help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published ahead of print on April 3, 2003, doi:10.1165/rcmb.2003-0029OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-0029OCv1
29/3/375    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chung, M. P.
Right arrow Articles by Hunninghake, G. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chung, M. P.
Right arrow Articles by Hunninghake, G. W.
American Journal of Respiratory Cell and Molecular Biology. Vol. 29, pp. 375-380, 2003
© 2003 American Thoracic Society
DOI: 10.1165/rcmb.2003-0029OC

Role of Repeated Lung Injury and Genetic Background in Bleomycin-Induced Fibrosis

Man Pyo Chung, Martha M. Monick, Nabeel Y. Hamzeh, Noah S. Butler, Linda S. Powers and Gary W. Hunninghake

Division of Pulmonary and Critical Care Medicine, Department of Medicine, Samsung Medical Center, Sungkyunkwan University, Seoul, South Korea; and Division of Pulmonary, Critical Care and Occupational Medicine, Department of Internal Medicine, Roy J. and Lucille A. Carver College of Medicine, University of Iowa and Veterans Administration Medical Center, Iowa City, Iowa

Address correspondence to: Gary W. Hunninghake, M.D., Division of Pulmonary, Critical Care, and Occupational Medicine, Department of Internal Medicine, University of Iowa, Roy J. and Lucille A. Carver College of Medicine, 200 Hawkins Drive, C33-GH, Iowa City, Iowa 52242. E-mail: gary-hunninghake{at}uiowa.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Current hypotheses of the pathogenesis of many forms of pulmonary fibrosis suggest that (i) a stimulus results in repeated or prolonged episodes of lung injury, and (ii) genetic factors modulate the outcome of the injury. The commonly employed single-exposure bleomycin model results in only temporary fibrosis. Therefore, we evaluated whether repeated bleomycin exposures, in the setting of a genetic background more likely to develop a T helper 2 (Th2) response, would induce prolonged fibrosis. Lung fibrosis was induced by intratracheal bleomycin injection, either as a single exposure or as three consecutive exposures. We found that bleomycin induced a Th2-like environment in both Th1-biased C57BL/6J and Th2-biased DBA/2 mice. We also found histologic changes and collagen increases consistent with lung injury/fibrosis at early time points, but prolonged fibrosis only after multiple exposures in the Th2-biased DBA/2 mice. We also determined if impaired healing of bleomycin-induced injury would prolong fibrosis in the C57BL/6J mice. Endothelial nitric oxide (which protects endothelial cells from oxidant-induced injury) synthase knockout animals on a C57BL/6J background also had prolonged fibrosis, similar to DBA/2 mice, after multiple bleomycin exposures. This was specific to eNOS, as inducible nitric oxide synthase knockout animals cleared the fibrosis as effectively as wild-type C57BL/6J mice. This data indicate that healing of injury/fibrosis after bleomycin is complex and can be determined by a number of genetic and environmental factors.

Abbreviations: endothelial nitric oxide synthase, eNOS • interferon-gamma, IFN-{gamma} • interleukin, IL • inducible nitric oxide synthase, iNOS, T helper, Th


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animal models are widely used to investigate the pathogenesis of lung fibrosis and to evaluate therapeutic efficacy of experimental agents (1). In these models, bleomycin is usually administered in a high dose by a single intratracheal injection (2, 3). Fibrosis induced with a single intratracheal instillation of bleomycin is associated with an increase in collagen deposition between 2 and 3 wk after treatment, which resolves by 4–6 wk (4). The time-dependent improvement in bleomycin models of lung fibrosis is inconsistent with many forms of pulmonary fibrosis in humans, which do not improve over time (58). Detailed studies on the relationship between repeated episodes of lung injury and development of lung fibrosis are very limited. Brown and coworkers developed a rat model of progressive lung fibrosis induced by three or more intratracheal instillations of bleomycin (9). Whereas regression of lung inflammation/fibrosis was observed with time following a single dose or two doses of bleomycin, with three or more doses there was a continual increase in lung lesion extent and severity. In a hamster model, Zia and colleagues reported that chronic lung fibrosis was achieved by three consecutive weekly doses of bleomycin.

It is known that several interacting factors, including genetic susceptibility, superimposed environmental insults, and the types of inflammatory response (T helper [Th]1 or Th2) can modify the fibrotic response (8). Tissue fibrosis is often associated with Th2-predominant inflammatory responses, as demonstrated in hepatic fibrosis (10) and asthma (11). In animal models, the pattern of cytokines (Th1 versus Th2) produced during an inflammatory response can be related to mouse strain; for example, C57BL/6J mice preferentially express Th1 cytokines (interferon [IFN]-{gamma} and interleukin [IL]-12), and BALB/c and DBA/2 mice preferentially to express Th2 cytokines (IL-4, IL-5, IL-13) in response to infectious agents such as Leishmania major (12). Interestingly, Th1-biased C57BL/6J mice are most often used to evaluate bleomycin-induced lung fibrosis (2). However, the bleomycin-induced fibrosis in C57BL/6J animals is quickly resolved (4). This suggests the need for an experimental model that more closely mimics the prolonged fibrosis characteristic of human disease.

Based on these observations, the present study was undertaken to determine if repeated lung injury and a Th2 environment or alterations in nitric oxide production (which is an important protective mechanism for endothelial cells in the setting of oxidant-induced lung injury) interact to produce persistent lung fibrosis. To test this hypothesis, Th2-biased DBA/2 mice, Th1-biased C57BL/6J mice, and Th1-biased C57BL/6J mice with either endothelial nitric oxide synthase (eNOS) or inducible nitric oxide synthase (iNOS) knocked out, received single or multiple (three weekly doses) intratracheal injections of bleomycin. We used this model to evaluate cytokine mRNA production, histologic changes, and collagen production.

We found that bleomycin in both DBA/2 and C57BL/6J models induced the Th2 cytokine, IL-13, and decreased the Th1 cytokine, IFN-{gamma}. When we examined histology and collagen changes, we found prolonged fibrosis in Th2-biased DBA/2 animals after multiple bleomycin exposures. This did not occur in the C57BL/6J animals with single or multiple exposures, or in the DBA/2 animals after a single exposure. Because the C57BL/6J animals resolved the fibrosis in both single and multiple bleomycin models, we next asked if we could interfere with the repair process. We examined the effect of knocking out either iNOS or eNOS (which is known to protect endothelial cells from oxidant-mediated injury) on the ability of C57BL/6J animals to resolve bleomycin-induced fibrosis. We found that lack of eNOS (and not iNOS) resulted in prolonged fibrosis after repeated injections of bleomycin. As a composite, these data show that in a Th2-biased animal, repeated bleomycin injections lead to prolonged fibrosis. In contrast, in a Th1-biased animal, prolonged fibrosis occurs only in the setting of an altered ability to repair injury.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and Treatment
Seven- to eight-week-old pathogen-free female C57BL/6J, DBA/2, and C57BL/6J animals lacking either the eNOS or iNOS gene (eNOS-/- or iNOS-/-) mice were purchased from The Jackson Laboratory (Bar Harbor, ME). Under ketamine anesthesia, bleomycin (Blenoxane; Bristol-Meyers Oncology, Princeton, NJ) or saline was given to mice either by single intratracheal instillation (3 U/kg) (single) or by three weekly intratracheal instillations (1 U/kg per dose, total 3 U/kg) (multiple) (Figure 1). In preliminary studies, we determined that a total 3 U/kg of bleomycin given as either a single injection or three weekly injections was adequate to induce lung fibrosis of a moderate degree with minimal mortality. Higher doses of bleomycin resulted in significant mortality. At 3 and 6 wk after the last bleomycin dose, mice were killed by pentobarbital overdose (~ 250 mg/kg) to harvest the lung for the evaluation of mRNA, collagen, and histology.



View larger version (8K):
[in this window]
[in a new window]
 
Figure 1. Mice were treated with one of two treatment protocols (single or multiple). Control animals received saline at identical time points.

 
Measurement of Collagen Content of the Lung
Collagen content of the lung was determined by assaying soluble collagen using the Sircol Collagen Assay kit (Biocolor, Belfast, Northern Ireland), according to the manufacturer's instructions.

Histology
At the time of killing, perfusion of the lungs through the right ventricle of the heart was done to remove the blood in the pulmonary circulation. The right lung was inflated with 2% paraformaldehyde through trachea at a pressure of 25 cm H2O for 5 min. Lungs were fixed, embedded in paraffin, sectioned, and stained with hematoxylin and eosin (H&E) and Masson's trichrome. For histologic evaluation of the lungs, four midlung vertical sections per lung were examined.

Isolation of Total RNA from the Lung
The whole lungs were snap-frozen in liquid nitrogen and stored at –70°C until processed later. Total lung RNA was isolated with RNA STAT-60 reagent (TEL-TEST, Friendswood, TX) following the manufacturer's instructions.

Reverse Transcription and Real-Time Polymerase Chain Reaction
Two micrograms of total RNA was reverse transcribed to complementary DNA (cDNA) using RETROscript reverse transcription (RT)-polymerase chain reaction (PCR) Kit (Ambion, Austin, TX) according to the manufacturer's instructions. The resulting cDNA was subjected to PCR as previously described (13). Specific primer sets used for murine cytokine mRNAs and housekeeping genes were as follows (5' to 3'): IL-13 sense, ACAGCTCCCTGGTTCTCTCA; IL-13 antisense, CCCCCATTCACTACACATCA; IFN-{gamma} sense, CGCTACACACTGCATCTTGG; IFN-{gamma} anti-sense, TGAGCTCATTGAATGCTTGG; HPRT sense, CCTCATGGACTGATTATGGAC; HPRT antisense, CAGATTCAACTTGCGCTCATC. IL-13 is used as a representative Th2 cytokine, and IFN-{gamma} mRNA was used as a representative Th1 cytokine. HPRT mRNA was evaluated as a housekeeping gene.

Relative Quantitative Gene Expression
Relative quantitative gene expression was calculated as previously described (13, 14). Briefly, Threshold Cycles (Ct) for reactions amplifying a gene of interest and a housekeeping gene were determined. The gene of interest was first normalized to the housekeeping gene and then untreated controls compared with the bleomycin-treated samples. Validity of this approach was confirmed by using serial 10-fold dilutions of template for all amplimers examined in this study. Using the 10-fold dilutions, the amplification efficiencies for each gene of interest and housekeeping amplimers were found to be identical.

Statistical Analysis
All data were expressed as means ± SEM. Differences between various groups were assessed for statistical significance with the nonparametric Kruskal-Wallis test followed by post hoc comparisons by the Mann-Whitney U test. P value less than 0.05 was considered to indicate statistical significance.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bleomycin Induces a Decrease in IFN-{gamma} mRNA and an Increase in IL-13 mRNA that Is Species-Independent
To examine the effect of bleomycin on a Th2 cytokine, IL-13, we evaluated lung mRNA levels 3 and 6 wk after exposure. We found an increase in IL-13 mRNA after both treatment models (single and multiple intratracheal injection) in both C57BL/6J and DBA/2 mice (Figure 2A). The amount of IL-13 mRNA in the DBA/2 animals was greater at the 6 wk time point, but the difference was not statistically significant. To examine the effect of bleomycin on a Th1 cytokine, we measured IFN-{gamma} mRNA levels 3 and 6 wk after exposure. Overall, IFN-{gamma} mRNA decreased in both single and multiple intratracheal bleomycin-treated C57BL/6J and DBA/2 mice (Figure 2B). The decreases in IFN-{gamma} induced by bleomycin were greater in the DBA/2 mice compared with the C57BL/6J mice; however, there was not a significant strain difference. These studies suggest that bleomycin increases IL-13 mRNA and that multiple bleomycin injections result in a prolonged increase in IL-13 mRNA in both mice species. As a composite, the mRNA studies support a Th2 link to bleomycin-induced fibrosis.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 2. Bleomycin induces IL-13 mRNA (A) and decreases IFN-{gamma} mRNA (B). RNA was analyzed by quantitative Realtime RT-PCR for IFN-{gamma} and IL-13 mRNA expression in the lung after single and repeated bleomycin injury. Each bar represents the mean ± SE of a minimum of four mice.

 
Both Single and Multiple Bleomycin Exposures Result in First the Development and then the Resolution of Fibrosis in Th1-Biased C57BL/6J Animals
Consistent with previous reports, interstitial inflammation and fibrosis were observed in C57BL/6J mice 3 wk after a single intratracheal injection of bleomycin (Figure 3A). Histologic abnormalities of the lung included increased interstitial wall thickness, interstitial mononuclear cell infiltrates, increased number of fibroblasts, and interstitial collagen deposition with distortion of normal lung architecture. These histologic changes, however, were markedly decreased in extent and severity when evaluated at the 6 wk time point. At this time point, histologic findings in C57BL/6J mice looked almost normal. After multiple bleomycin injections, the evolution of lung fibrosis in C57BL/6J showed the same pattern as with a single bleomycin injection; lung inflammation/fibrosis developed at the 3 wk time point but returned to baseline levels at 6 wk after the last dose of bleomycin. To confirm the histologic data, we measured collagen production in the various groups. We found that collagen levels increased 3 wk after both single and multiple bleomycin exposures (Figure 3B). By 6 wk in both treatment regiments, collagen levels had returned to baseline. These studies suggest that in a Th1-biased animal (C57BL/6J), neither a single nor multiple exposure model resulted in prolonged fibrosis.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 3. Th1-biased C57BL/6J animals resolve bleomycin-induced fibrosis after both single and multiple exposures. C57BL/6J mice were treated with either single or multiple bleomycin exposures (Figure 1). Lungs were harvested at 3 and 6 wk and analyzed for histologic changes (H&E stain) (A) or collagen content (B). Collagen in the bleomycin-exposed animals is expressed relative to the collagen content of control animals not exposed to bleomycin. All figures are at original magnification x100. P < 0.05. B: open bars, single bleomycin exposure; shaded bars, multiple bleomycin exposure.

 
Multiple, but Not Single, Bleomycin Exposures Result in the Development of Prolonged Lung Fibrosis in Th2-Biased DBA/2 Animals
Because Th2-biased BALB/c mice have high levels of bleomycin hydrolase and are resistant to the effects of bleomycin, we used another known Th2-biased mouse (DBA/2) for these studies (1517). In our preliminary studies, we found that lungs of DBA mice could be injured after exposure to bleomycin. In a recent study, we have demonstrated that DBA/2 mice produce significantly more of the Th2 cytokines IL-4 and IL-13 after inflammatory stimuli than do the Th1-biased C57BL/6J mice (15). This confirms other work supporting the Th2 bias of DBA/2 mice. When we treated DBA/2 mice with a single bleomycin injection, lung inflammation/fibrosis developed at 3 wk, and like the C57BL/6J mice, the fibrosis resolved at 6 wk. In contrast, with multiple bleomycin injections, lung inflammation/fibrosis persisted 6 wk after the last bleomycin injection (Figure 4A). There was also evidence of alveolar collapse and early remodeling of the lung. The prolonged fibrosis continued for at least 9 wk (data not shown). To confirm the histologic data, we measured collagen production in the various groups. We found that collagen levels increased 3 wk after both single and multiple bleomycin exposures (Figure 4B). By 6 wk in the single treatment option, collagen levels had returned to baseline. However, consistent with the histologic changes, the multiple bleomycin option resulted in a continued increased collagen at the 6 wk time point in the DBA/2 mice. These data suggest that with multiple exposures the Th2-biased DBA/2 mice develop prolonged fibrosis compared with transient fibrosis developed by the Th1-biased C57BL/6J mice.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 4. Th2-biased DBA/2 animals demonstrate prolonged bleomycin-induced fibrosis after multiple exposures. The fibrosis resolved after a single bleomycin exposure. DBA/2 mice were treated with either single or multiple bleomycin exposures (Figure 1). Lungs were harvested at 3 and 6 wk and analyzed for histologic changes (H&E stain) (A) or collagen content (B). Collagen in the bleomycin-exposed animals is expressed relative to the collagen content of control animals not exposed to bleomycin. All figures are at original magnification x100. P < 0.05. B: open bars, single bleomycin exposure; shaded bars, multiple bleomycin exposure.

 
eNOS Is Required for Repair of Fibrotic Lung Changes in Th1-Biased C57BL/6J Mice Treated with Multiple Bleomycin Exposures
To investigate the effect of nitric oxide on the repair of bleomycin-induced fibrosis that occurs in C57BL/6J animals, we treated wild-type littermate C57BL/6J mice, eNOS-/- and iNOS-/- with both bleomycin treatment models. We found that both the wild-type and iNOS-/- mice cleared the fibrosis after both single and multiple bleomycin exposures (Figure 5). In contrast, in the eNOS-/- animals, multiple bleomycin exposures resulted in a nonresolving fibrosis that looked identical to our findings with the Th2-biased DBA/2 mice. This data suggests that an active repair process in the C57BL/6J animals leads to the resolution of fibrosis. Furthermore, this data as a composite demonstrates potential animal models that more closely mimic the prolonged fibrosis characteristic of human disease.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 5. Mice with a C57BL/6J background and eNOS knocked out demonstrate prolonged bleomycin-induced fibrosis after multiple exposures. C57BL/6J, eNOS-/-, and iNOS-/- were exposed to multiple bleomycin exposures. Lungs were harvested at 3 and 6 wk and collagen measured. *P < 0.05.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this report, we demonstrate that persistent lung fibrosis in mice can be caused by repeated episodes of bleomycin-induced lung injury but not by a single episode of lung injury. We initially examined the effect of bleomycin in a Th1-biased mouse (C57BL/6J) and a Th2-biased mouse (DBA/2) by evaluating the effect of bleomycin on production of a Th1 (IFN-{gamma}) and a Th2 (IL-13) cytokine. We found that bleomycin increased IL-13 mRNA and decreased IFN-{gamma} mRNA, suggesting that bleomycin triggers a Th2 environment in both animals. Reports in other species suggest that repeated doses of bleomycin can induce persistent lung fibrosis (4, 9). To investigate the role of repeated exposures in a murine model, we injected three equally divided doses or a single dose (equal to the sum of the multiple injections) of bleomycin. When we examined the effect of either single or multiple bleomycin exposures on fibrosis (histology) and collagen production, we found that 3 wk after bleomycin both mice had increased fibrosis. In the C57BL/6J mouse with either single or multiple exposures, and in the DBA/2 mouse after a single exposure, the fibrosis had completely resolved by 6 wk. In contrast, in the Th2-biased DBA/2 mouse, multiple exposures resulted in prolonged fibrosis. These studies clearly show that the type of injury and the genetic background of the mice are both important in the generation of prolonged lung fibrosis.

IFN-{gamma}, a Th1 cytokine, has profound suppressive effects on the production of extracellular matrix proteins such as collagen and fibronectin (18). It also downregulates the expression of transforming growth factor ß1, a mediator strongly implicated in fibroblast proliferation and collagen deposition (19). Furthermore, IFN-{gamma} may suppress established Th2-type inflammatory responses. This data is consistent with our finding that bleomycin (a profibrotic event) decreases baseline levels of IFN-{gamma} production in mice. IL-13, a Th2 cytokine, is produced by Th2 cells (20, 21). It shares several structural characteristics and many functional activities with IL-4 (22). Similar to IL-4, IL-13 inhibits the production of inflammatory cytokines and upregulates collagen production by fibroblasts (23). However, unlike IL-4, the generation of IL-13 is prolonged after cellular activation, and the amount of IL-13 produced is more than 10-fold that of IL-4 (20, 24). For this reason, IL-4–induced collagen production is more transient than that induced by IL-13. A recent report by Chiaramonte and coworkers suggested that IL-13, not IL-4, is the major Th2-type cytokine driving type I and type III collagen mRNA production in hepatic fibrosis (25). IL-13 has also been shown in other studies to be involved in the pathogenesis of various fibrotic disorders such as hepatic fibrosis (10, 25), progressive systemic sclerosis (26), and pulmonary fibrosis (27, 28). In looking at IL-13 mRNA levels after bleomycin, we found increased (though not statistically significant) levels in DBA/2 mice with multiple exposure–induced fibrosis. It should be noted, however, that bleomycin induced similar changes in IFN-{gamma} and IL-13 in the two strains of mice. Therefore, the study presents no direct evidence that Th1/Th2 balance determines the progression of fibrosis following bleomycin. Although we did not directly measure IFN-{gamma} and IL-13 protein in these studies, it is highly likely that the protein levels mimicked changes in the mRNA. In this regard, we previously showed that there is a close correlation between IFN-{gamma} and IL-13 protein levels and mRNA in C57BL/6J and DBA/2 mice (15)

We also determined if the phenotype of the C57BL/6J mice could be altered in a manner that would allow prolonged expression of pulmonary fibrosis after bleomycin exposure. We hypothesized that C57BL/6J mice were more efficient at healing bleomycin-induced fibrosis, compared with the DBA/2 mice. Although bleomycin exposure injures multiple cell types in the lung, it is known to injure the lung endothelium. In other models of tissue injury, eNOS is critical for protection and repair of the vascular endothelium (29, 30). Therefore, we evaluated whether C57BL/6J mice with a knockout of eNOS would have impaired healing after bleomycin exposure and prolonged fibrosis. As a second control for these studies, we also evaluated C57BL/6J mice with a knockout of iNOS. We found that C57BL/6J mice with a knockout of eNOS, but not iNOS, developed prolonged fibrosis, like the DBA/2 mice after multiple exposures to bleomycin. These observations suggest that one critical factor for the resolution of bleomycin-induced injury is repair of the injury to lung endothelium.

Overall, our studies show that the conditions necessary to develop persistent lung fibrosis may be complex. They suggest that repeated episodes of injury are required, and that there are complex genetic factors and the ability to protect or repair lung endothelium that determine the development of persistent lung fibrosis.


    Acknowledgments
 
This study was supported in part by a VA Merit Review grant, NIH: HL-60316 and NIH: ES-09607, EPA: R826711.

Received in original form January 27, 2003

Received in final form March 4, 2003


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Chandler, D. B., D. M. Hyde, and S. N. Giri. 1983. Morphometric estimates of infiltrative cellular changes during the development of bleomycin-induced pulmonary fibrosis in hamsters. Am. J. Pathol. 112:170–177.[Abstract]
  2. Schrier, D. J., R. G. Kunkel, and S. H. Phan. 1983. The role of strain variation in murine bleomycin-induced pulmonary fibrosis. Am. Rev. Respir. Dis. 127:63–66.[Medline]
  3. Davis, D. W., D. A. Weidner, A. Holian, and D. J. McConkey. 2000. Nitric oxide-dependent activation of p53 suppresses bleomycin-induced apoptosis in the lung. J. Exp. Med. 192:857–869.[Abstract/Free Full Text]
  4. Zia, S., D. M. Hyde, and S. N. Giri. 1992. Development of a bleomycin hamster model of subchronic lung fibrosis. Pathology 24:155–163.[Medline]
  5. Mason, R. J., M. I. Schwarz, G. W. Hunninghake, and R. A. Musson. 1999. NHLBI Workshop Summary. Pharmacological therapy for idiopathic pulmonary fibrosis: past, present, and future. Am. J. Respir. Crit. Care Med. 160:1771–1777.[Free Full Text]
  6. Katzenstein, A. L., and J. L. Myers. 1998. Idiopathic pulmonary fibrosis: clinical relevance of pathologic classification. Am. J. Respir. Crit. Care Med. 157:1301–1315.[Free Full Text]
  7. American Thoracic Society. 2000. Idiopathic pulmonary fibrosis: diagnosis and treatment. International consensus statement. American Thoracic Society (ATS), and the European Respiratory Society (ERS). Am. J. Respir. Crit. Care Med. 161:646–664.[Free Full Text]
  8. Gross, T. J., and G. W. Hunninghake. 2001. Idiopathic pulmonary fibrosis. N. Engl. J. Med. 345:517–525.[Free Full Text]
  9. Brown, R. F., R. B. Drawbaugh, and T. C. Marrs. 1988. An investigation of possible models for the production of progressive pulmonary fibrosis in the rat: the effects of repeated intratracheal instillation of bleomycin. Toxicology 51:101–110.[CrossRef][Medline]
  10. Fallon, P. G., E. J. Richardson, G. J. McKenzie, and A. N. McKenzie. 2000. Schistosome infection of transgenic mice defines distinct and contrasting pathogenic roles for IL-4 and IL-13: IL-13 is a profibrotic agent. J. Immunol. 164:2585–2591.[Abstract/Free Full Text]
  11. Ray, A., and L. Cohn. 1999. Th2 cells and GATA-3 in asthma: new insights into the regulation of airway inflammation. J. Clin. Invest. 104:985–993.[Medline]
  12. Scott, P., P. Natovitz, R. L. Coffman, E. Pearce, and A. Sher. 1988. Immunoregulation of cutaneous leishmaniasis. T cell lines that transfer protective immunity or exacerbation belong to different T helper subsets and respond to distinct parasite antigens. J. Exp. Med. 168:1675–1684.[Abstract/Free Full Text]
  13. Monick, M. M., P. K. Robeff, N. S. Butler, D. M. Flaherty, A. B. Carter, M. W. Peterson, and G. W. Hunninghake. 2002. Phosphatidylinositol 3-kinase activity negatively regulates stability of cyclooxygenase 2 mRNA. J. Biol. Chem. 277:32992–33000.[Abstract/Free Full Text]
  14. Monick, M. M., L. Powers, N. Butler, T. Yarovinsky, and G. W. Hunninghake. 2002. Interaction of matrix with integrin receptors is required for optimal LPS-induced MAP kinase activation. Am. J. Physiol. Lung Cell. Mol. Physiol. 283:L390–L402.[Abstract/Free Full Text]
  15. Butler, N. S., M. M. Monick, T. O. Yarovinsky, L. S. Powers, and G. W. Hunninghake. 2002. Altered IL-4 mRNA stability correlates with Th1 and Th2 bias and susceptibility to hypersensitivity pneumonitis in two inbred strains of mice. J. Immunol. 169:3700–3709.[Abstract/Free Full Text]
  16. Filderman, A. E., and J. S. Lazo. 1991. Murine strain differences in pulmonary bleomycin metabolism. Biochem. Pharmacol. 42:195–198.[CrossRef][Medline]
  17. Schwartz, D. R., G. E. Homanics, D. G. Hoyt, E. Klein, J. Abernethy, and J. S. Lazo. 1999. The neutral cysteine protease bleomycin hydrolase is essential for epidermal integrity and bleomycin resistance. Proc. Natl. Acad. Sci. USA 96:4680–4685.[Abstract/Free Full Text]
  18. Duncan, M. R., and B. Berman. 1985. Gamma interferon is the lymphokine and beta interferon the monokine responsible for inhibition of fibroblast collagen production and late but not early fibroblast proliferation. J. Exp. Med. 162:516–527.[Abstract/Free Full Text]
  19. Lawrence, D. A. 1996. Transforming growth factor-beta: a general review. Eur. Cytokine Netw. 7:363–374.[Medline]
  20. de Vries, J. E. 1998. The role of IL-13 and its receptor in allergy and inflammatory responses. J. Allergy Clin. Immunol. 102:165–169.[CrossRef][Medline]
  21. Minty, A., S. Asselin, A. Bensussan, D. Shire, N. Vita, A. Vyakarnam, J. Wijdenes, P. Ferrara, and D. Caput. 1997. The related cytokines interleukin-13 and interleukin-4 are distinguished by differential production and differential effects on T lymphocytes. Eur. Cytokine Netw. 8:203–213.[Medline]
  22. Zurawski, G., and J. E. de Vries. 1994. Interleukin 13, an interleukin 4-like cytokine that acts on monocytes and B cells, but not on T cells. Immunol. Today 15:19–26.[CrossRef][Medline]
  23. Oriente, A., N. S. Fedarko, S. E. Pacocha, S. K. Huang, L. M. Lichtenstein, and D. M. Essayan. 2000. Interleukin-13 modulates collagen homeostasis in human skin and keloid fibroblasts. J. Pharmacol. Exp. Ther. 292:988–994.[Abstract/Free Full Text]
  24. Essayan, D. M., W. F. Han, X. M. Li, H. Q. Xiao, J. Kleine-Tebbe, and S. K. Huang. 1996. Clonal diversity of IL-4 and IL-13 expression in human allergen-specific T lymphocytes. J. Allergy Clin. Immunol. 98:1035–1044.[CrossRef][Medline]
  25. Chiaramonte, M. G., D. D. Donaldson, A. W. Cheever, and T. A. Wynn. 1999. An IL-13 inhibitor blocks the development of hepatic fibrosis during a T-helper type 2-dominated inflammatory response. J. Clin. Invest. 104:777–785.[Medline]
  26. Hasegawa, M., M. Fujimoto, K. Kikuchi, and K. Takehara. 1997. Elevated serum levels of interleukin 4 (IL-4), IL-10, and IL-13 in patients with systemic sclerosis. J. Rheumatol. 24:328–332.[Medline]
  27. Chiaramonte, M. G., L. R. Schopf, T. Y. Neben, A. W. Cheever, D. D. Donaldson, and T. A. Wynn. 1999. IL-13 is a key regulatory cytokine for Th2 cell-mediated pulmonary granuloma formation and IgE responses induced by Schistosoma mansoni eggs. J. Immunol. 162:920–930.[Abstract/Free Full Text]
  28. Hancock, A., L. Armstrong, R. Gama, and A. Millar. 1998. Production of interleukin 13 by alveolar macrophages from normal and fibrotic lung. Am. J. Respir. Cell Mol. Biol. 18:60–65.[Abstract/Free Full Text]
  29. Ozaki, M., S. Kawashima, T. Hirase, T. Yamashita, M. Namiki, N. Inoue, K. Hirata Ki, and M. Yokoyama. 2002. Overexpression of endothelial nitric oxide synthase in endothelial cells is protective against ischemia-reperfusion injury in mouse skeletal muscle. Am. J. Pathol. 160:1335–1344.[Abstract/Free Full Text]
  30. Hafezi-Moghadam, A., T. Simoncini, E. Yang, F. P. Limbourg, J. C. Plumier, M. C. Rebsamen, C. M. Hsieh, D. S. Chui, K. L. Thomas, A. J. Prorock, V. E. Laubach, M. A. Moskowitz, B. A. French, K. Ley, and J. K. Liao. 2002. Acute cardiovascular protective effects of corticosteroids are mediated by non-transcriptional activation of endothelial nitric oxide synthase. Nat. Med. 8:473–479.[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
H.-Z. Yang, B. Cui, H.-Z. Liu, Z.-R. Chen, H.-M. Yan, F. Hua, and Z.-W. Hu
Targeting TLR2 Attenuates Pulmonary Inflammation and Fibrosis by Reversion of Suppressive Immune Microenvironment
J. Immunol., January 1, 2009; 182(1): 692 - 702.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
A. Dooley, S. Y. Low, A. Holmes, A. G. Kidane, D. J. Abraham, C. M. Black, and K. R. Bruckdorfer
Nitric oxide synthase expression and activity in the tight-skin mouse model of fibrosis
Rheumatology, March 1, 2008; 47(3): 272 - 280.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Vyas-Read, P. W. Shaul, I. S. Yuhanna, and B. C. Willis
Nitric oxide attenuates epithelial-mesenchymal transition in alveolar epithelial cells
Am J Physiol Lung Cell Mol Physiol, July 1, 2007; 293(1): L212 - L221.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
K. Huang, W. Mitzner, R. Rabold, B. Schofield, H. Lee, S. Biswal, and C. G. Tankersley
Variation in senescent-dependent lung changes in inbred mouse strains
J Appl Physiol, April 1, 2007; 102(4): 1632 - 1639.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. Xu, A. L. Mora, J. LaVoy, K. L. Brigham, and M. Rojas
Increased bleomycin-induced lung injury in mice deficient in the transcription factor T-bet
Am J Physiol Lung Cell Mol Physiol, October 1, 2006; 291(4): L658 - L667.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
C K Haston, T G Tomko, N Godin, L Kerckhoff, and M T Hallett
Murine candidate bleomycin induced pulmonary fibrosis susceptibility genes identified by gene expression and sequence analysis of linkage regions
J. Med. Genet., June 1, 2005; 42(6): 464 - 473.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
T. Nakamura, K. Matsumoto, S. Mizuno, Y. Sawa, H. Matsuda, and T. Nakamura
Hepatocyte growth factor prevents tissue fibrosis, remodeling, and dysfunction in cardiomyopathic hamster hearts
Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2131 - H2139.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
N. Hattori, S. Mizuno, Y. Yoshida, K. Chin, M. Mishima, T. H. Sisson, R. H. Simon, T. Nakamura, and M. Miyake
The Plasminogen Activation System Reduces Fibrosis in the Lung by a Hepatocyte Growth Factor-Dependent Mechanism
Am. J. Pathol., March 1, 2004; 164(3): 1091 - 1098.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-0029OCv1
29/3/375    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chung, M. P.
Right arrow Articles by Hunninghake, G. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chung, M. P.
Right arrow Articles by Hunninghake, G. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2003 American Thoracic Society.