Published ahead of print on January 31, 2003, doi:10.1165/rcmb.2002-0254OC
American Journal of Respiratory Cell and Molecular Biology. Vol. 29, pp. 19-27, 2003
© 2003 American Thoracic Society DOI: 10.1165/rcmb.2002-0254OC
Cyclic AMP-Mobilizing Agents and Glucocorticoids Modulate Human Smooth Muscle Cell Migration
Elena A. Goncharova,
Charlotte K. Billington,
Carla Irani,
Alexander V. Vorotnikov,
Vsevolod A. Tkachuk,
Raymond B. Penn,
Vera P. Krymskaya and
Reynold A. Panettieri, Jr.
Pulmonary, Allergy, and Critical Care Division, Department of Medicine, University of Pennsylvania; Division of Critical Care, Pulmonary, Allergic & Immunologic Diseases, Jefferson Medical College, and Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, Pennsylvania; and Laboratory of Cell Motility, Laboratory of Molecular Endocrinology, Institute of Experimental Cardiology, Russian Cardiology Research Center, Moscow, Russia
Address correspondence to: Reynold A. Panettieri, Jr., M.D., Pulmonary, Allergy and Critical Care Division, University of Pennsylvania, 421 Curie Boulevard, Room 805 BRB II/III, Philadelphia, PA 19104-6160. E-mail: rap{at}mail.med.upenn.edu
 |
Abstract
|
|---|
Hyperplasia and cell migration of smooth muscle are features of both airway and pulmonary vascular diseases. The precise cellular and molecular mechanisms that regulate smooth muscle migration in the lungs remain unknown. In this study, we examined the effect of cAMP-mobilizing agents and steroids on smooth muscle cell migration. Platelet-derived growth factor (PDGF), transforming growth factor- , vascular endothelial growth factor, and basic fibroblast growth factor significantly stimulated cell migration in pulmonary vascular smooth muscle (PVSM) cells. Airway smooth muscle (ASM) migration was also stimulated by PDGF, transforming growth factor- , and basic fibroblast growth factor, but vascular endothelial growth factor was without effect. Interestingly, the smooth muscle mitogen thrombin did not stimulate migration of either cell type. Agents capable of elevating intracellular cAMP inhibited basal (unstimulated) cell migration in both cell types, whereas their effects on PDGF-stimulated migration were more variable. Prostaglandin E2, salmeterol, and the phosphodiesterase type 4 inhibitor cilomolast inhibited basal ASM and PVSM migration by 3060%. Prostaglandin E2 and cilomolast also inhibited PDGF-stimulated migration of ASM and PVSM cells, but salmeterol was without effect. Preincubation of ASM cells with dexamethasone or fluticasone inhibited basal and PDGF-stimulated migration, and enabled an inhibitory effect of salmeterol on PDGF-induced cell migration. Steroids alone did not stimulate cAMP production or cAMP/PKA-dependent gene transcription (CRE-Luc activity), but slightly augmented salmeterol-stimulated CRE-Luc activity. Collectively, these findings demonstrate that cAMP-mobilizing agents and steroids modulate human smooth muscle cell migration, likely by distinct mechanisms.
Abbreviations: airway smooth muscle, ASM basic fibroblast growth factor, bFGF cAMP/PKA-dependent gene transcription, CRE-Luc activity fetal bovine serum, FBS phosphodiesterase type 4, PDE4 platelet-derived growth factor, PDGF prostaglandin E2, PGE2 pulmonary vascular smooth muscle, PVSM transforming growth factor- , TGF- vascular endothelial growth factor, VEGF
 |
Introduction
|
|---|
Increased smooth muscle mass is frequently associated with diseases manifested by increased airway or pulmonary vascular resistance (13). Growth factors, contractile agonists, and inflammatory mediators stimulate abnormal smooth muscle growth by promoting smooth muscle proliferation (4). Histologic findings suggest that proliferating smooth muscle cells migrate along chemotactic gradients, as evidenced by the invasion of smooth musclelike cells into the submucosa (5), and of pulmonary vascular smooth muscle (PVSM) cells into the interstitium (6). Importantly, agents that stimulate smooth muscle cell proliferation also appear capable of inducing smooth muscle cell migration (710).
Numerous studies also suggest that intracellular cAMP, the second messenger that activates protein kinase A (PKA), is a negative regulator of smooth muscle cell proliferation (1114). cAMP similarly modulates cell migration in an inhibitory fashion in a variety of cell types (1517). Agents such as prostaglandin E2 (PGE2) and ß-agonists, which activate G proteincoupled receptors to elevate cellular cAMP levels, have been shown to inhibit the migration of fibroblasts (18), monocytes (19), lymphocytes (20), eosinophils (21), and airway smooth muscle (ASM) cells (10). Phosphodiesterase type 4 (PDE4) inhibitors, also capable of increasing cellular cAMP levels, similarly suppress vascular smooth muscle cell (22) and eosinophil migration (23).
Fewer studies have examined whether steroids regulate cell migration. Studies of rat vascular smooth muscle (VSM) cells demonstrate that dexamethasone inhibits rat VSM migration via suppression of matrix metalloproteinase activity (24). In contrast, the effects of dexamethasone on aortic smooth muscle cells appear species-specific; dexamethasone inhibits rat aortic smooth muscle cell migration, but has no effect on the migration of human aortic smooth muscle cells (25).
To date, few studies have compared cell migration in both airway and vascular smooth muscle cells. Such studies are important as targeted therapeutic approaches to many diseases are developed. In this study, we compared the ability of various mitogens to stimulate the migration of human ASM and PVSM cells. In addition, we assessed the capacity of cAMP-generating agents and steroids to regulate basal and stimulated smooth muscle cell migration. Results demonstrate that various growth factors, but not all mitogens, stimulate ASM and PVSM cell migration. Agents that elevate intracellular cAMP levels inhibited smooth muscle cell migration, although relatively weak generators of cAMP (e.g., salmeterol) by themselves were unable to inhibit growth factorstimulated smooth muscle cell migration. Steroids alone inhibited both basal and PDGF-stimulated ASM cell migration, and enabled an inhibitory effect of salmeterol on migration. Collectively, these findings show that cAMP-mobilizing agents and steroids modulate human PVSM and ASM cell migration, and suggest potentially new therapeutic targets in managing a common feature of airway and pulmonary vascular disease.
 |
Materials and Methods
|
|---|
Materials
Ham's F-12 media and 0.05% trypsin/0.53 mM ethylenediaminetetraacetic acid were purchased from Life Technologies (Grand Island, NY). Fetal bovine serum (FBS) was purchased from HyClone Laboratories (Logan, UT). Endothelial cell growth supplement was purchased from Becton-Dickinson (Bedford, MA). Vitrogen 100 was purchased from Cohesion Technologies Inc. (Palo Alto, CA). Platelet-derived growth factor BB (PDGF), basic fibroblast growth factor (bFGF), vascular endothelial growth factor (VEGF), transforming growth factor- (TGF- ) and forskolin were purchased from CalbiochemNovabiochem (San Diego, CA). PGE2 was purchased from Calbiochem (La Jolla, CA). Salmeterol, fluticasone, and cilomolast were generously supplied by GlaxoSmithKline, Inc. (King of Prussia, PA) All other materials, unless specified otherwise, were obtained from Sigma (St. Louis, MO).
Human ASM and PVSM Cell Culture
Human ASM and PVSM cells were dissociated from human trachea and pulmonary artery, respectively, which were obtained from human lung transplant donors, in accordance with procedures approved by the University of Pennsylvania Committee on Studies Involving Human Beings as described previously (9, 26). ASM cells were cultured in Ham's F-12 medium supplemented with 10% FBS, 100 U/ml penicillin, and 0.1 mg/ml streptomycin. PVSM cells were plated on tissue culture plates covered with Vitrogen and cultured in Ham's F-12 media supplemented with 10% FBS, 30 µg/ml endothelial cell growth supplement, 100 U/ml penicillin, and 0.1 mg/ml streptomycin. Prior to each experiment both ASM and PVSM cells were maintained in serum-free Ham's F-12 for 48 h under the same conditions.
Cell Migration Assay
Cell motility was examined using a Boyden chamber apparatus. Confluent ASM or PVSM cells, growth-arrested for 48 h in serum-free media, were briefly trypsinized by 0.05% trypsin/0.53 mM ethylenediaminetetraacetic acid, centrifuged at 900 rpm for 10 min, and resuspended in serum-free Ham's F-12 media supplemented with 0.1% bovine serum albumin (BSA). Cells (5 x 104) were then placed into the upper wells of the Boyden chamber fitted with an 8-µm pore membrane, coated with Vitrogen (100 µg/ml). Agonists or vehicle in serum-free Ham's F-12 media with 0.1% BSA were added to either the lower chamber or both the lower and upper chambers. Cells in the Boyden chamber were incubated for 4 h at 37°C in a 5% CO2 incubator. Nonmigrated cells were scraped off; the membrane was fixed with methanol, stained with Hemacolor stain set and scanned. Cell migration was analyzed using the Gel-Pro analyzer program (Media Cybernetics, Silver Spring, MD). In parallel experiments, myocyte monolayers were treated with dexamethasone or fluticasone for 18 h before agonists being added to the lower wells.
In some experiments, various agents were also added to the upper wells, and cell migration was assessed after 4 h at 37°C. These studies characterized whether mitogens promoted chemokinesis, which is characterized by the increased random movement of cells, or whether mitogens promoted chemotaxis, in which movement occurs along a gradient.
Assay of cAMP Accumulation in ASM Cells
Confluent, growth-arrested human ASM cells grown in 24-well plates were stimulated with vehicle, 1 µM salmeterol, or 1 µM PGE2 in phosphate-buffered saline (PBS) for 10 min at 37°C as described previously (27), with the exception being that no phosphodiesterase inhibitors (except where noted) were included in the stimulation mix. cAMP was subsequently isolated by ethanol extraction and assayed by radioimmunoassay as described previously (27).
Plasmid Construction, ASM Transfection, and CRE-Luc Reporter Assay
Two micrograms each of the oligonucleotides 5' tcgatagcctgacgtcagagag 3' (containing the consensus CRE sequence tgacgtca) and its reverse complement were phosphorylated with T4 kinase. The kinase was deactivated by heating, and 50 ng of annealed oligos were placed in a ligation reaction with 100 ng of Sal1-digested, phosphatased 56FosdE-Luc (28), and transformed into DH5 cells. Colonies were screened for DNA containing inserts excised with Pst1, and candidates were sequenced. A clone identified with 3 (CRE) inserts all in the 5' to 3' orientation was subsequently confirmed to lack responsiveness to AP-1 or Ras activating agents, and used in the present study.
ASM cells were passaged at a density of 1 x 104 cells/ml onto 15-cm plates and grown in 27 ml Ham's F-12/10% FBS. 24 h later, the medium was replaced with fresh Ham's F-12/10% FBS, and cells were transfected with Fugene (Applied Sciences, Indianapolis, IN) as described previously for COS-1 cells (27) using a mixture of 90 µl Fugene and 30 µg of 56FosdECRE3-Luc. Twenty-four hours later, cells were passaged onto 24-well plates, subsequently growth-arrested for 48 h, then pretreated with vehicle, dexamethasone or fluticasone prior to stimulation with vehicle or 1 µM salmeterol. Following 10 h stimulation, cells were washed twice in Ca2+- and Mg2+-free PBS, lysed in 25 mM Tris-HCl, pH 7.8, 2 mM dithiothreitol, 2 mM EGTA, 10% glycerol, 1% Triton X-100 and harvested. Lysates were cleared by centrifugation and supernatants frozen at 70°C. Samples were subsequently assayed for luciferase activity using firefly luciferase substrate as described previously (28).
Data Analysis
Data points from individual assays represent the mean values ± SE. Statistically significant differences among groups were assessed with the ANOVA (Bonferroni-Dunn test), with values of P < 0.05 sufficient to reject the null hypothesis for all analyses. All experiments were designed with matched control conditions within each experiment to enable statistical comparison as paired samples.
 |
Results
|
|---|
Growth Factors Induce Human ASM and PVSM Cell Migration
Because diseases characterized by smooth muscle hyperplasia also exhibit evidence of smooth muscle migration, we examined whether known mitogens for human ASM and PVSM promote myocyte migration. As shown in Figures 1A and 1B, growth factors such as PDGF, TGF- , and bFGF stimulated human ASM and PVSM cell migration. The concentrations of growth factors used in these assays were those that maximally stimulate cell proliferation. In ASM cells, PDGF, TGF- , and bFGF induced cell migration by 3.2 ± 0.1, 3.3 ± 0.5, and 2.9 ± 0.5 fold, respectively. In PVSM cells, PDGF was more effective in promoting cell migration than either TGF- or bFGF (Figure 1B). VEGF stimulated migration of PVSM 2.2 ± 0.1 fold, but had little effect on ASM cell migration. This lack of effect is observed despite evidence of VEGF receptors on ASM, as stimulation of ASM cultures with VEGF induces the secretion of fibronectin in a receptor-specific manner (Aili Lazaar, personal communication). In both ASM and PVSM cells, the potent mitogen thrombin had no effect on migration. Collectively, these data demonstrate that some growth factors, but not all mitogens, promote ASM and PVSM migration.


View larger version (33K):
[in this window]
[in a new window]
|
Figure 1. (A) Growth factors induce ASM and PVSM cell migration. Growth-arrested ASM (A) and PVSM (B) cells were harvested and transferred to a Boyden chamber for analysis of cell migration in response to either 10 ng/ml PDGF, 10 ng/ml TGF- , 10 ng/ml bFGF, 10 ng/ml VEGF, 1 U/ml thrombin, or vehicle, as described in MATERIALS AND METHODS. Data represent mean values ± SE from nine observations. *P < 0.001 versus control by ANOVA (Bonferroni-Dunn test). Mean values for number of cells migrated: ASM (basal), 289.7 ± 16.4; ASM (PDGF-stimulated), 874.9 ± 18.2; PVSM (basal), 259.2 ± 21.1; (PDGF-stimulated), 782.8 ± 44. One fold represents the quantity of cells per field, which equals 289.7 ± 16.4 for ASM, and 259.2 ± 21.1 for PVSM, after migration on the serum-free media with 0.1% BSA (cell suspension in the same media) without stimuli, and reflects basal chemokinetic activity. X fold values greater than one (e.g., observed with PDGF stimulation reflect an 100(X-1)/X % increase in activity. (C) Chemokinesis of growth-arrested ASM cells in the presence of 10 ng/ml PDGF, 1 U/ml thrombin, or vehicle in both (lower and upper) chambers. Data represent mean ± SE values from nine observations. Filled bars, lower chamber; open bars, upper and lower chamber.
|
|
To address whether the observed cell migration was due to chemotaxis or chemokinesis, vehicle, PDGF, or thrombin was added to either the upper chamber or both the upper and lower chambers and ASM cell migration assessed after 4 h of stimulation. In all cases, agents were unable to stimulate cell migration when added to both the upper and lower chambers (Figure 1C). Growth factors, therefore, function as chemoattractants and not chemokinetic agents to induce migration of ASM and PVSM cells.
PGE2 and Salmeterol Inhibit ASM and PVSM Cell Migration
Based on previous findings in other cell types (16, 22, 29), we postulated that agents that increase intracellular cAMP levels inhibit basal and growth factorinduced migration of ASM and PVSM cells. We first examined the effects of PGE2 and salmeterol, which increase intracellular levels of cAMP via activations of EP prostanoid and ß2-adrenergic receptors (27). As shown in Figure 2A, PGE2 inhibited basal cell migration of both ASM and PVSM in a dose-dependent manner, exhibiting a greater potency in PVSM but causing an 60% maximal inhibition in both cell types. Salmeterol had a similar but slightly less efficacious ( 40% maximal inhibition) effect on basal cell migration of both ASM and PVSM (Figure 2B). Because basal migration was inhibited by PGE2 and salmeterol, these data suggest that cAMP mobilizing agents inhibit chemokinesis of smooth muscle.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 2. PGE2 and salmeterol inhibit basal ASM (diamonds) and PVSM (squares) cell migration. The effects of 10, 100, 1,000 or 10,000 nM PGE2 (A) or salmeterol (B) on basal migration were assessed for ASM and PVSM cells. Data represent mean values ± SE from nine (ASM) or six (PVSM) observations. (A) *P < 0.001 for PGE2 versus vehicle for ASM cells; **P < 0.001 for PGE2 versus vehicle for PVSM cells. (B) *P < 0.001 for salmeterol versus vehicle for ASM cells; **P < 0.001 for salmeterol versus vehicle for PVSM cells by ANOVA (Bonferroni-Dunn test).
|
|
The effects of PGE2 and salmeterol were also examined in cells treated with PDGF. As shown in Figure 3A, PGE2 effectively inhibited PDGF-induced cell migration in ASM and PVSM cells. Interestingly, salmeterol (Figure 3B) had no significant effect on PDGF-induced migration of either cell type.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 3. PGE2, but not salmeterol, inhibits PDGF-induced ASM (diamonds) and PVSM (squares) cell migration. The effects of 10, 100, 1,000 or 1,000 nM PGE2 (A) or salmeterol (B) on PDGF-stimulated ASM and PVSM cell migration were assessed. Data represent mean values ± SE from nine (ASM) or six (PVSM) observations. *P < 0.001 for PDGF + PGE2 versus PDGF for ASM cells; **P < 0.001 for PDGF + PGE2 versus PGE2 for PVSM cells by ANOVA (Bonferroni-Dunn test).
|
|
We next examined the effects of cilomolast, which increases intracellular cAMP levels via specific inhibition of type 4 phosphodiesterase activity (30), on basal and stimulated cell migration. Cilomolast inhibited basal migration of both ASM (33.7 ± 6.4% change, P < 0.05) and PVSM (26.8 ± 3.7% change, P < 0.05) cells in a dose-dependent manner (Figure 4A). In PVSM cells, cilomolast was also a potent and effective inhibitor of PDGF-stimulated migration (45.1 ± 7.7% change, P < 0.05), whereas its effect on PDGF-stimulated migration of ASM was less impressive, but still produced a significant inhibition (23.0 ± 7.6%, P < 0.05) at 100 nM (Figure 4B). In addition, the effects of cilomolast and salmeterol on basal ASM cell migration were additive (Figure 5).

View larger version (13K):
[in this window]
[in a new window]
|
Figure 4. Cilomolast inhibits basal and PDGF-induced ASM (diamonds) and PVSM (squares) cell migration. The effects of vehicle or 1, 10, 100 nM of cilomolast on ASM or PVSM cell migration in the absence (A) or in the presence (B) of 10 ng/ml of PDGF was assessed as described in MATERIALS AND METHODS. Data represent mean values ± SE from nine (ASM) or six (PVSM) observations. (A) *P < 0.001 for cilomolast versus vehicle for ASM cells; **P < 0.001 for cilomolast versus vehicle for PVSM cells. (B) *P < 0.001 for PDGF + cilomolast versus PDGF for ASM cells; **P < 0.001 for PDGF + cilomolast versus PDGF for PVSM cells by ANOVA (Bonferroni-Dunn test).
|
|

View larger version (14K):
[in this window]
[in a new window]
|
Figure 5. The effects of salmeterol and cilomolast on unstimulated ASM cell migration are additive. The effects of vehicle, 10 nM of cilomolast, 10 nM of salmeterol, and 10 nM cilomolast plus 10 nM salmeterol, on basal migration were assessed for ASM cells as described in MATERIALS AND METHODS. Data represent mean ± SE from six observations. *P < 0.001 for cilomolast + salmeterol versus cilomolast by ANOVA (Bonferroni-Dunn test).
|
|
Dexamethasone and Fluticasone Promote the Inhibitory Effect of Salmeterol on PDGF-Induced Cell Migration
Steroids are the treatment of choice in the management of airway inflammation and have been reported to partially inhibit growth factorstimulated mitogenesis of ASM (31). In addition, recent evidence suggests that steroids modulate the effects of ß-agonists in a variety of cell types (32, 33). We therefore examined the effect of steroids, alone or in combination with PGE2 or salmeterol, on ASM cell migration. Preincubation of ASM cells with fluticasone alone for 18 h significantly inhibited basal (chemokinetic) and PDGF-induced (chemotactic) migration (Figure 6). We then tested whether cAMP-enhancing agents, PGE2 and salmeterol, modulated PDGF-stimulated migration of glucocorticoid-pretreated cells. In cells pretreated with fluticasone, PGE2 and to a lesser degree salmeterol augmented inhibition of PDGF-induced cell migration (Figures 7A and 7B). Although the augmented inhibition of cell migration by salmeterol in the presence of fluticasone is modest, this result was surprising because salmeterol itself had no effect on PDGF-induced cell migration (Figure 3B). We also found that pretreatment with dexamethasone (100 nM) rendered salmeterol treatment effective in inhibiting PDGF-stimulated migration of both ASM and PVSM. When fluticasone or dexamethasone was added simultaneously with PDGF, steroids had no effect on basal and PDGF-induced ASM cell migration (data not shown).

View larger version (13K):
[in this window]
[in a new window]
|
Figure 6. Preincubation of ASM cells with fluticasone modulates basal and PDGF-induced cell migration. Growth-arrested ASM cells were preincubated with either vehicle, 1, 10 or 100 nM of fluticasone (Flu) for 18 h; basal cell migration (A) or migration in the presence of 10 ng/ml PDGF (B) were then examined. Data represent mean values ± SE from six replications. (A) *P < 0.001 for 100 nM of fluticasone versus control. (B) *P < 0.001 for 10 or 100 nM of fluticasone versus PDGF by ANOVA (Bonferroni-Dunn test).
|
|


View larger version (31K):
[in this window]
[in a new window]
|
Figure 7. Fluticasone modulates the effects of salmeterol, PGE2 and forskolin on PDGF-induced ASM cell migration. Growth-arrested ASM cells were preincubated with vehicle (black columns) or 0.1 µM of fluticasone (Flu) (white columns) for 18 h. The effects of vehicle or 10 µM of salmeterol (Sal) (A), 0.1 µM of PGE2 (B), or 5 µM of forskolin (C) on PDGF-stimulated cell migration were then assessed. Data represent mean values ± SE from six observations. (A) *P < 0.001 for Flu + Sal + PDGF versus Sal + PDGF w/o Flu; *P < 0.001 for Flu + Sal + PDGF versus Flu + PDGF w/o Sal. (B) *P < 0.001 for Flu + PGE2 + PDGF versus PGE2 + PDGF; *P < 0.001 for Flu + PGE2 + PDGF versus Flu + PDGF w/o PGE2. (C) *P < 0.001 for Flu + forskolin + PDGF versus forskolin + PDGF w/o Flu; *P < 0.001 for Flu + forskolin + PDGF versus Flu + PDGF w/o forskolin by ANOVA (Bonferroni-Dunn test).
|
|
To confirm that the difference in cell migration between cells treated with fluticasone and diluent was not a result of steroids inhibiting cell attachment (and thus fewer cells are available to migrate across the membrane), ASM cells treated overnight with diluent or fluticasone were allowed to attach for 4 h to the upper membrane and then cell counts per field were performed. After overnight treatment with diluent, there were 48,394 ± 579 cells/field (n = 3) and after overnight treatment with Flu, there were 48,954 ± 289 cells/field (n = 3). Similar results were observed in cells treated with PGE2 or salmeterol (data not shown). These data suggest that steroids have little effect on cell attachment, and that the observed effect of steroids truly reflects inhibition of migration per se.
To define components of Gs-coupled receptor signaling that modulate glucocorticoid-dependent inhibition of migration, we tested whether direct adenylyl cyclase activation affects PDGF-induced migration of fluticasone-preincubated ASM cells. Forskolin alone markedly decreased PDGF-induced migration. When fluticasone was added simultaneously with forskolin, fluticasone had little effect on forskolin-induced inhibition of migration of cells stimulated with PDGF (data not shown). In contrast, when cells were preincubated with fluticasone for 18 h, fluticasone modestly enhanced forskolin-induced inhibition of PDGF-induced migration (Figure 7C). These data suggest that the inhibitory effect of Gs-coupled receptors on migration is mediated by adenylyl cyclase activation.
The Effectiveness of Agonists in Inhibiting Cell Migration Is Associated with their Capacity to Increase cAMP Levels and Activate cAMP-Responsive Element Promoter Activity
To explore the basis of the differential effects of cAMP mobilizing agents and steroids on cell migration, we characterized the effects of PGE2, salmeterol, cilomolast, dexamethasone, and fluticasone on cAMP generation and CREB promoter activation. In assays of short-term (10 min) intracellular cAMP accumulation, salmeterol and cilomolast each stimulated cAMP accumulation to levels 3- to 4-fold those of basal (Figure 8A), whereas PGE2-stimulated cAMP accumulation was decidedly more robust ( 35-fold basal levels). The addition of cilomolast augmented salmeterol-stimulated cAMP accumulation to 7.5-fold that of basal accumulation. However, chronic pretreatment with dexamethasone (data not shown) or fluticasone (Figure 8B) has no effect on basal or salmeterol-stimulated cAMP generation; this is consistent with our previous studies demonstrating no effect of dexamethasone on basal or ß-agoniststimulated cAMP generation in human ASM (34).

View larger version (18K):
[in this window]
[in a new window]
|
Figure 8. Fluticasone pretreatment does not alter acute basal salmeterol-stimulated cAMP accumulation. (A) Confluent, growth-arrested human ASM cells grown in 24-well plates were stimulated with vehicle, 1 µM salmeterol (Salm), 100 nM cilomolast (Cil), 100 nM cilomolast plus 1 µM salmeterol (Salm + Cil), or 1 µM PGE2 in PBS for 10 min at 37°C, and cAMP accumulation was assayed as described in MATERIALS AND METHODS. (B) Cells were pretreated for 18 h with vehicle (open bars) or the 100 nM fluticasone (Flu; filled bars) before acute addition of the indicated agents. Data represent mean values ± SE from three paired observations. For both A and B, the patterns of cAMP generation and CRE-Luc activity stimulated by the indicated agents, and effect of fluticasone, were similar when performed in the presence of PDGF (data not shown).
|
|
Because cell migration measured in the present study occurred over the course of 4 h of treatment, we next examined the effects of inhibitors of ASM cell migration on the activation of a cAMP-responsive element (CRE) reporter, which provides an index of cAMP generation and PKA activation that occurs over hours. In this system, activation of PKA promotes phosphorylation of the transcription factor CREB, and the binding of phospho-CREB to a consensus (CRE) binding site in the transfected reporter plasmid 56FosdECRE3-Luc drives transcription of the firefly luciferase gene. The activity of synthesized luciferase is assessed in an in vitro assay. ASM cells transfected with 56FosdECRE3-Luc and stimulated with PGE2, cilomolast, or salmeterol for 10 h increased luciferase activity 4.6 ± 0.6, 1.9 ± 0.2, and 1.9 ± 0.2 fold, respectively, over that of basal (vehicle-stimulated) activity (Figure 9A), a profile consistent with the rank order of the effect of these agents on PDGF-stimulated ASM cell migration. Concomitant treatment with cilomolast and salmeterol induced a significantly greater level of luciferase activity than that induced by salmeterol alone (2.5 ± 0.2 fold versus 1.9 ± 0.2 fold, respectively, P < 0.05). Pretreatment of cells with 100 nM fluticasone for 18 h had no effect on basal luciferase activity, yet caused a small but significant increase in salmeterol-stimulated luciferase activity (Figure 9B). The effects of pretreatment with 100 nM dexamethasone were similar to those of fluticasone (data not shown).

View larger version (18K):
[in this window]
[in a new window]
|
Figure 9. Fluticasone modulates salmeterol-induced cAMP-dependent gene expression in ASM cells. (A) ASM cells transfected with a CRE-luciferase (CRE-Luc) construct were plated in 24-well plates, growth arrested, then stimulated with the indicated agents for 16 h, after which cell lysates were harvested and analyzed for luciferase activity as described in MATERIALS AND METHODS. For B, cells were pretreated for 18 h with vehicle (open bars) or 100 nM fluticasone (Flu; filled bars) before acute addition of the indicated agents. Data represent mean values ± SE from three (A) or five (B) paired observations. *P < 0.05 for fluticasone-treated group versus vehicle-treated group. For both A and B, the patterns of cAMP generation and CRE-Luc activity stimulated by the indicated agents, and effect of fluticasone, were similar when performed in the presence of PDGF (data not shown).
|
|
 |
Discussion
|
|---|
Elucidation of the mechanisms promoting human ASM and PVSM cell migration may provide insight into the pathogenesis of asthma and pulmonary vascular diseases. Recent studies suggest that agents that promote smooth muscle cell proliferation can also initiate cell migration (79). Our study demonstrates that some, but not all, mitogens promote ASM and PVSM cell migration and notes cell-specific responses. VEGF stimulated PVSM cell migration, but had little effect in stimulating ASM cell migration. Thrombin, an effective mitogen for both ASM and PVSM, had no effect on either ASM or PVSM cell migration. Our study also addresses the hypothesis that agents that increase intracellular cAMP levels inhibit ASM and PVSM cell migration. Our data demonstrate that agents that stimulate adenylyl cyclase (PGE2 and salmeterol) through Gs protein-coupled receptors and the phosphodiesterase type 4 inhibitor, cilomolast, inhibit ASM and PVSM cell migration with an efficacy associated with their ability to promote cAMP accumulation and PKA activation. Interestingly, steroids alone profoundly inhibit growth factor-stimulated smooth muscle cell migration in a cAMP-independent manner, and are more efficacious when combined with salmeterol.
Several studies have suggested that intracellular cAMP regulates the migration of a variety of mammalian cell types. Receptors coupled to the heterotrimeric G protein Gs mediate the effects of agents such as ß-agonists and PGE2 to stimulate adenylyl cyclase, which hydrolyzes ATP to cAMP. ß-Adrenergic receptor agonists and PGE2 inhibit migration of fibroblasts (18), macrophages (19), and ASM cells (10); salmeterol inhibits eosinophil migration (21). Our data indicate that PGE2 and salmeterol inhibit the migration of unstimulated ASM and PVSM cells. However, PGE2, but not salmeterol, was effective in inhibiting PDGF-stimulated ASM and PVSM cell migration.
Intracellular cAMP levels are dictated by the balance between cAMP generation (adenylyl cyclase activity) and breakdown (by membrane bound phosphodiesterases). In smooth muscle cells, phosphodiesterase type 4 is the predominant phosphodiesterase subtype that hydrolyzes cAMP to AMP (35). In numerous cell types, PDE4 inhibitors exhibit the capacity to regulate cell migration. Treatment of colon cancer cells with PDE4 inhibitors rolipram or Ro-201724 inhibited their migration (29). Selective inhibitors of PDE4 also decreased the migration of rat eosinophils (23) and vascular smooth muscle cells (22). We found that cilomolast, a selective PDE4 inhibitor, reduced human ASM and PVSM cell migration under both basal (chemokinetic) and PDGF-stimulated (chemotactic) conditions. Moreover, the combination of cilomolast and salmeterol had an additive effect in inhibiting basal ASM cell migration, consistent with the ability of phosphodiesterase inhibitors to increase the accumulation of intracellular cAMP generated by G proteincoupled receptor activation (36).
The signaling pathways underlying cAMP-dependent inhibition of cell migration are relatively unexplored. Studies have suggested a link between cAMP-dependent PKA activation and inhibition of cell migration (16, 18, 3739). However, the effects of cAMP-dependent PKA activation on migration appear to be cell-specific. Whereas in the majority of cell types PKA activation inhibits cell migration, PKA activation serves to accelerate the migration of bronchial epithelial cells during wound repair by reducing the levels of active Rho and the formation of focal adhesions (40). Recent evidence suggests that MAPK activation is important for PDGF-stimulated migration of epithelial, endothelial, human ASM (6, 41, 42), pulmonary artery smooth muscle (43), and vascular smooth muscle cells (44, 45). Pharmacologic inhibition of p42/p44 signaling inhibited PDGF-induced migration of many cell types (10, 4347). PKA inhibits p42/p44 signaling at the level of the upstream intermediate Raf-1, by promoting Raf-l phosphorylation at multiple serine residues, leading to a reduced affinity of Raf for Ras (48). Interestingly, treatment of human ASM cells with various cAMP-generating agents very modestly inhibit p42/p44 phosphorylation stimulated by PDGF at concentrations that promote cell migration (data not shown), suggesting that the inhibitory effect of cAMP-mobilizing agents is not mediated by a reduction in p42/p44 activity.
In the present study, the relationship between the ability of the cAMP-mobilizing agents to inhibit cell migration and stimulate cAMP is explored, and extended by analysis of CRE-Luc activity in ASM cells. PGE2, the GPCR agonist most efficacious in inhibiting ASM cell migration, was also the most effective stimulator of both cAMP production and CRE-Luc activity. Conversely, salmeterol, a ß2-adrenergic receptor agonist with low intrinsic activity (49), is a relatively weak stimulator of CRE-Luc activity in ASM cells, and by itself does not inhibit PDGF-stimulated migration of either ASM or PVSM cells. Although we have not examined other ß-agonists in the present study, our collective results suggest the lack of effect of salmeterol is explained primarily by its (weak) ability to stimulate cAMP production, and does not reflect a general property of ß-agonists per se. Future studies examining the time-dependent effects of ß-agonists with high intrinsic activity, both a long acting (e.g., formoterol) and short-acting (e.g., isoproterenol) nature should clarify this issue.
Interestingly, the PDE4 inhibitor cilomolast is also a relatively weak stimulator of CRE-Luc activity, but can inhibit (albeit weakly) PDGF-stimulated ASM cell migration. Why cilomolast but not salmeterol can inhibit stimulated ASM migration, despite an apparent similar capacity to stimulate cAMP and activate PKA, is unclear. Potential explanations could involve additional actions of ß2-adrenergic receptor activation that are PKA-independent and mitigate any inhibitory effect on migration, or compartmentalization of cAMP signaling conferred by the localization of PDE4 in ASM cells. Of note, however, is the observation that combined treatment with cilomolast and salmeterol stimulated CRE-Luc activity in ASM to a greater extent than did either agent alone, consistent with the additive effect of these two agents in inhibiting cell migration.
As noted above, dexamethasone has been shown to inhibit both rat aortic smooth muscle and PVSM cell migration (24, 50, 51). Consistent with these observations, our data demonstrate that fluticasone and dexamethasone markedly inhibit basal and PDGF-stimulated migration of ASM and PVSM cells. Because treatment of ASM cells with fluticasone or dexamethasone had little effect on basal or salmeterol-induced cAMP level and only a modest effect on CRE activity, it is unlikely that inhibition of migration by steroids occurs as a result of PKA activation. Other signaling pathways such as Rho kinase or PI3-kinase may be targets of glucocorticoids (5254). However, our efforts to date have failed to demonstrate inhibition of PI3-kinase activation by glucocorticoids (Vera Krymskaya, unpublished observations). Future studies are needed to address the cellular mechanisms by which steroids inhibit cell migration.
Because recent studies suggest that the combined effects of ß-agonists and steroids can exhibit positive cooperativity at both an organ system (55) and cellular (32, 33) level, we examined the effect of glucocorticoids on salmeterol-, PGE2-, and forskolin-mediated inhibition of ASM migration. Although dexamethasone or fluticasone but not salmeterol alone inhibited PDGF-stimulated ASM cell migration, combined treatment enhanced inhibition. Similarly, overnight pretreatment of ASM cells with fluticasone augmented the inhibitory effect of PGE2 and salmeterol on PDGF-induced migration. Also, preincubation of ASM cells with fluticasone enhanced the inhibitory effect of forskolin (an adenylyl cyclase activator) on the PDGF-induced ASM cell migration. Whether the primarily additive effect of glucocorticoids and cAMP-elevating agents represents contributions of distinct, parallel pathways, or signaling crosstalk/cooperativity (perhaps at the level of cAMP production and PKA activation) is not known. Our data demonstrate that pretreatment with fluticasone or dexamethasone does not alter basal cAMP production or CRE-Luc activity, and fails to significantly increase acute cAMP accumulation stimulated by salmeterol, suggesting that under these conditions glucocorticoid treatment does not enhance ß2AR responsiveness via mechanisms such as ß2AR upregulation as described previously (33), and that the inhibitory effects of glucocorticoids on migration are cAMP/PKA-independent. However, pretreatment with fluticasone or dexamethasone did promote a small but significant increase in salmeterol-stimulated CRE activity, suggesting a small measure of signaling cooperativity at the level of gene transcription regulation.
Although we clearly showed a differential migration response of ASM and PVSM cells to growth factors and to inhibitors of cell migration, limitations of our model systems should be identified. The growth of PVSM required plating PVSM cells on matrix-coated plates. It is plausible that matrix potentially could modulate migratory phenotypes. Although plausible, we believe this is unlikely because cells are removed from the plates and then plated in the Boyden chamber, where cell migration is then measured after 4 h. All experiments were performed from a minimum of three different cell lines of ASM and PVSM, thus minimizing biologic variability attributable to multiple donors. All cell migration assays were also performed with serum-deprived, quiescent cells matched by cumulative population doublings, and as such variability among growth characteristics or cell passage was minimized. We recognize that in vitro comparisons among different cell types in culture are potentially wrought with complexity. However, to the best of our ability, we have attempted to control for potential confounding variables. Despite these concerns, the direct comparison of cell types within the study may offer insights into the development of cell-specific therapeutic agents.
In summary, our data suggest cell-specific effects of various mitogens on the migration of human ASM and PVSM cells. In addition, cAMP-generating agents inhibit ASM and PVSM cell migration, and their efficacy appears related to their capacity to stimulate cAMP production and PKA activity. Steroids profoundly inhibit PDGF-stimulated migration of ASM and PVSM, and this inhibition is enhanced by salmeterol. Our previous studies demonstrated that ß-adrenergic receptor agonists, as well as PDE4 inhibitors, enhance interleukin-6 secretion and inhibit RANTES secretion in ASM cells (56). Thus, the therapeutic nature of cAMP-generating agents, well established with respect to the regulation of bronchomotor tone, likely extends to several newly identified cellular functions of airway smooth muscle.
 |
Acknowledgments
|
|---|
This work was supported by grants HL55301, HL64063, HL67663 (R.A.P), HL071106-01 (V.P.K.), HL58506, and HL065338 (R.B.P.) from the National Heart, Lung, and Blood Institute; grants from the American Heart Association (V.P.K.); and Glaxo Smith Kline (R.A.P.). R.B.P. is the recipient of a Career Investigator Award from the American Lung Association. The authors wish to thank the National Disease Research Interchange (NDRI) for providing human trachea and pulmonary artery; Ms. Mary McNichol for assistance in preparation of the manuscript.
Received in original form November 14, 2002
Received in final form January 28, 2003
 |
References
|
|---|
- Panettieri, R. A., Jr. 1998. Cellular and molecular mechanisms regulating airway smooth muscle proliferation and cell adhesion molecule expression. Am. J. Respir. Crit. Care Med. 158:133140.
- Black, J. L., M. Roth, J. Lee, S. Carlin, and P. R. Johnson. 2001. Mechanisms of airway remodeling: airway smooth muscle. Am. J. Respir. Crit. Care Med. 164:S63S66.[Abstract/Free Full Text]
- Bento, A. M., and M. B. Hershenson. 1998. Airway remodeling: potential contributions of subepithelial fibrosis and airway smooth muscle hypertrophy/hyperplasia to airway narrowing in asthma. Allergy Asthma Proc. 19:353358.[CrossRef][Medline]
- Stork, P. J. S., and J. M. Schmitt. 2002. Crosstalk between cAMP and MAP kinase signaling in the regulation of cell proliferation. Trends Cell Biol. 12:258266.[CrossRef][Medline]
- Gizycki, M. J., E. Adelroth, A. V. Rogers, P. M. O'Byrne, and P. K. Jeffery. 1997. Myofibroblast involvement in the allergen-induced late response in mild atopic asthma. Am. J. Respir. Cell Mol. Biol. 16:664673.[Abstract]
- Hedges, J. C., M. A. Dechert, I. A. Yamboliev, J. L. Martin, E. Hickey, L. A. Weber, and W. T. Gerthoffer. 1999. A Role for p38MAPK/HSP27 pathway in smooth muscle cell migration. J. Biol. Chem. 274:2421124219.[Abstract/Free Full Text]
- Kraemer, R., H. Nguyen, K. L. March, and B. Hempstead. 1999. NGF activates similar intracellular signaling pathways in vascular smooth muscle cells as PDGF-BB but elicits different biological responses. Arterioscler. Thromb. Vasc. Biol. 19:10411050.[Abstract/Free Full Text]
- Cospedal, R., H. Abedi, and I. Zachary. 1999. Platelet-derived growth factor-BB (PDGF-BB) regulation of migration and focal adhesion kinase phosphorylation in rabbit aortic vascular smooth muscle cells: roles of phosphatidylinositol 3-kinase and mitogen-activated protein kinases. Cardiovasc. Res. 41:708721.[Abstract/Free Full Text]
- Goncharova, E. A., A. J. Ammit, C. Irani, R. G. Carroll, A. J. Eszterhas, R. A. Panettieri, and V. P. Krymskaya. 2002. Phosphatidylinositol 3-kinase is required for proliferation and migration of human pulmonary vascular smooth muscle cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 283:L354L363.[Abstract/Free Full Text]
- Parameswaran, K., G. Cox, K. Radford, L. Janssen, R. Sehmi, and P. M. O'Byrne. 2002. Cysteinyl leukotrienes promote human airway smooth muscle migration. Am. J. Respir. Crit. Care Med. 166:738742.[Abstract/Free Full Text]
- Wong, S. T., L. P. Baker, K. Trinh, M. Hetman, L. A. Suzuki, D. R. Storm, and K. E. Bornfeldt. 2001. Adenylyl cyclase 3 mediates prostaglandin E2-induced growth inhibition in arterial smooth muscle cells. J. Biol. Chem. 276:3420634212.[Abstract/Free Full Text]
- Koyama, H., K. E. Bornfeldt, S. Fukumoto, and Y. Nishizawa. 2001. Molecular pathways of cyclic nucleotide-induced inhibition of arterial smooth muscle cell proliferation. J. Cell. Physiol. 186:110.[CrossRef][Medline]
- Rybalkin, S. D., and K. E. Bornfeldt. 1999. Cyclic nucleotide phosphodiesterases and human arterial smooth muscle cell proliferation. Thromb. Haemost. 82:424434.[Medline]
- Osinski, M. T., and K. Schror. 2000. Inhibition of platelet-derived growth factor-induced mitogenesis by phosphodiesterase 3 inhibitors: role of protein kinase a in vascular smooth muscle cell mitogenesis. Biochem. Pharmacol. 60:381387.[CrossRef][Medline]
- Hackett, S. F., Z. Friedman, and P. A. Campochiaro. 1987. Cyclic 3',5'-adenosine monophosphate modulates vascular endothelial cell migration in vitro. Cell Biol. Int. Rep. 11:279287.[CrossRef][Medline]
- Itoh, H., S. Yamamura, J. A. Ware, S. Zhuang, S. Mii, B. Liu, and K. C. Kent. 2001. Differential effects of protein kinase C on human vascular smooth muscle cell proliferation and migration. Am. J. Physiol. Heart Circ. Physiol. 281:H359H370.[Abstract/Free Full Text]
- Elferink, J. G. R., and B. E. VanUffelen. 1996. The role of cyclic nucleotides in neutrophil migration. Gen. Pharmacol. 27:387393.[Medline]
- Kohyama, T., R. F. Ertl, V. Valenti, J. Spurzem, M. Kawamoto, Y. Nakamura, T. Veys, L. Allegra, D. Romberger, and S. I. Rennard. 2001. Prostaglandin E2 inhibits fibroblast chemotaxis. Am. J. Physiol. Lung Cell. Mol. Physiol. 281:L1257L1263.[Abstract/Free Full Text]
- Singhal, P. C., R. T. Sankaran, N. Nahar, N. Shah, and P. Patel. 2000. Vasoactive agents modulate migration of monocytes across glomerular endothelial cells. J. Investig. Med. 48:110117.[Medline]
- Mesri, M., J. Liversidge, and J. V. Forrester. 1996. Prostaglandin E2 and monoclonal antibody to lymphocyte function-associated antigen-1 differentially inhibit migration of T lymphocytes across microvascular retinal endothelial cells in rat. Immunology 88:471477.[CrossRef][Medline]
- Tool, A. T., F. P. Mul, E. F. Knol, A. J. Verhoeven, and D. Roos. 1996. The effect of salmeterol and nimesulide on chemotaxis and synthesis of PAF and LTC4 by human eosinophils. Eur. Respir. J. Suppl. 22:141s145s.[CrossRef][Medline]
- Palmer, D., K. Tsoi, and D. H. Maurice. 1998. Synergistic inhibition of vascular smooth muscle cell migration by phosphodiesterase 3 and phosphodiesterase 4 inhibitors. Circ. Res. 82:852861.[Abstract/Free Full Text]
- Alves, A. C., A. L. A. Pires, H. N. Cruz, M. F. Serra, B. L. Diaz, R. S. B. Cordeiro, V. Lagente, M. A. Martins, and P. M. R. e Silva. 1996. Selective inhibition of phosphodiesterase type IV suppresses the chemotactic responsiveness of rat eosinophils in vitro. Eur. J. Pharmacol. 312:8996.[CrossRef][Medline]
- Pross, C., M. M. Farooq, N. Angle, J. S. Lane, J. J. Cerveira, A. E. Xavier, J. A. Freischlag, R. E. Law, and H. A. Gelabert. 2002. Dexamethasone inhibits vascular smooth muscle cell migration via modulation of matrix metalloproteinase activity. J. Surg. Res. 102:5762.[CrossRef][Medline]
- Pross, C., M. M. Farooq, J. S. Lane, N. Angle, C. K. Tomono, A. E. Xavier, J. A. Freischlag, A. E. Collins, R. E. Law, and H. A. Gelabert. 2002. Rat and human aortic smooth muscle cells display differing migration and matrix metalloproteinase activities in response to dexamethasone. J. Vasc. Surg. 35:12531259.[CrossRef][Medline]
- Panettieri, R. A., Jr., R. K. Murray, L. R. DePalo, P. A. Yadvish, and M. I. Kotlikoff. 1989. A human airway smooth muscle cell line that retains physiological responsiveness. Am. J. Physiol. Cell Physiol. 256:C329C335.[Abstract/Free Full Text]
- Penn, R. B., R. M. Pascual, Y. Kim, S. J. Mundell, V. P. Krymskaya, R. A. Panettieri, Jr., and J. L. Benovic. 2001. Arrestin specificity for G protein-coupled receptors in human airway smooth muscle. J. Biol. Chem. 276:3264832656.[Abstract/Free Full Text]
- Orsini, M. J., V. P. Krymskaya, A. J. Eszterhas, J. L. Benovic, R. A. Panettieri, Jr., and R. B. Penn. 1999. MAPK superfamily activation in human airway smooth muscle: mitogenesis requires prolonged p42/p44 activation. Am. J. Physiol. Lung Cell. Mol. Physiol. 277:L479L488.[Abstract/Free Full Text]
- Murata, K., T. Sudo, M. Kameyama, H. Fukuoka, M. Muka, Y. Doki, Y. Sasaki, O. Ishikawa, Y. Kimura, and S. Imaoka. 2000. Cyclic AMP specific phosphodiesterase activity and colon cancer cell motility. Clin. Exp. Metastasis 18:599604.[CrossRef][Medline]
- Kohyama, T., X. Liu, F. Q. Wen, Y. K. Zhu, H. Wang, H. J. Kim, H. Takizawa, L. B. Cieslinski, M. S. Barnette, and S. I. Rennard. 2002. PDE4 inhibitors attenuate fibroblast chemotaxis and contraction of native collagen gels. Am. J. Respir. Cell Mol. Biol. 26:694701.[Abstract/Free Full Text]
- Fernandes, D., E. Guida, V. Koutsoubos, T. Harris, P. Vadiveloo, J. W. Wilson, and A. G. Stewart. 1999. Glucocorticoids inhibit proliferation, cyclin D1 expression, and retinoblastoma protein phosphorylation, but not activity of the extracellular-regulated kinases in human cultured airway smooth muscle. Am. J. Respir. Cell Mol. Biol. 21:7788.[Abstract/Free Full Text]
- Eickelberg, O., M. Roth, R. Lorx, V. Bruce, J. Rudiger, M. Johnson, and L.-H. Block. 1999. Ligand-independent activation of the glucocorticoid receptor by beta 2-adrenergic receptor agonists in primary human lung fibroblasts and vascular smooth muscle cells. J. Biol. Chem. 274:10051010.[Abstract/Free Full Text]
- Kalavantavanich, K., and C. M. Schramm. 2000. Dexamethasone potentiates high-affinity beta-agonist binding and Gsalpha protein expression in airway smooth muscle. Am. J. Physiol. Lung Cell. Mol. Physiol. 278:L1101L1106.[Abstract/Free Full Text]
- Pascual, R. M., C. K. Billington, I. P. Hall, R. A. Panettieri, Jr., J. E. Fish, S. P. Peters, and R. B. Penn. 2001. Mechanisms of cytokine effects on G protein-coupled receptor-mediated signaling in airway smooth muscle. Am. J. Physiol. Lung Cell. Mol. Physiol. 281:L1425L1435.[Abstract/Free Full Text]
- Underwood, D. C., J. K. Matthews, R. R. Osborn, S. Bochnowicz, and T. J. Torphy. 1997. The influence of endogenous catecholamines on the inhibitory effects of rolipram against early- and late-phase response to antigen in the guinea pig. J. Pharmacol. Exp. Ther. 280:210219.[Abstract/Free Full Text]
- Penn, R. B., and J. L. Benovic. 1998. Regulation of G protein-coupled receptors. In Handbook of Physiology. Vol. 1. P. M. Conn, editor. Oxford University Press, New York. 125164.
- Sun, J., X. X. Sui, J. A. Bradbury, D. C. Zeldin, M. S. Conte, and J. K. Liao. 2002. Inhibition of vascular smooth muscle cell migration by cytochrome P450 epoxygenase-derived eicosanoids. Circ. Res. 90:10201027.[Abstract/Free Full Text]
- Mukai, M., H. Nakamura, M. Tatsuta, T. Iwasaki, A. Togawa, F. Imamura, and H. Akedo. 2000. Hepatoma cell migration through a mesothelial cell monolayer is inhibited by cyclic AMP-elevating agents via a Rho-dependent pathway. FEBS Lett. 484:6973.[CrossRef][Medline]
- Kaufmann, R., U. Junker, K. Junker, K. Nuske, C. Ranke, M. Zieger, and J. Scheele. 2002. The serine proteinase thrombin promotes migration of human renal carcinoma cells by a PKA-dependent mechanism. Cancer Lett. 180:183190.[CrossRef][Medline]
- Spurzem, J. R., J. Gupta, T. Veys, K. R. Kneifl, S. I. Rennard, and T. A. Wyatt. 2002. Activation of protein kinase A accelerates bovine bronchial epithelial cell migration. Am. J. Physiol. Lung Cell. Mol. Physiol. 282:L1108L1116.[Abstract/Free Full Text]
- Goncharova, E. A., A. V. Vorotnikov, E. O. Gracheva, W. C. Albert, R. A. Panettieri, Jr., V. V. Stepanova, and V. A. Tkachuk. 2002. Activation of p38 MAP-kinase and caldesmon phosphorylation are essential for urokinase-induced human smooth muscle cell migration. Biol. Chem. 383:115126.[CrossRef][Medline]
- Dechert, M. A., J. M. Holder, and W. T. Gerthoffer. 2001. p21-activated kinase 1 participates in tracheal smooth muscle cell migration by signaling to p38 MAPK. Am. J. Physiol. Cell Physiol. 281:C123C132.[Abstract/Free Full Text]
- Yamboliev, I. A., and W. T. Gerthoffer. 2001. Modulatory role of ERK MAPK-caldesmon pathway in PDGF- stimulated migration of cultured pulmonary artery SMCs. Am. J. Physiol. Lung Cell. Mol. Physiol. 280:C1680C1688.
- Graf, K., X. P. Xi, D. Yang, E. Fleck, W. A. Hsueh, and R. E. Law. 1997. Mitogen-activated protein kinase activation is involved in platelet-derived growth factor-directed migration by vascular smooth muscle cells. J. Hypertension 29:334339.[CrossRef]
- Nelson, P. R., S. Yamamura, L. Mureebe, H. Itoh, and K. C. Kent. 1998. Smooth muscle cell migration and proliferation are mediated by distinct phases of activation of the intracellular messenger mitogen-activated protein kinase. J. Vasc. Surg. 27:117125.[CrossRef][Medline]
- Hinton, D. R., S. He, K. Graf, D. Yang, W. A. Hsueh, S. J. Ryan, and R. E. Law. 1998. Mitogen-activated protein kinase activation mediates PDGF-directed migration of RPE cells. Exp. Cell Res. 239:1115.[CrossRef][Medline]
- Shono, T., H. Kanetake, and S. Kanda. 2001. The role of mitogen-activated protein kinase activation within focal adhesions in chemotaxis toward FGF-2 by murine brain capillary endothelial cells. Exp. Cell Res. 264:275283.[CrossRef][Medline]
- Hafner, S., H. S. Adler, H. Mischak, P. Janosch, G. Heidecker, A. Wolfman, S. Pippig, M. Lohse, M. Ueffing, and W. Kolch. 1994. Mechanism of inhibition of Raf-1 by protein kinase A. Mol. Cell. Biol. 14:66966703.[Abstract/Free Full Text]
- January, B., A. Seibold, C. Allal, B. S. Whaley, B. J. Knoll, R. H. Moore, B. F. Dickey, R. Barber, and R. B. Clark. 1998. Salmeterol-induced desensitization, internalization and phosphorylation of the human beta2-adrenoceptor. Br. J. Pharmacol. 123:701711.[CrossRef][Medline]
- Yamada, K., M. Naito, T. Hayashi, K. Asai, N. Yoshimine, and A. Iguchi. 1993. Effects of dexamethasone on migration of human monocytes in response to oxidized beta-very low density lipoprotein. Artery 20:253267.[Medline]
- Brenner, R. E., D. Felger, C. Winter, A. Christiansen, D. Hofmann, and P. Bartmann. 2001. Effects of dexamethasone on proliferation, chemotaxis, collagen I, and fibronectin-metabolism of human fetal lung fibroblasts. Pediatr. Pulmonol. 32:17.[Medline]
- Koukouritaki, S., A. Gravanis, and C. Stournaras. 1999. Tyrosine phosphorylation of focal adhesion kinase and paxillin regulates the signaling mechanism of the rapid nongenomic action of dexamethasone on actin cytoskeleton. Mol. Med. 5:731742.[Medline]
- Duong, D. T., M. E. Waltner-Law, R. Sears, L. Sealy, and D. K. Granner. 2002. Insulin inhibits hepatocellular glucose production by utilizing liver-enriched transcriptional inhibitory protein to disrupt the association of CREB-binding protein and RNA polymerase II with the phosphoenolpyruvate carboxykinase gene promoter. J. Biol. Chem. 277:3223432242.[Abstract/Free Full Text]
- Singleton, J. R., B. L. Baker, and A. Thorburn. 2000. Dexamethasone inhibits insulin-like growth factor signaling and potentiates myoblast apoptosis. Endocrinology 141:29452950.[Abstract/Free Full Text]
- Pearlman, D. S., W. Stricker, S. Weinstein, G. Gross, P. Chervinsky, A. Woodring, B. Prillaman, and T. Shah. 1999. Inhaled salmeterol and fluticasone: a study comparing monotherapy and combination therapy in asthma. Ann. Allerg. Asthma Immunol. 82:257265.[Medline]
- Ammit, A. J., A. L. Lazaar, C. Irani, G. M. O'Neill, N. D. Gordon, Y. Amrani, R. B. Penn, and R. A. Panettieri, Jr. 2002. Tumor necrosis factor-
induced secretion of RANTES and interleukin-6 from human airway smooth muscle cells: modulation by glucocorticoids and ß-agonists. Am. J. Respir. Cell Mol. Biol. 26:465474.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
R. S. Sacks, A. L. Firth, C. V. Remillard, N. Agange, J. Yau, E. A. Ko, and J. X.-J. Yuan
Thrombin-mediated increases in cytosolic [Ca2+] involve different mechanisms in human pulmonary artery smooth muscle and endothelial cells
Am J Physiol Lung Cell Mol Physiol,
December 1, 2008;
295(6):
L1048 - L1055.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Nair, K. Radford, A. Fanat, L. J. Janssen, M. Peters-Golden, and P. G. Cox
The Effects of Leptin on Airway Smooth Muscle Responses
Am. J. Respir. Cell Mol. Biol.,
October 1, 2008;
39(4):
475 - 481.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. K. Bentley and M. B. Hershenson
Airway Smooth Muscle Growth in Asthma: Proliferation, Hypertrophy, and Migration
Proceedings of the ATS,
January 1, 2008;
5(1):
89 - 96.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. T. Gerthoffer
Migration of Airway Smooth Muscle Cells
Proceedings of the ATS,
January 1, 2008;
5(1):
97 - 105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. R Walker
Glucocorticoids and Cardiovascular Disease
Eur. J. Endocrinol.,
November 1, 2007;
157(5):
545 - 559.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. H. Walters, D. W. Reid, D. P. Johns, and C. Ward
Nonpharmacological and pharmacological interventions to prevent or reduce airway remodelling
Eur. Respir. J.,
September 1, 2007;
30(3):
574 - 588.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Parameswaran, K. Radford, A. Fanat, J. Stephen, C. Bonnans, B. D. Levy, L. J. Janssen, and P. G. Cox
Modulation of Human Airway Smooth Muscle Migration by Lipid Mediators and Th-2 Cytokines
Am. J. Respir. Cell Mol. Biol.,
August 1, 2007;
37(2):
240 - 247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hirakawa, Y. Karashima, M. Watanabe, C. Kimura, Y. Ito, and M. Oike
Protein Kinase A Inhibits Lysophosphatidic Acid-Induced Migration of Airway Smooth Muscle Cells
J. Pharmacol. Exp. Ther.,
June 1, 2007;
321(3):
1102 - 1108.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Osawa, P. D. Yim, D. Xu, R. A. Panettieri, and C. W. Emala
Raf-1 kinase mediates adenylyl cyclase sensitization by TNF-{alpha} in human airway smooth muscle cells
Am J Physiol Lung Cell Mol Physiol,
June 1, 2007;
292(6):
L1414 - L1421.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Jalvy, M.-A. Renault, L. Lam Shang Leen, I. Belloc, A. Reynaud, A.-P. Gadeau, and C. Desgranges
CREB Mediates UTP-Directed Arterial Smooth Muscle Cell Migration and Expression of the Chemotactic Protein Osteopontin via Its Interaction with Activator Protein-1 Sites
Circ. Res.,
May 11, 2007;
100(9):
1292 - 1299.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. An, T. R. Bai, J. H. T. Bates, J. L. Black, R. H. Brown, V. Brusasco, P. Chitano, L. Deng, M. Dowell, D. H. Eidelman, et al.
Airway smooth muscle dynamics: a common pathway of airway obstruction in asthma
Eur. Respir. J.,
May 1, 2007;
29(5):
834 - 860.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Zhang, H. H. Patel, F. Murray, C. V. Remillard, C. Schach, P. A. Thistlethwaite, Paul. A. Insel, and J. X.-J. Yuan
Pulmonary artery smooth muscle cells from normal subjects and IPAH patients show divergent cAMP-mediated effects on TRPC expression and capacitative Ca2+ entry
Am J Physiol Lung Cell Mol Physiol,
May 1, 2007;
292(5):
L1202 - L1210.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. Goncharova, D. A. Goncharov, P. N. Lim, D. Noonan, and V. P. Krymskaya
Modulation of Cell Migration and Invasiveness by Tumor Suppressor TSC2 in Lymphangioleiomyomatosis
Am. J. Respir. Cell Mol. Biol.,
April 1, 2006;
34(4):
473 - 480.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. F. Chung
The Role of Airway Smooth Muscle in the Pathogenesis of Airway Wall Remodeling in Chronic Obstructive Pulmonary Disease
Proceedings of the ATS,
November 1, 2005;
2(4):
347 - 354.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. F. Chung
Evaluation of Selective Prostaglandin E2 (PGE2) Receptor Agonists as Therapeutic Agents for the Treatment of Asthma
Sci. Signal.,
September 27, 2005;
2005(303):
pe47 - pe47.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Joubert, S. Lajoie-Kadoch, I. Labonte, A. S. Gounni, K. Maghni, V. Wellemans, J. Chakir, M. Laviolette, Q. Hamid, and B. Lamkhioued
CCR3 Expression and Function in Asthmatic Airway Smooth Muscle Cells
J. Immunol.,
August 15, 2005;
175(4):
2702 - 2708.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Naik, C. K. Billington, R. M. Pascual, D. A. Deshpande, F. P. Stefano, T. A. Kohout, D. M. Eckman, J. L. Benovic, and R. B. Penn
Regulation of Cysteinyl Leukotriene Type 1 Receptor Internalization and Signaling
J. Biol. Chem.,
March 11, 2005;
280(10):
8722 - 8732.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Bulin, U. Albrecht, J.G. Bode, A.-A. Weber, K. Schror, B. Levkau, and J.W. Fischer
Differential Effects of Vasodilatory Prostaglandins on Focal Adhesions, Cytoskeletal Architecture, and Migration in Human Aortic Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol.,
January 1, 2005;
25(1):
84 - 89.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A.G. Stewart
Emigration and immigration of mesenchymal cells: a multicultural airway wall
Eur. Respir. J.,
October 1, 2004;
24(4):
515 - 517.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Parameswaran, K. Radford, J. Zuo, L.J. Janssen, P.M. O'Byrne, and P.G. Cox
Extracellular matrix regulates human airway smooth muscle cell migration
Eur. Respir. J.,
October 1, 2004;
24(4):
545 - 551.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Madison
Migration of Airway Smooth Muscle Cells
Am. J. Respir. Cell Mol. Biol.,
July 1, 2003;
29(1):
8 - 11.
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 American Thoracic Society.
|