help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Published ahead of print on April 14, 2003, doi:10.1165/rcmb.2002-0138OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-0138OCv1
29/5/598    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ahrén, I. L.
Right arrow Articles by Riesbeck, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ahrén, I. L.
Right arrow Articles by Riesbeck, K.
American Journal of Respiratory Cell and Molecular Biology. Vol. 29, pp. 598-605, 2003
© 2003 American Thoracic Society
DOI: 10.1165/rcmb.2002-0138OC

Nontypeable Haemophilus influenzae Activates Human Eosinophils through ß-Glucan Receptors

Irini Lazou Ahrén, Emily Eriksson, Arne Egesten and Kristian Riesbeck

Department of Medical Microbiology, Malmö University Hospital, Lund University, Malmö, Sweden

Address correspondence to: Kristian Riesbeck, M.D., Ph.D., Department of Medical Microbiology, Malmö University Hospital, Lund University, SE-205 02 Malmö, Sweden. E-mail: kristian.riesbeck{at}mikrobiol.mas.lu.se


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Eosinophils are a characteristic component of the inflammatory response seen in several diseases, including allergic asthma and chronic obstructive pulmonary disease. After activation, eosinophil-derived products may exert proinflammatory effects and cause considerable tissue damage. In the present study, we investigated innate interactions between the respiratory tract pathogen nontypeable Haemophilus influenzae (NTHi) and human eosinophils. Bacterial binding to eosinophils was dependent on (1–3)-ß-D-glucan receptors, as deduced from blocking experiments using the soluble glucan derivatives laminarin and scleroglucan. In addition, expression of the ß-glucan receptor dectin-1 was shown in eosinophils by reverse transcriptase–polymerase chain reaction. Activation of the ß-glucan receptors by bacteria elicited a time- and dose-dependent respiratory burst in eosinophils. NTHi caused increased expression of the proinflammatory chemokine interleukin-8 as measured by reverse transcriptase–polymerase chain reaction and enzyme-linked immunosorbent assay. Incubation of eosinophils in the presence of NTHi for 4.5 h revealed upregulation of 245 different genes as detected by microarray. Signal transduction-related transcripts were most strongly upregulated, followed by cytokine mRNAs. Our findings suggest that NTHi can induce an innate inflammatory response in eosinophils that is mainly mediated via ß-glucan receptors. This points to possible pathophysiologic mechanisms involving innate recognition of NTHi by eosinophils during infection of the airways, thus promoting inflammation in chronic pulmonary disease.

Abbreviations: chronic obstructive pulmonary disease, COPD • 2,7-dichlorofluorescein diacetate, DCF • enzyme-linked immunosorbent assay, ELISA • fluorescein isothiocyanate, FITC • glyceraldehyde-3-phosphate dehydrogenase, G3PDH • interleukin, IL • multiplicity of infection, MOI • nontypeable Haemophilus influenzae, NTHi • platelet-activating factor, PAF • peripheral blood leukocytes, PBL • phosphate-buffered saline, PBS • reverse transcriptase–polymerase chain reaction, RT-PCR


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Eosinophils are involved in inflammatory responses and are associated with diseases such as chronic obstructive pulmonary disease (COPD) and allergic asthma (1, 2). Respiratory epithelial cells stimulated by tumor necrosis factor-{alpha} and interleukin (IL)-1{alpha} during inflammation produce eosinophil-specific chemoattractants, in particular eotaxin, which are important for the recruitment and activation of eosinophils (3). Once the eosinophils have migrated to inflamed tissue, several stimuli can activate the cells to release mediators. Such stimuli include complexed immunoglobulins, complement fragments, or cytokines. Consequently, the stimulated eosinophils can degranulate and secrete inflammatory mediators, resulting in severe tissue damage and promotion of inflammation (4, 5).

Nontypeable Haemophilus influenzae (NTHi) is a gram-negative human pathogen causing diseases in both the upper and lower respiratory tract. The binding and entry of NTHi into human epithelial cells and macrophages have been studied widely (6, 7). Furthermore, NTHi can activate human respiratory epithelial cells to an increased production of proinflammatory cytokines (8). Bacteria opsonized by immunoglobulins and complement fragments stimulate neutrophils to synthesize leukotriene B4 (9). Moreover, NTHi is responsible for triggering exacerbations in diseases such as asthma and COPD (10, 11).

Recently, we reported on the importance of (1–3)-ß-D-glucan specific receptors for the binding and subsequent entry of NTHi into epithelial and monocytic cells (12). The complement receptor type 3 (CR3; CD11b/CD18), which belongs to the family of ß2-integrins, is the most well characterized ß-glucan receptor (13). CR3 has a ß-glucan–binding site within its {alpha}-chain subunit (CD11b) of the heterodimeric protein. The presence of at least two ß-glucan receptors other than CR3 was initially suggested to exist on primary monocytes and the monocytic cell line U-937 (14–16). Interestingly, recent reports have revealed that the type II transmembrane receptor dectin-1 is the main ß-glucan receptor on macrophages (17, 18). Although several dectin-1 isoforms exist (19, 20), the two isoforms designated A and B are the main functional receptors for zymosan as determined by transfection experiments (17). Binding of a ß-glucan ligand to the surface of monocytes has been shown to result in nuclear factor-{kappa}B activation, IL-6 mRNA expression, and internalization of the ligand (16). In parallel, ß-glucan receptors can induce leukotriene C4 generation in eosinophils after stimulation by nonopsonized zymosan particles (21).

In contrast to NTHi-dependent activation of epithelial cells and monocytic cell lineages, there is no information available on the innate interaction between NTHi and eosinophils. The aim of the present study was to examine a possible innate recognition of NTHi by eosinophils. We demonstrate that binding of NTHi and subsequent stimulation of the respiratory burst in eosinophils are ß-D-glucan–dependent events, and that eosinophils express mRNAs for several dectin-1 isoforms, including the A and B isoforms. Finally, NTHi significantly increased IL-8 expression by eosinophils, and microarray analysis of 847 transcripts showed upregulation of 245 mRNAs including signal transduction–related molecules and proinflammatory mediators.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents
Fluorescein isothiocyanate (FITC), 2,7-dichlorofluorescein diacetate (DCF), mannan, laminarin, and methyl glucoside (methyl ß-D glucopyranoside) were purchased from Sigma (St. Louis, MO). Scleroglucan was kindly provided by Dr. David Williams (Department of Surgery and Immunopharmacology Research Group, James H. Quillen College of Medicine, East Tennessee State University, Johnson City). The platelet-activating factor (PAF)-receptor antagonist WEB2170 was from Boehringer Ingelheim (Ingelheim, Germany), and L659989 was kindly provided by Merck, Sharp, and Dohme (Sollentuna, Sweden). The monoclonal antibody against the human mannose receptor (clone 15–2) was from Hbt (Uden, The Netherlands). Mannan and laminarin were dissolved in RPMI 1640 medium (GIBCO BRL, Paisley, UK), whereas the PAF-receptor antagonists and FITC were dissolved in dimethylsulfoxide. All stock solutions were kept in aliquots at –20°C. DCF (0.5 mM) was prepared freshly in 95% ethanol and was further diluted in PBS to a final concentration of 25 µM.

Bacteria and Growth Conditions
The NTHi strain 772, biotype II, is a clinical nasopharyngeal isolate from our department (22) and was grown in brain heart infusion broth (Difco Laboratories Detroit, MI) supplemented with nicotinamide adenine dinucleotide and hemin (both at 10 µg/ml). In all experiments, bacteria were grown to a stationary phase at 37°C under shaking conditions, followed by dilution 1/100 in prewarmed medium. The bacteria were further incubated at 37°C until OD600 was 0.4.

Fluorescence Labeling of Bacteria
Bacteria were incubated as described above, washed in phosphate-buffered saline (PBS), pH 7.4, and finally resuspended in PBS containing 1% bovine serum albumin. FITC (10 mg/ml) was added at a final concentration of 0.1 mg/ml, and the bacteria were further incubated at room temperature with shaking. After 20 min, NTHi was washed three times in PBS–bovine serum albumin and resuspended in PBS before addition to the cells. Labeling did not affect bacterial viability.

Isolation of Peripheral Blood Leukocytes and Eosinophils
Blood obtained from healthy volunteers was used for isolation of highly purified eosinophils as previously described (23). Briefly, heparinized peripheral blood was diluted 1:1 (vol/vol) in PBS and carefully pipetted over Ficoll-Paque (Pharmacia, Uppsala, Sweden). After centrifugation for 30 min at 500 x g, the peripheral blood leukocytes (PBL) were removed with a pipette, washed twice in PBS, and kept on ice until further treatment or use in experiments. To isolate eosinophils, erythrocytes in the pellet were lysed, and the remaining granulocytes were incubated with immunomagnetic beads coated with antibodies to CD16 (Miltenyi, Gladbach, Germany). The CD16-positive neutrophils were retained in a magnetic column, allowing retrieval of highly pure eosinophils. The purity of eosinophils was more than 98% as determined by May-Grünwald-Giemsa staining, and cell viability was more than 98% as judged by trypan blue exclusion.

NTHi Binding to Eosinophils
Eosinophils (1 x 106 cells/ml) in Hanks' balanced salt solution with Ca2+ and Mg2+ were preincubated with laminarin (0.05–5 mg/ml), mannan (3–6 mg/ml), scleroglucan (0.05–5 mg/ml), methyl glucoside (50–400 mM), or PAF-receptor antagonists (10 µg/ml) for 20 min at 37°C before addition of FITC-labeled NTHi 772 (multiplicity of infection [MOI] 100 bacteria: 1 cell). The eosinophil/bacteria mixture was further incubated with end-over-end rotation at 37°C for 30 min. The bacterial binding to eosinophils was analyzed by flow cytometry using a Coulter Epics XL-MCL Flow Cytometer (Coulter Diagnostics, Miami, FL). Eosinophils were gated using their characteristics in side and forward scatter. Eosinophils with bound bacteria were discriminated from cells without bacteria by a change in fluorescence.

Assay for Bacterial Killing
Bacterial killing by eosinophils was analyzed using a viable count assay. Eosinophils were incubated with NTHi and, at specific time points, aliquots were removed, vortexed in tubes with glass pearls to disrupt eosinophils, serially diluted, and plated on chocolate agar plates. Colony-forming units were counted after overnight incubation at 37°C. The number of colonies obtained after coincubation of bacteria and eosinophils were compared with the number of colonies formed by bacteria incubated alone. To ensure that the eosinophils had bactericidal capacity, serum-opsonized Escherichia coli was included as control (24).

Analysis of the Respiratory Burst
Eosinophils (1 x 106 cells/ml) were incubated in 25 µM DCF at 37°C for 20 min to make the cells fluorescent upon production of superoxide and subsequent formation of hydrogen peroxide. The cell suspension was mixed every fifth minute. DCF is deacetylated intracellularly and forms nonfluorescent DCFH that turns fluorescent upon binding to hydrogen peroxide. Thereafter, the cells were aliquoted (500 µl/tube), followed by addition of bacteria at different concentrations. The mixtures were incubated at 37°C, rotating end-over-end. Samples (120 µl) were removed at different time points, fixed in equal volumes of 2% paraformaldehyde, and analyzed by flow cytometry.

Detection of IL-8 Expression
Eosinophils (1 x 106 cells/ml) were suspended in RPMI 1640 supplemented with 5% FCS and gentamicin (12 µg/ml). After addition of NTHi 772 (MOI 100:1), eosinophils were incubated at 37°C rotating end-over-end. At different time points, supernatants were collected and stored at –20°C until analyzed for their IL-8 contents using a sandwich enzyme-linked immunosorbent assay (ELISA; Pharmingen, San Diego, CA).

Total RNA was isolated from eosinophils using a total RNA isolation kit (BD Biosciences, Erembodegem, Belgium). The quality of RNA was checked by agarose gel electrophoresis identifying 18S and 28S rRNA. Reverse transcriptase–polymerase chain reactions (RT-PCRs) were performed according to a standard procedure using "Ready-to-Go" PCR tubes (Amersham Pharmacia Biotech, Uppsala, Sweden). The specific IL-8 primers were 5'atgacttccaagctggccgtg3' and 5'ggagtatgtctttatgcactgacatcta3', generating a product of 125 bp. Subsequent Southern blot and hybridization with a digoxigenin-labeled internal oligonucleotide (5'tctgcagctctgtgtgaagg3') was performed using a standard protocol (Roche Diagnostics Scandinavia, Bromma, Sweden). The housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (G3PDH) was used as a control. The G3PDH primers were 5'accaccatggagaaggctgg3'and 5'cacagtgtagcccaggatgc3'generating a product of 530 bp, and the digoxygenin-conjugated internal oligonucleotide was 5'gttcagctcagggatgacctt3'.

Detection of Human ß-Glucan Receptor mRNA (Dectin-1) Expression
Total RNA was isolated from eosinophils and PBL as described above. RT-PCRs were subsequently performed in two steps. Initially, total RNA (200 ng) was converted to cDNA in a reversed transcription (RT) reaction using AMV reverse transcriptase (Roche, Mannheim, Germany). Incubation temperatures for the RT were 42°C for 60 min, and thereafter 95°C for 5 min. Five microliters of the reaction volume was used as template in the PCR-reactions using DyNAzyme II DNA polymerase (Finnzyme Espoo, Finland). After 40 cycles consisting of 95°C for 2 min, 59°C for 2 min, and 72°C for 2 min, the reaction was completed at 72°C for 10 min. The specific ß-glucan receptor (dectin-1) primers used were 5'-aaaggatccaggggctctcaagaacaatg-3' and 5'-aaactcgagtcttccacccttccccttac-3', potentially making it possible to detect gene expression of two major and six minor isoforms of the receptor (17). The G3PDH primers were used as control. The PCR products were analyzed by electrophoresis in a 1.8% TAE agarose gel.

Human Cytokine Gene Expression Array and Data Analysis
Total RNA (2 µg) was amplified in two steps, involving annealing of human cytokine–specific primers (R&D Systems, Abingdon, UK) and RT in the presence of {alpha}-33P-dCTP (370 Mbq/ml, 10 µCi/ml) (Amersham Pharmacia Biotech) according to the recommendations by the manufacturer. The unincorporated radioactive nucleotides were removed by using Sephadex G-25 spin columns (Costar, Corning, NY). A labeling efficiency of 80% was obtained. The radioactively labeled cDNA was hybridized to the human cytokine expression array (R&D Systems) according to the manufacturer's instructions. Exposure of the arrays was performed on phosphor screens for 72 h at room temperature. Array spots were analyzed using the ImageQuant software (Molecular Dynamics, Amersham Biosciences, Uppsala, Sweden) giving a mean volume/density value for each gene. Local background was subtracted from each spot and the samples were normalized against the average of the nine house keeping genes on the array. The fold-induction for all of the genes on the array was calculated using the normalized data sets for the control and the NTHi stimulated eosinophils. A minimum of 2-fold induction was considered significant.

Statistical Analysis
All data are presented as mean ± SD. Student's t test for paired data was used for the statistical analysis of the results. P values < 0.05 were considered statistically significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
NTHi Bind to Eosinophils via ß-Glucan Receptors
To study the binding of NTHi strain 772 to human eosinophils and to characterize putative receptors, FITC-labeled bacteria were incubated with eosinophils in the presence or absence of the receptor antagonists laminarin or scleroglucan. The effect of both compounds was tested in the concentration range of 0.05–5 mg/ml. Both scleroglucan and laminarin blocked binding in a dose-dependent fashion. Scleroglucan at 5 mg/ml blocked bacterial adherence by 81 ± 8% (mean ± SD), whereas laminarin used at the same concentration blocked by 51 ± 20% (Figure 1A). FITC-labeled Escherichia coli (ATCC 25,922) was included as control to assure the specificity of the bacterial binding to eosinophils. In contrast to NTHi, E. coli showed no binding to eosinophils as detected by flow cytometry (data not shown).



View larger version (43K):
[in this window]
[in a new window]
  		Figure 1. Binding of NTHi to human eosinophils and detection of human ßGR isoforms. (A) Eosinophils (1 x 106 cells/ml) were incubated with FITC-labeled NTHi (MOI 100:1) for 30 min in the presence or absence of receptor inhibitors. Bacterial binding was detected by flow cytometry. Laminarin and scleroglucan at the indicated concentrations blocked the binding of NTHi to human eosinophils in a dose-dependent manner. The results represent mean values of three to five experiments, and show percentage of eosinophils with bound FITC-NTHi as compared with control cells incubated with bacteria without laminarin and scleroglucan added. Error bars show standard deviations. *P <= 0.05, **P <= 0.01, ***P <= 0.001. (B) Total RNA, extracted from human eosinophils or PBLs, was amplified by a two-step RT-PCR and analyzed by gel electrophoresis (1.8% agarose) for the presence of human ß-glucan receptor (ßGR; dectin-1) isoforms. Lane 1 shows the ßGR mRNA isoforms detected in PBLs, whereas lanes 2 and 3 demonstrate the isoforms detected in RNA isolated from eosinophils originating from two different donors. Arrows show positions for ßGR A to E according to the nomenclature by Willment and coworkers (17).

 
Other surface receptors are known to play a role in NTHi binding to mammalian cells. NTHi can bind via the choline moiety of the lipooligosaccharide to the PAF receptor on epithelial cells (25). It is also known that CR3 (CD11b/CD18) has a ß-glucan binding site in its {alpha}-subunit (13). Furthermore, the mannose receptor plays a role in NTHi binding to epithelial cells (12). However, neither the PAF-receptor antagonists nor methyl glucoside used for blocking CR3 showed any inhibitory effect on bacterial binding to eosinophils. In addition, excess of solubilized mannan did not interfere with the NTHi binding. In line with this, the mannose receptor (CD206) could not be detected on the surface of eosinophils by flow cytometry (data not shown). Thus, among the putative receptors tested, the binding of NTHi to eosinophils is mainly mediated via ß-glucan receptors.

To examine the ability of eosinophils to kill nonopsonized NTHi, a viable count assay was used. NTHi was incubated with eosinophils, and bacterial viability was measured at different time points. However, no killing of NTHi was detected in our experimental model (data not shown).

Human Eosinophils Express ß-Glucan Receptor (Dectin-1) mRNA Isoforms
NTHi interacts with ß-glucan receptors on the cell surface of eosinophils, as deduced from experiments using the ß-glucan derivatives laminarin and scleroglucan (Figure 1A). Therefore, experiments were performed to detect gene transcripts for the recently characterized ß-glucan receptor dectin-1 (17). Total RNA isolated from eosinophils was subjected to RT-PCR. As shown in Figure 1B, at least two bands corresponding to ß-GR isoforms A and B were detected in human eosinophils. Dectin-1 isoforms were also found in periheral blood leukocytes that were included as a positive control. This is in accordance with the data reported by Willment and coworkers (17).

NTHi and the ß-Glucan Derivative Laminarin Induce a Respiratory Burst in Eosinophils
To examine whether NTHi activates eosinophils, the induction of superoxide/hydrogen peroxide production (i.e., respiratory burst) was analyzed. After loading the cells with DCF, they were stimulated with bacteria at different MOI and for different time intervals. As seen in Figure 2A, the respiratory burst was induced in a time- and dose-dependent manner. A statistically significant increase in the production of hydrogen peroxide was observed within 30 min of stimulation at a MOI of 100:1 (Figure 2B). No further increase in the respiratory burst was observed after 60 min of stimulation. In Figure 2C, a dose response of the eosinophilic stimulation by different MOIs at 30 min is shown. Increased bacterial numbers consequently resulted in a stronger respiratory burst.



View larger version (29K):
[in this window]
[in a new window]
  		Figure 2. Induction of eosinophilic respiratory burst after stimulation by NTHi. (A) One representative experiment, showing the time- and dose-dependent induction of the respiratory burst in eosinophils stimulated by NTHi. (B) Induction of respiratory burst in eosinophils after 15, 30, and 60 min of incubation with the bacteria. The results are mean values of three experiments, and error bars show standard deviations. (C) Increasing concentrations of NTHi stimulated more cells to produce hydrogen peroxide after 30 min of incubation. The results show the percentage of eosinophils positive for the production of hydrogen peroxide.

 
In blocking experiments, where eosinophils were pretreated with laminarin before addition of NTHi, it was found that the ß-glucan derivative itself was a potent inducer of the respiratory burst. Already within 15 min of incubation, laminarin at 1 mg/ml stimulated 48% of the cells (Figure 3A). After 30 min of incubation, even lower concentrations of laminarin (0.1 mg/ml) induced the respiratory burst in 10% of the cells (Figure 3B). In contrast, scleroglucan at these concentrations did not significantly activate the respiratory burst. In summary, after stimulation by NTHi, the production of hydrogen peroxide in eosinophils occurred in a time- and dose-dependent manner. Most importantly, the ß-glucan derivative laminarin induced an oxidative burst, suggesting that NTHi ß-glucans are involved in the stimulation of eosinophils.



View larger version (20K):
[in this window]
[in a new window]
  		Figure 3. Flow cytometric detection of the respiratory burst in eosinophils stimulated by laminarin. DCF-loaded eosinophils were incubated in the presence of different concentrations of laminarin for 15, 30, and 60 min. (A) Kinetics of the hydrogen peroxide production in eosinophils after stimulation by 1 mg/ml laminarin. (B) Dose response–related induction of the respiratory burst in eosinophils after 30 min of stimulation by laminarin. The figure shows one representative experiment out of three.

 
NTHi Increases the Expression of IL-8 in Eosinophils
To further characterize the effects from NTHi on eosinophils, the proinflammatory chemokine IL-8 was investigated both at protein and mRNA levels. Eosinophils were incubated with NTHi, and supernatants were collected to analyze the synthesis of IL-8 after 3, 16, and 24 h of incubation. A spontaneous IL-8 production was observed in cells incubated without bacteria. However, activation by NTHi significantly increased the production of IL-8 by > 3-fold when compared with controls without bacteria at 16 h (Figure 4A).



View larger version (16K):
[in this window]
[in a new window]
  		Figure 4. NTHi stimulates eosinophils to increased IL-8 synthesis. (A) Human eosinophils were incubated with NTHi for 3, 16, or 24 h. Supernatants were analyzed by ELISA. The results represent mean values of three experiments, and error bars show standard error of the mean. (B) Eosinophils were incubated with NTHi and total RNA was extracted after 4.5 h. RT-PCR was followed by Southern blot for the detection of IL-8 mRNA and the housekeeping gene G3PDH. Densitometry was used to calculate ratios for the IL-8 expression compared with G3PDH. Results from three separate experiments and donors are shown.

 
To examine whether the increased IL-8 protein levels were caused by an increased transcription, the expression of IL-8 mRNA was also analyzed after 4.5 h of stimulation by NTHi. Total RNA was purified and analyzed by RT-PCR, followed by Southern blot of the resulting PCR products. The housekeeping gene G3PDH was used as a control to normalize the samples (Figure 4B). The constitutive IL-8 mRNA levels varied between the donors. However, after stimulation with NTHi, up to a 1.5-fold increased IL-8 mRNA expression was detected.

Induction and Upregulation of Gene Expression in Eosinophils by NTHi
Due to difficulties in isolating sufficient amounts of RNA from eosinophils of individual donors, equal amounts of RNA from the three healthy donors were pooled and used for microarray analysis (Figure 4B). Radioactive cDNA was prepared using specific primers for cytokine and signal transduction molecules. The resulting products were hybridized to filters containing cDNA for 847 genes. A total of 245 genes were upregulated after stimulation of eosinophils by NTHi. In Figure 5, 15 different gene groups are shown. An induction by > 2-fold was detected for 147 genes, whereas 98 genes were detected only in cells stimulated by NTHi. A list of inflammation-associated induced genes is presented in Table 1. The gene group representing signal transduction-related molecules contained the largest number of induced genes, corresponding to 26% of all the genes induced. The second largest group was the cytokine and receptors group, corresponding to 17% of the genes. Thus, NTHi-activated eosinophils expressed mRNAs corresponding to an array of gene groups. Proinflammatory mediators and signal transduction–related gene transcripts showed the strongest expression.



View larger version (44K):
[in this window]
[in a new window]
  		Figure 5. NTHi induced the expression of 245 genes in human eosinophils. Pie chart showing the distribution of the induced genes in different groups.

 

View this table:
[in this window]
[in a new window]
  		TABLE 1 Genes induced in eosinophils after stimulation by NTHi

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We have previously demonstrated that (1–3)-ß-D-glucan receptors are important for binding and subsequent entry of NTHi into human monocytes and epithelial cells (12). In the present investigation, we show that NTHi also binds to human eosinophils through (1–3)-ß-D-glucan receptors. Consequently, eosinophils are stimulated to produce superoxide and induce expression of signal transduction molecules and proinflammatory mediators.

Cloning and characterization of the human ß-glucan receptor dectin-1 have revealed two major functional mRNA transcripts of 4.2 and 2.4 kilobases, respectively (17). The two isoforms, designated A and B, are differentially expressed in various cell types and tissues. In transfection experiments, however, the isoforms A and B are the only functional isoforms as compared with the isoforms C to H. Eosinophils produce at least isoform A and B mRNAs, as revealed by RT-PCR (Figure 2B). Binding of zymosan (a yeast-derived ß-glucan–rich particle) to dectin-1 receptor isoforms A and B can be inhibited by ß-1,3– and ß-1,6–linked glucans (17). Scleroglucan and laminarin, which both are ß-1,6–linked glucans, bind to isoforms A and B, albeit at slightly different efficiency. In a previous study, we demonstrated that laminarin blocked binding of NTHi to primary monocytes and the epithelial cell line A-549 by 50%, whereas scleroglucan did not block the NTHi-dependent binding (12). In contrast, the present study shows that also the ß-glucan receptor, which is blocked by scleroglucan, plays an important dominant role in the binding association of NTHi to eosinophils. Thus, the mechanism of NTHi binding differs between eosinophils and epithelial cells.

Two different functions have been attributed to the ß-glucan receptor dectin-1. First, dectin-1 strongly activates T lymphocytes as revealed in a HeLa transfection system (19). Second, analysis of the dectin-1 protein sequence reveals a cytoplasmic immunoreceptor tyrosine-based activation motif (ITAM) in the C-terminus, suggesting a signaling function for the receptor (17). The dectin-1 isoforms A and B both have the ITAM motif, excluding the idea that the two molecules should differ in their signaling pathways. To study whether the innate recognition of NTHi leads to activation of eosinophils, we measured the oxidative burst induced in the cells. A significant induction of hydrogen peroxide was detected after stimulation by either bacteria (Figure 2) or laminarin (Figure 3). Thus, the ß-glucan receptors on the eosinophilic cell surface mediate not only bacterial binding but also cell activation. It has previously been shown that nonopsonized zymosan particles may activate eosinophils through a glucan recognition mechanism, inducing leukotriene C4 production (21). This is in agreement with findings in the present study using nonopsonized NTHi. A ß-glucan–dependent induction of respiratory burst has also been reported in human neutrophils. Antibodies to CR3 blocked the activation of neutrophils, suggesting the involvement of a ß-glucan lectin-binding site found in the CD11b subunit of CR3 (27). Moreover, it has been suggested that the ß-glucan–dependent immunomodulatory effects require crosslinking of membrane ß-glucan receptors (28). Thus, larger polymers (e.g., scleroglucan) are more efficient stimulants of host cells. Scleroglucan would therefore be expected to be a more potent inducer of the respiratory burst in eosinophils as compared with laminarin. The fact that scleroglucan significantly blocked NTHi binding to eosinophils, whereas laminarin, in addition to blocking, induced a respiratory burst, may suggest that an additional ß-glucan receptor exists on eosinophils that is associated with intracellular signaling. Because dectin-1 has been reported to be the major ß-glucan receptor on macrophages, this has to be proven (18).

In our experimental system, we were not able to detect any killing of NTHi by eosinophils using a viable count assay, whereas 75% of E. coli added to the cells was killed (24). One explanation for the lack of killing could be the action of catalase produced by NTHi. It has been reported that the haemophilus hktE catalase gene protects the organism from exogenous hydrogen peroxide and unstable oxygene-containing molecules derived thereof (26). Thus, a possible explanation for the discrepancy between eosinophilic killing of NTHi and E. coli might be differences in the activity of catalase in the different bacterial species.

NTHi stimulated an increase in IL-8 production both at the mRNA and protein levels. The proinflammatory chemokine IL-8 plays a major role in the inflammatory response, recruiting neutrophils to inflamed tissues. The ability of eosinophils to generate IL-8 has been studied extensively (29–32). To further investigate the effects of NTHi on eosinophil gene expression, microarray analysis was performed. After stimulation of eosinophils by NTHi, we detected the upregulation of 245 different genes. Of these, 98 genes were detected only in stimulated cells. Many different groups of genes were induced; signal transduction molecules and proinflammatory mediators (cytokines and their receptors) may be the most relevant genes during innate recognition of NTHi by eosinophils. The array data merely give an overview of the eosinophilic stimulation achieved after incubation with NTHi for 4.5 h. Before any firm conclusions can be drawn regarding the physiologic relevance concerning expression of specific genes, quantitative RT-PCRs or Northern blots should verify the array results. In addition, the levels of translated protein should be examined by Western blots or ELISAs. However, if we in theory accept that the induced transcription of a gene is followed by translation into protein, we have detected the expression of certain genes that have been associated with inflammatory diseases involving eosinophils. For example, it has recently been suggested that the chemokine MIP-1ß may play a role for the development of COPD and is probably a chemoattractant for eosinophils in patients suffering from this disease (33). IL-13 induces several characteristic features of asthma, including airway eosinophilia, airway hyperresponsiveness, and overproduction of mucus (34), whereas IL-15 has been reported to affect neutrophils in several ways and to delay apoptosis in human eosinophils (35, 36). Thus, IL-15 could contribute to a prolonged inflammatory response involving eosinophils and neutrophils in asthma-associated inflammation.

The gene for the IL receptor IL-5R{alpha} is constitutively expressed by mature eosinophils (37). However, in the present study it was detected only in cells stimulated by NTHi. This shows that the results obtained by microarray analysis may be insensitive compared with other methods. On the other hand, it has the advantage of giving a broad overview of gene regulation during cellular activation.

In conclusion, we have shown that NTHi can stimulate eosinophils in a ß-glucan–dependent manner. This may contribute to an increased eosinophilic inflammation in the respiratory tract. Taking this idea a step further, we suggest that NTHi could contribute to the inflammation associated with diseases such as allergic asthma and COPD, through activation of eosinophils.


   Acknowledgments
 
This work was supported by grants from the Alfred Österlund Foundation, the Anna and Edwin Berger Foundation, the Greta and Johan Kock Foundation, the Swedish Medical Research Council, the Swedish Society of Medicine, the Åke Wiberg foundation, and the Cancer Foundation at the Malmö University Hospital.

Received in original form July 28, 2002

Received in final form April 1, 2003


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Sethi, S., and T. F. Murphy. 2001. Bacterial infections in chronic obstructive pulmonary disease in 2000: a state-of-the-art review. Clin. Microbiol. Rev. 14:336–363.[Abstract/Free Full Text]
  2. Robinson, D. S., A. B. Kay, and A. J. Wardlaw. 2002. Eosinophils. Clin. Allergy Immunol. 16:43–75.[Medline]
  3. Lamkhioued, B., P. M. Renzi, S. Abi-Younes, E. A. Garcia-Zepada, Z. Allakhverdi, O. Ghaffar, M. D. Rothenberg, A. D. Luster, and Q. Hamid. 1997. Increased expression of eotaxin in bronchoalveolar lavage and airways of asthmatics contributes to the chemotaxis of eosinophils to the site of inflammation. J. Immunol. 159:4593–4601.[Abstract]
  4. Horie, S., and H. Kita. 1994. CD11b/CD18 (Mac-1) is required for degranulation of human eosinophils induced by human recombinant granulocyte-macrophage colony-stimulating factor and platelet-activating factor. J. Immunol. 152:5457–5467.[Abstract]
  5. Gleich, G. J. 2000. Mechanisms of eosinophil-associated inflammation. J. Allergy Clin. Immunol. 105:651–663.[CrossRef][Medline]
  6. St. Geme, J. W., III. 2002. Molecular and cellular determinants of non-typeable Haemophilus influenzae adherence and invasion. Cell. Microbiol. 4:191–200.[CrossRef][Medline]
  7. Craig, J. E., A. Nobbs, and N. J. High. 2002. The extracytoplasmic sigma factor, final sigma (E), is required for intraceullular survival of nontypeable Haemophilus influenzae in J774 macrophages. Infect. Immun. 70:708–715.[Abstract/Free Full Text]
  8. Clemans, D. L., R. J. Bauer, J. A. Hanson, M. V. Hobbs, J. W. St. Geme, III, C. F. Marrs, and J. R. Gildsorf. 2000. Induction of proinflammatory cytokines from human respiratory epithelial cells after stimulation by nontypeable Haemophilus influenzae. Infect. Immun. 68:4430–4440.[Abstract/Free Full Text]
  9. Garofalo, R., H. Faden, S. Sharma, and P. L. Ogra. 1991. Release of leukotriene B4 from human neutrophils after interaction with nontypeable Haemophilus influenzae. Infect. Immun. 59:4221–4226.[Abstract/Free Full Text]
  10. Leanord, A., and C. Williams. 2002. Haemophilus influenzae in acute exacerbations of chronic obstructive pulmonary disease. Int. J. Antimicrob. Agents 19:371–375.[CrossRef][Medline]
  11. Cazzola, M., M. G. Matera, and F. Rossi. 1991. Bronchial hyperresponsiveness and bacterial respiratory infections. Clin. Ther. 13:157–171.[Medline]
  12. Ahrén, I. L., D. L. Williams, P. J. Rice, A. Forsgren, and K. Riesbeck. 2001. The importance of a beta-glucan receptor in the nonopsonic entry of nontypeable Haemophilus influenzae into human monocytic and epithelial cells. J. Infect. Dis. 184:150–158.[CrossRef][Medline]
  13. Xia, Y., and G. D. Ross. 1999. Generation of recombinant fragments of CD11b expressing the functional beta-glucan-binding lectin site of CR3 (CD11b/CD18). J. Immunol. 162:7285–7293.[Abstract/Free Full Text]
  14. Czop, J. K., and J. Kay. 1991. Isolation and characterization of beta-glucan receptors on human mononuclear phagocytes. J. Exp. Med. 173:1511–1520.[Abstract/Free Full Text]
  15. Müeller, A., J. Raptis, P. J. Rice, J. H. Kalbfleisch, R. D. Stout, H. E. Ensley, W. Browder, and D. L. Williams. 2000. The influence of glucan polymer structure and solution conformation on binding to (1->3)-beta-D-glucan receptors in a human monocyte-like cell line. Glycobiology 10:339–346.[Abstract/Free Full Text]
  16. Müeller, A., P. J. Rice, H. E. Ensley, P. S. Coogan, J. H. Kalbfleish, J. L. Kelley, E. J. Love, C. A. Portera, T. Ha, I. W. Browder, and D. L. Williams. 1996. Receptor binding and internalization of a water-soluble (1->3)-ß-D-glucan biologic response modifier in two monocyte/macrophage cell lines. J. Immunol. 156:3418–3425.[Abstract]
  17. Willment, J. A., S. Gordon, and G. D. Brown. 2001. Characterization of the human ß-glucan receptor and its alternatively spliced isoforms. J. Biol. Chem. 276:43818–43823.[Abstract/Free Full Text]
  18. Brown, G. D., P. R. Taylor, D. M. Reid, J. A. Willment, D. L. Williams, L. Martinez-Pomares, S. Y . Wong, and S. Gordon. 2002. Dectin-1 is a major beta-glucan receptor on macrophages. J. Exp. Med. 196:407–412.[Abstract/Free Full Text]
  19. Grunebach, F., M. M. Weck, J. Reichert, and P. Brossart. 2002. Molecular and functional characterization of human Dectin-1. Exp. Hematol. 30:1309–1315.[CrossRef][Medline]
  20. Taylor, P. R., G. D. Brown, D. M. Reid, J. A. Willment, L. Martinez-Pomares, S. Gordon, and S. Y. Wong. 2002. The beta-glucan receptor, dectin-1, is predominantly expressed on the surface of cells of the monocyte/macrophage and neutrophil lineages. J. Immunol. 169:3876–3882.[Abstract/Free Full Text]
  21. Mahauthaman, R., C. J. Howell, B. W. Spur, L. J. Youlten, T. J. Clark, M. H. Lessof, and T. H. Lee. 1988. The generation and cellular distribution of leukotriene C4 in human eosinophils stimulated by unopsonized zymosan and glucan particles. J. Allergy Clin. Immunol. 81:696–705.[CrossRef][Medline]
  22. Janson, H., L. O. Heden, A. Grubb, M. R. Ruan, and A. Forsgren. 1991. Protein D, an immunoglobulin D-binding protein of Haemophilus influenzae: cloning, nucleotide sequence, and expression in Escherichia coli. Infect. Immun. 59:119–125.[Abstract/Free Full Text]
  23. Hansel, T. T., I. J. M. De Vries, T. Iff, S. Rihs, M. Wandzilak, K. Blaser, and C. Walker. 1991. An improved immunomagnetic procedure for isolation of highly purified human blood eosinophils. J. Immunol. Methods 145:105–110.[CrossRef][Medline]
  24. Persson, T., P. Andersson, M. Bodelsson, M. Laurell, J. Malm, and A. Egesten. 2001. Bactericidal activity of human eosinophilic granulocytes against Escherichia coli. Infect. Immun. 69:3591–3596.[Abstract/Free Full Text]
  25. Swords, W. E., B. A. Buscher, K. Ver Steeg II, A. Preston, W. A. Nichols, J. N. Weiser, B. W. Gibson, and M. A. Apicella. 2000. Non-typeable Haemophilus influenzae adhere to and invade human bronchial epithelial cells via an interaction of lipooligosaccharide with the PAF receptor. Mol. Microbiol. 37:13–27[CrossRef][Medline]
  26. Bishai, W., N. S. Howard, J. A. Winkelstein, and H. O. Smith. 1994. Characterization and virulence analysis of catalase mutants of Haemophilus influenzae. Infect. Immun. 62:4855–4860.[Abstract/Free Full Text]
  27. Ross, G. D., J. A. Cain, B. L. Myones, S. L. Newman, and P. J. Lachman. 1987. Specificity of membrane complement receptor type three (CR3) for ß-glucans. Complement 4:61–74.[Medline]
  28. Lowe, E., P. Rice, T. Ha, C. Li, J. Kelley, H. Ensley, J. Lopez-Perez, J. Kalbfleisch, D. Lowman, P. Margl, W. Browder, and D. Williams. 2001. A (1–3)-ß-linked heptasaccharide is the unit ligand for glucan pattern recognition receptors on human monocytes. Microbes Infect. 3:789–797.[CrossRef][Medline]
  29. Kita, H., R. I. Abu-Ghazaleh, S. Sur, and G. J. Gleich. 1995. Eosinophil major basic protein induces degranulation and IL-8 production by human eosinophils. J. Immunol. 154:4749–4758.[Abstract]
  30. Nakajima, H., G. J. Gleich, and H. Kita. 1996. Constitutive production of IL-4 and IL-10 and stimulated production of IL-8 by normal peripheral blood eosinophils. J. Immunol. 156:4859–4866.[Abstract]
  31. Temple, R., E. Allen, J. Fordham, S. Phipps, H.-O. Schneider, K. Lindhauer, I. Hayes, J. Lockey, K. Pollock, and R. Jupp. 2001. Microarray analysis of eosinophils reveals a number of candidate survival and apoptosis genes. Am. J. Respir. Cell Mol. Biol. 25:425–433.[Abstract/Free Full Text]
  32. Petering, H., O. Götze, D. Kimming, R. Smolarski, A. Kapp, and J. Elsner. 1999. The biologic role of interleukin-8 - functional analysis and expression of CXCR1 and CXCR2 on human eosinophils. Blood 93:694–702.[Abstract/Free Full Text]
  33. Barczyk, A., W. Pierzchala, and E. Sozanska. 2001. Levels of CC-chemokine (MCP-1 alpha, MIP-1 beta) in induced sputum of patients with chronic obstructive pulmonary disease and patients with chronic bronchitis. Pneumonol. Allergol. Pol. 69:40–49.
  34. Pope, S. M., E. B. Brandt, A. Mishra, S. P. Hogan, N. Zimmermann, K. I. Matthaei, P. S. Foster, and M. E. Rothenberg. 2001. IL-13 induces eosinophil recruitment into the lung by an IL-5- and eotaxin-dependent mechanism. J. Allergy Clin. Immunol. 108:594–601.[CrossRef][Medline]
  35. Cassatella, M. A., and P. P. McDonald. 2000. Interleukin-15 and its impact on neutrophil function. Curr. Opin. Hematol. 7:174–177.[CrossRef][Medline]
  36. Hoontrakoon, R., H. W. Chu, S. J. Gardai, S. E. Wenzel, R. McDonald, V. A. Fadok, P. M. Henson, and D. L. Bratton. 2002. Interleukin-15 inhibits spontaneous apoptosis in human eosinophils via autocrine production of granulocyte macrophage-colony stimulating factor and nuclear factor-{kappa}B activation. Am. J. Respir. Cell Mol. Biol. 26:404–412.[Abstract/Free Full Text]
  37. Tavernier, J., J. van der Heyden, A. Verthee, G. Brusselle, X. van Ostade, J. Vandekerckhove, J. North, S. M. Rankin, B. Kay, and D. S. Robinson. 2000. Interleukin 5 regulates the isoform expression of its own receptor {alpha}-subunit. Blood 95:1600–1607.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 ThoraxHome page
B J Hales, L J Pearce, M M H Kusel, P G Holt, P D Sly, and W R Thomas
Differences in the antibody response to a mucosal bacterial antigen between allergic and non-allergic subjectsSmoke-free legislation reduces exposure in children
Thorax, March 1, 2008; 63(3): 221 - 227.
[Abstract] [Full Text] [PDF]

Home page
 Proc Am Thorac SocHome page
N. N. Hansel and G. B. Diette
Gene Expression Profiling in Human Asthma
Proceedings of the ATS, January 1, 2007; 4(1): 32 - 36.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-0138OCv1
29/5/598    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ahrén, I. L.
Right arrow Articles by Riesbeck, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ahrén, I. L.
Right arrow Articles by Riesbeck, K.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2003 American Thoracic Society.