4).
Experiments were performed to characterize the unknown molecule(s) with an apparent molecular weight higher than 100 kD. BALF from 20 LPS-challenged control mice were pooled, concentrated, subjected to gel filtration, and fractions were analyzed for their absorbance and antielastase activity. As shown in Figure 5, a first peak (fractions 4550) corresponding to a Mr of 600 kD was detected, followed by a second peak of high activity (fractions 7988) corresponding to a Mr of 50 kD. When BALF from neutropenic mice were processed in a similar fashion, only the 50-kD peak was present (data not shown). Fractions 4355 (E1) and fractions 7894 (E2) from LPS-challenged control mice were pooled and concentrated separately. The determination of the protein content (Bradford method) indicated that E1 contained little proteinaceous material compared with E2, i.e., 540 µg and 11,120 µg, respectively, although the absorbance for each peak was similar (Figure 5).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 5. Analysis by gel filtration of the molecular weight of the antielastase activity in the BALF of mice 48 h after LPS-induced acute lung inflammation. BALF were collected from 48-h LPS-challenged control mice. The different BALF from 20 mice were pooled, concentrated, and subjected to gel filtration. Elution profile was monitored at 280 nm, and the antielastase activity present in each 4-ml fraction was quantified against purified human leukocyte elastase.
|
|
Antielastase Activity and DNA
The discrepancy between absorption at 280 nm and the protein content of E1 concentrate led us to run an absorption spectrum of the material. We observed that the absorption was higher at 260 nm than at 280 nm, suggesting the presence of nucleic acid material. An agarose slab gel electrophoresis and ethidium bromide staining revealed the presence of large amount of DNA in the E1 concentrate of BALF from 48-h LPS-challenged control mice compared with the E1 concentrate of BALF from 48-h LPS-challenged neutropenic mice (Figure 6A). In addition, preincubation of E1 with DNase (200 U/ml for 15 min at 37°C) led to the complete disappearance of the material. Because formation of complexes between DNA and human leukocyte elastase has been reported (36), we investigated the interaction between these two molecules. As shown in Figure 6B, immunoblot analysis revealed that the migration profile of purified human elastase depended on whether it was incubated or not with the E1 concentrate from LPS-challenged control mice. The confirmation of the presence of a complex was shown by the addition of DNase, which restored the migration profile of elastase.

View larger version (86K):
[in this window]
[in a new window]
|
Figure 6. Analysis and characterization of BALF E1 DNA content by agarose gel electrophoresis. (A) Fractions of E1 purified from 20 BALF, collected from either 48-h LPS-challenged control mice (Control + LPS) or 48-h LPS-challenged RB6-treated mice (RB6 + LPS), were incubated or not with DNase and/or human purified leukocyte elastase (see MATERIALS AND METHODS). Incubates were then subjected to agarose gel electrophoresis and ethidium stained. On the left hand side: molecular weight markers. (B) Agarose gel was electrotransfered to a nitrocellulose membrane and probed with an anti-human elastase antibody. Legends are as above.
|
|
As DNA not only binds elastase but also impairs its enzymatic activity (36), we hypothesized that most of the antielastase activity observed in E1 was due to DNA. As shown in Figure 7, the antielastase activity in E1 was 20% of that of the control when DNA was destroyed upon DNase treatment. As a control, we verified that RNase treatment of the same sample was devoid of significant effect. We also purified genomic DNA from mouse tail and showed that it inhibited elastase (data not shown).

View larger version (56K):
[in this window]
[in a new window]
|
Figure 7. Effects of DNase and RNase on BALF E1. Fractions of E1 purified from 20 BALF, collected from 48-h LPS-challenged control mice, were incubated with DNase or RNase at 37°C for 15 min. Antielastase activities were quantified against purified human leukocyte elastase. Results are means ± SEM of 34 different experiments.
|
|
Effect of DNase in LPS-Induced Lung Inflammation In Vivo
To confirm that DNA accounted for most of the antielastase activity present in the BALF during acute lung inflammation, BALF from 48-h LPS-challenged control mice were preincubated with DNase before testing their antielastase activity. Profiles of inhibition were similar to those observed with the E1 concentrate depicted in Figure 7, i.e., around 75% inhibition with DNase and no significant difference with RNase (data not shown). It is of note that DNase may impair the inhibitory capacity of 1-PI toward purified elastase activity, although this effect was reported to be limited to low concentrations of 1-PI (37). To check this possibility, we assessed the antielastase activity in BALF of LPS-challenged neutropenic mice lacking DNA (but containing the same amount of 1-Pi; see Figure 4). We found that whether BALF was treated or not with DNase, the antielastase activity was similar (1.01 ± 0.39 and 0.89 ± 0.42 [means ± SEM; n = 4], respectively), therefore ruling out an effect of DNase on 1-PI under our in vivo experimental conditions.
Furthermore, intranasal administration of DNase also reduced the the antiproteinase activity recovered from inflamed lungs. Indeed, two different doses of DNase were administered to LPS-challenged mice, 45 h post-LPS (i.e., 3 h before performing the lavage). As shown in Figure 8, DNase at 500 U/mouse and 2,000 U/mouse displayed a similar inhibition of around 60% (n = 3). This lack of difference between 500 and 2,000 U DNase/mouse, indicates that, at these doses, DNA was totally hydrolyzed and consequently that the remaining 40% antielastase activity was most probably due the other elastase inhibitors such as SLPI and 1-PI.

View larger version (53K):
[in this window]
[in a new window]
|
Figure 8. Effect of intranasal administrations of DNase on BALF antielastase activity after LPS-induced acute lung inflammation. Three hours before BALF collection (at 45 h of the 48-h time course), LPS-treated mice were given an intranasal administration of DNase at two different concentrations, 500 or 2,000 U/animal. Antielastase activities present in cell-free BALF were quantified against purified human leukocyte elastase. Results are means ± SEM of four different BALF.
|
|
Human Studies
BALF from nine patients suffering from ALI were first concentrated 10 times by ultrafiltration through a membrane with a cutoff of 100 kD, and the antielastase activities of the concentrates were analyzed. Agarose gel electrophoresis and ethidium bromide staining indicated that six out of nine concentrates contained DNA material (data not shown). Interestingly, these six concentrates displayed an antielastase activity, which was reduced upon incubation with 200 U/ml DNase for 15 min at 37°C (Figure 9).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 9. Presence of a DNA-mediated antielastase activity in the BALF of patients suffering from acute lung inflammation. BALF concentrates from nine patients suffering from ALI were assessed for their antielastase activity upon pretreatment and not with DNase (200 U/ml for 15 min at 37°C). Activities were quantified against purified human leukocyte elastase as described in MATERIALS AND METHODS, and expressed in arbitrary units.
|
|
 |
Discussion
|
|---|
Elastase is stored as an active enzyme in the neutrophil azurophil granules with two other serine proteinases, namely cathepsin G and proteinase 3. All three enzymes may be released extracellularly during the process of phagocytosis, when neutrophils encounter microorganisms, and also when neutrophils accumulate at high density and lyse (2, 7, 8). The ability of these different serine proteinases to injure lung tissues, necessitates a tight control of their enzymatic activities. The present data show that during experimental acute lung inflammation in mice, the anti-proteinase barrier of the airways (i) varies with the presence of neutrophils, and (ii) is in part constituted of free DNA.
One of the surprising facts emerging from the present study is that DNA represents a quite large proportion of the antielastase barrier in mice with neutrophilic inflammation. Treatment of BALF of these mice with DNase allowed us to estimate its contribution at around 75% of the total. This was a surprising finding because the most important elastase inhibitors were thought to be SLPI, 1-PI, and elafin. Nonetheless, the question remains as to whether the present experimental approach is a true modeling of an inflammatory human lung disease. Our present study confirms that DNA material is indeed present in the airspaces of patients with ALI, and participates (although in a variable and lower proportion than in mice) in the antiproteinase barrier activity.
The presence of DNA in the airways has been recognized for a long time in different lung pathologies characterized by a neutrophil burden. Thus, DNA has been recovered in sputum samples from patients with chronic bronchitis, bronchiectasia, or asthma (38). This is believed to be due to the fact that when short-lived neutrophils die, they not only release their granule serine proteinases, but also their nuclear content. Data obtained with the present experimental model are in agreement with this hypothesis. Indeed, there is a close correlation between the density of neutrophils and the presence of the DNA antielastase barrier. However, this is in itself fascinating, because it is generally assumed that the present experimental approach generates acute lung inflammation rather than acute lung injury. It is indeed believed that in the present model neutrophils become apoptotic and are eliminated upon phagocytosis by alveolar macrophages, a "silent" nonphlogistic process with an absence of release of nucleic material (39, 40). It may therefore be hypothesized that a certain proportion of apoptotic neutrophils are not phagocytosed and become necrotic, thereby releasing their content.
The inhibitory effect of biological fluids DNA on proteolytic enzymes has been known for quite a long time (41). As far as neutrophil elastase is concerned, it has been demonstrated that as for heparin (42), the polyanionic DNA molecules bind elastase and inhibit its elastolytic activity (36). Although this binding strongly decreases with ionic strength as for heparin, the inhibition is nonetheless potent at the physiologic ionic concentration (36). It appears that under our experimental conditions elastase binds to DNA materials contained in BALF (see Figure 6). This is supported by experiments performed with hexadecyltrimethyl ammonium bromide, showing that its addition to BALF largely reduced the antielastase activity. As shown by Nadziejko and colleagues (35), this cationic detergent competes with elastase to form complexes with the polyanionic DNA, with as a consequence less free DNA and therefore more active elastase. An alternative mechanism in DNA-mediated inhibition of elastase might be an indirect one, by promoting the inhibition of elastase by SLPI (43, 44). Indeed, the treatment with DNase would inactivate the elastase/SLPI/DNA interactions in peak E1, thereby uncovering the elastase activity. This is, however, speculative, because another report mentions that DNA binds effectively to SLPI but impairs its functional activity (36).
The in vivo presence and the role of DNA as a direct inhibitor of elastase (and also cathepsin G) activity is evident under our experimental conditions. This is deduced from ex vivo treatment of BALF and in vivo treatment of mice with DNase. It is of note that a potential indirect effect of DNase through a downregulation of the 1-PI activity (37) was ruled out. As a consequence, the presence of DNA in the airspaces can be considered as beneficial for the lung, and raises the problem of DNase therapy. Such a therapy has been considered in patients with cystic fibrosis, with the aim of reducing sputum viscosity. As far as elastase is concerned, a review by Vogelmeier and Döring (45) quoted discrepant studies with on the one hand remarkable rise of elastase activity following the start of the therapy, and on the other hand an overall decline of the elastase burden. Our present experimental data indicate that DNase treatment definitely decreases the antielastase barrier in mice but that nonetheless around 40% remain.
 |
Acknowledgments
|
|---|
The authors thank Mr. Mark Marsden (Rayne Laboratory, Edinburgh University) for expert technical assistance, and Mr. Scott Johnston for reviewing this manuscript.
Received in original form July 16, 2002
Received in final form December 30, 2002
 |
References
|
|---|
- Weiss, S. J. 1989. Tissue destruction by neutrophils. N. Engl. J. Med. 320:365376.[Medline]
- Witko-Sarsat, V., and B. Descamps-Latscha. 1994. Neutrophil-derived oxidants and proteinases as immunomodulatory mediators in inflammation. Mediators Inflamm. 3:257273.[Medline]
- Jaeschke, H., and C. W. Smith. 1997. Mechanisms of neutrophil-induced parenchymal cell injury. J. Leukoc. Biol. 61:647653.[Abstract]
- Wagner, J. G., and R. A. Roth. 1999. Neutrophil migration during endotoxemia. J. Leukoc. Biol. 66:1024.[Abstract]
- Pittet, J. F., R. C. Mackersie, T. R. Martin, and M. A. Matthay. 1997. Biological markers of acute lung injury: prognostic and pathogenic significance. Am. J. Respir. Crit. Care Med. 155:11871205.[Medline]
- Ware, L. B., and M. A. Matthay. 2000. The acute respiratory distress syndrome. N. Engl. J. Med. 342:13341349.[Free Full Text]
- Smith, J. A. 1994. Neutrophils, host defense, and inflammation: a double-edged sword. J. Leukoc. Biol. 56:672686.[Abstract]
- Lee, W. L., and G. P. Downey. 2001. Leukocyte elastase: physiological functions and role in acute lung injury. Am. J. Respir. Crit. Care Med. 164:896904.[Free Full Text]
- Bieth, J. G. 1986. Elastases: catalytic and biological properties. In Regulation of Matrix Accumulation. R. Mecham, editor. Academic Press, New York. 217230.
- Smedly, L. A., M. G. Tonnesen, R. A. Sandhaus, C. Haslett, L. A. Guthrie, R. B. Johnston, Jr., P. M. Henson, and G. S. Worthen. 1986. Neutrophil-mediated injury to endothelial cells. Enhancement by endotoxin and essential role of neutrophil elastase. J. Clin. Invest. 77:12331243.
- Hiemstra, P. S., S. van Wetering, and J. Stolk. 1998. Neutrophil serine proteinases and defensins in chronic obstructive pulmonary disease: effects on pulmonary epithelium. Eur. Respir. J. 12:12001208.[Abstract]
- Suter, P. M., S. Suter, E. Girardin, P. Roux-Lombard, G. E. Grau, and J. M. Dayer. 1992. High bronchoalveolar levels of tumor necrosis factor and its inhibitors, interleukin-1, interferon and elastase in patients with adult respiratory distress syndrome after trauma, shock, or sepsis. Am. Rev. Respir. Dis. 145:10161022.[Medline]
- Vender, R. L. 1996. Therapeutic potential of neutrophil-elastase inhibition in pulmonary disease. J. Invest. Med. 44:531539.[Medline]
- Woessner, J. F. 1992. Role of cellular proteinases and their protein inhibitors in inflammation. In Biochemistry of Inflammation: Immunology and Medicine, vol. 18. J. T. Whicher, and S. W. Evans, editors. Kluwer Academic Publishers, Dordrecht, The Netherlands. 5789.
- Jochum, M., C. Gippner-Stepper, W. Machleidt, and H. Fritz. 1994. The role of phagocyte proteinases and proteinase inhibitors in multiple organ failure. Am. J. Respir. Crit. Care Med. 150:S123S130.
- Sallenave, J.-M. 2000. The role of secretory leukocyte proteinase inhibitor and elafin (elastase-specific inhibitory/skin-derived antileukoprotease) as alarm antiproteinases in inflammatory lung disease. Respir. Res. 1:8792.[CrossRef][Medline]
- Sallenave, J.-M., S. C. Donelly, I. S. Grant, C. Robertson, J. Gauldie, and C. Haslett. 1999. Secretory leukocyte proteinase inhibitor is preferentially increased in patients with acute respiratory distress syndrome. Eur. Respir. J. 13:10291036.[Abstract]
- Renesto, P., P. Ferrer-Lopez, and M. Chignard. 1990. Interference of recombinant eglin C, a proteinase inhibitor extracted from leeches, with neutrophil-mediated platelet activation. Lab. Invest. 62:409416.[Medline]
- Conlan, J. W., and R. J. North. 1994. Neutrophils are essential for early anti-Listeria defense in the liver but not in the spleen or peritoneal cavity as revealed by a granulocyte-depleting monoclonal antibody. J. Exp. Med. 179:259268.[Abstract/Free Full Text]
- Romani, L. A., A. Mencacci, R. Cenci, R. Spaccapelo, G. Del Sero, I. Nicoletti, G. Trinchieri, F. Bistoni, and P. Puccetti. 1997. Neutrophil production of IL-12 and IL-10 in candidiasis and efficacy of IL-12 therapy in neutropenic mice. J. Immunol. 158:53495356.[Abstract]
- Jaffré, S., M. Dehoux, C. Paugam, A. Grenier, S. Chollet-Martin, J.-B. Stern, J. Mantz, M. Aubier, and B. Crestani. 2002. Hepatocyte growth factor is produced by blood and alveolar neutrophils in acute respiratory failure. Am. J. Physiol. Lung Cell. Mol. Physiol. 282:L310L315.[Abstract/Free Full Text]
- Salez, L., M. Singer, V. Balloy, and M. Chignard. 2002. Lack of IL-10 synthesis by murine alveolar macrophages upon lipopolysaccharide exposure: comparison with peritoneal macrophages. J. Leukoc. Biol. 67:545552.
- Chignard, M., and V. Balloy. 2000. Neutrophil recruitment and increased permeability during acute lung injury induced by bacterial lipopolysaccharides. Am. J. Physiol. Lung Cell. Mol. Physiol. 279:L1083L1090.[Abstract/Free Full Text]
- Muthukkumar, S., J. Goldstein, and K. E. Stein. 2000. The ability of B cells and dendritic cells to present antigen increases during ontogeny. J. Immunol. 165:48034813.[Abstract/Free Full Text]
- Asselin-Paturel, C., A. Boonstra, M. Dalod, I. Durand, N. Yessaad, C. Dezutter-Dambuyant, A. Vicari, A. O'Garra, C. Biron, F. Briere, and G. Trinchieri. 2001. Mouse type I IFN-producing cells are immature APCs with plasmacytoid morphology. Nat. Immunol. 2:11441150.[CrossRef][Medline]
- Terrazas, L. I., K. L. Walsh, D. Piskorska, E. McGuire, and D. A. Harn, Jr. 2001. The schistosome oligosaccharide lacto-N-neotetraose expands Gr1(+) cells that secrete anti-inflammatory cytokines and inhibit proliferation of naive CD4(+) cells: a potential mechanism for immune polarization in helminth infections. J. Immunol. 167:52945303.[Abstract/Free Full Text]
- Mihaila, A., and G. M. Tremblay. 2001. Human alveolar macrophages express elafin and secretory leukocyte protease inhibitor. Z. Naturforsch. 56:291297.
- Sallenave, J.-M., M. Si-Tahar, G. Cox, M. Chignard, and J. Gauldie. 1997. Secretory leukocyte proteinase inhibitor is a major leukocyte elastase inhibitor in human neutrophils. J. Leukoc. Biol. 61:695702.[Abstract]
- Sallenave, J.-M., J. Shulmann, J. Crossley, M. Jordana, and J. Gauldie. 1994. Regulation of secretory leukocyte proteinase inhibitor (SLPI) and elastase-specific inhibitor (ESI/elafin) in human airway epithelial cells by cytokines and neutrophilic enzymes. Am. J. Respir. Cell Mol. Biol. 11:733741.[Abstract]
- Barbey-Morel, C., J. A. Pierce, E. J. Campbell, and D. H. Perlmutter. 1987. Lipopolysaccharides modulates
1-proteinase inhibitor expression of and other serine proteinase inhibitors in human monocytes and macrophages. J. Exp. Med. 166:10411054.[Abstract/Free Full Text]
- Venembre, P., A. Boutten, N. Seta, M. S. Dehoux, B. Crestani, M. Aubier, and G. Durand. 1994. Secretion of alpha 1-antitrypsin by alveolar epithelial cells. FEBS Lett. 346:171174.[CrossRef][Medline]
- Sallenave, J.-M., G. M. Tremblay, J. Gauldie, and C. D. Richards. 1997. Oncostatin M, but not interleukin-6 or leukemia-inhibitory factor stimulates expression of alpha1-proteinase inhibitor in A549 type II human epithelial cells. J. Interferon Cytokine Res. 17:337346.[Medline]
- Boutten, A., P. Venembre, N. Seta, J. Hamelin, M. Aubier, G. Durand, and M. S. Dehoux. 1998. Oncostatin M is a potent stimulator of alpha1-antitrypsin secretion in lung epithelial cells: modulation by transforming growth factor-ß and interferon-
. Am. J. Respir. Cell Mol. Biol. 18:511520.[Abstract/Free Full Text]
- du Bois, R. M., J. F. Bernaudin, P. Paakko, R. Hubbard, H. Takahashi, V. Ferrans, and R. G. Crystal. 1991. Human neutrophils express the alpha 1-antitrypsin gene and produce alpha 1-antitrypsin. Blood 77:27242730.[Abstract/Free Full Text]
- Nadziejko, C., I. Finkelstein, and J. R. Balmes. 1995. Contribution of secretory leukocyte proteinase inhibitor to the antiproteinase defense system of the peripheral lung: effect of ozone-induced acute inflammation. Am. J. Respir. Crit. Care Med. 152:15921598.[Abstract]
- Belorgey, D., and J. G. Bieth. 1995. DNA binds neutrophil elastase and mucus proteinase inhibitor and impairs their functional activity. FEBS Lett. 361:265268.[CrossRef][Medline]
- Hansen, G., S. Hoffjan, K. Mosler, and A. Schuster. 2001. Effect of recombinant human DNase on
1-proteinases inhibitor function: an experimental approach to the combined clinical use of rhDNase and 1-PI in CF patients. Lung 179:185194.[CrossRef][Medline]
- Picot, R., I. Das, and L. Reid. 1978. Pus, deoxyribonucleic acid, and sputum viscosity. Thorax 33:235242.[Abstract/Free Full Text]
- Cox, G., J. Crossley, and Z. Xing. 1995. Macrophage engulfment of apoptotic neutrophils contibutes to the resolution of acute pulmonary inflammation in vivo. Am. J. Respir. Cell Mol. Biol. 12:232237.[Abstract]
- Haslett, C. 2000. Granulocyte apoptotis and its role in the resolution and control of lung inflammation. Am. J. Respir. Crit. Care Med. 160:S5S11.
- Lieberman, J. 1967. Inhibition of protease activity in purulent sputum by DNA. J. Lab. Clin. Med. 70:595605.[Medline]
- Redini, F., J. M. Tixier, M. Petitou, J. Choay, L. Robert, and W. Hornbeck. 1988. Inhibition of leukocyte elastase by heparin and its derivatives. Biochem. J. 252:515519.[Medline]
- Ying, Q.-L., and S. R. Simon. 1995. Accelerated binding of secretory leukoprotease inhibitor to human leukocyte elastase mediated by single-stranded sites in DNA from tracheobronchial mucus. Am. J. Respir. Cell Mol. Biol. 13:703711.[Abstract]
- Ying, Q.-L., and S. R. Simon. 2000. DNA from bronchial secretions modulates elastase inhibition by
1-proteinase inhibitor and oxidized secretory leukoprotease inhibitor. Am. J. Respir. Cell Mol. Biol. 23:506513.[Abstract/Free Full Text]
- Vogelmeier, C., and G. Döring. 1996. Neutrophil proteinases and rDNase therapy in cystic fibrosis. Eur. Respir. J. 9:21932195.[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
G. M. d. C. Ventura, V. Balloy, R. Ramphal, H. Khun, M. Huerre, B. Ryffel, M.-C. M. Plotkowski, M. Chignard, and M. Si-Tahar
Lack of MyD88 Protects the Immunodeficient Host Against Fatal Lung Inflammation Triggered by the Opportunistic Bacteria Burkholderia cenocepacia
J. Immunol.,
July 1, 2009;
183(1):
670 - 676.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Balloy, M. Huerre, J.-P. Latge, and M. Chignard
Differences in Patterns of Infection and Inflammation for Corticosteroid Treatment and Chemotherapy in Experimental Invasive Pulmonary Aspergillosis
Infect. Immun.,
January 1, 2005;
73(1):
494 - 503.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Brinkmann, U. Reichard, C. Goosmann, B. Fauler, Y. Uhlemann, D. S. Weiss, Y. Weinrauch, and A. Zychlinsky
Neutrophil Extracellular Traps Kill Bacteria
Science,
March 5, 2004;
303(5663):
1532 - 1535.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 American Thoracic Society.
|