help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Published ahead of print on June 5, 2003, doi:10.1165/rcmb.2003-0070OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-0070OCv1
29/6/653    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ghio, A. J.
Right arrow Articles by Piantadosi, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ghio, A. J.
Right arrow Articles by Piantadosi, C. A.
American Journal of Respiratory Cell and Molecular Biology. Vol. 29, pp. 653-660, 2003
© 2003 American Thoracic Society
DOI: 10.1165/rcmb.2003-0070OC

Superoxide-Dependent Iron Uptake

A New Role for Anion Exchange Protein 2

Andrew J. Ghio, Eva Nozik-Grayck, Jennifer Turi, Ilona Jaspers, Danielle R. Mercatante, Ryszard Kole and Claude A. Piantadosi

Departments of Medicine and Pediatrics, Duke University Medical Center, Durham; National Health and Environmental Effects Research Laboratory, Office of Research and Development, Environmental Protection Agency, Research Triangle Park; Center for Environmental Medicine and Lung Biology, University of North Carolina, Chapel Hill; and Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, North Carolina

Address correspondence to: Claude A. Piantadosi, P.O. Box 3315, Duke University Medical Center, Durham, NC 27710. E-mail: piant001{at}mc.duke.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lung cells import iron across the plasma membrane as ferrous (Fe2+) ion by incompletely understood mechanisms. We tested the hypothesis that human bronchial epithelial (HBE) cells import non–transferrin-bound iron (NTBI) using superoxide-dependent ferri-reductase activity involving anion exchange protein 2 (AE2) and extracellular bicarbonate (HCO3-). HBE cells that constitutively express AE2 mRNA by reverse transcriptase–polymerase chain reaction and AE2 protein by Western analysis avidly transported NTBI after exposure to either Fe2+ or Fe3+, but reduction of Fe3+ to Fe2+ was first required. The ability of HBE cells to reduce Fe3+ and transport Fe2+ was inhibited by active extracellular superoxide dismutase (SOD). Similarly, HBE cells that overexpress Cu,Zn SOD after adenoviral infection with AdSOD1 showed diminished iron uptake. The role of AE2 in iron uptake was indicated by three lines of evidence: (i) lack of both iron reduction and iron transport in bicarbonate-free buffer at controlled pH, (ii) failure of HBE cells treated with stilbene AE inhibitors to reduce Fe3+ or transport iron, and (iii) inhibition of iron uptake in HBE cells by inhibition of AE2 protein expression with antisense oligonucleotides. We thus disclose a novel ferri-reductase mechanism of NTBI uptake by human lung cells that employs superoxide exchange for HCO3- by AE2 protein in the plasma membrane.

Abbreviations: anion exchange, AE • bronchial epithelial growth medium, BEGM • bathophenanthroline disulfonate, BPS • 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid, DIDS • ferric ammonium citrate, FAC • human bronchial epithelial cells, HBE cells • Hanks' balanced salt solution, HBSS • non–transferrin-bound iron, NTBI • phosphate-buffered saline, PBS • sodium dodecyl sulfate, SDS • 4-acetamido-4'-isothiocyanatostilbene-2,2'disulfonic acid, SITS • superoxide dismutase, SOD


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Iron is an essential micronutrient for most aspects of cellular metabolism, but its chemistry presents cells with difficulties procuring it because Fe3+ forms aqueous oxyhydroxides, which are biologically inaccessible. In addition, uncontrolled oxidative catalysis by incompletely coordinated metal presents a major toxic threat to the cell. As a result, cells have developed specific strategies to acquire iron for cell function and homeostasis. Some cells export organic compounds (i.e., siderophores) that chelate non–transferrin-bound iron (NTBI) and maintain it in a soluble state for translocation across the plasma membrane via specific receptors. Alternatively, unicellular organisms and plants use endogenous ligands to bind NTBI as low molecular weight organo-metal complexes. A common requirement for transport of NTBI appears to be ferri-reductase activity. For instance, NTBI uptake in the yeast Saccharomyces cerevisiae requires metal reductase activity encoded by iron-responsive elements FRE1 and FRE2. A comparable mechanism of NTBI transport is present in many animal cells in which Fe3+ is reduced to Fe2+ before its uptake by a carrier protein (1).

In plant cells, chemical reduction of Fe3+ to Fe2+ is mediated by superoxide (·O2-) anion (2, 3) produced by enzymes such as NAD(P)H: flavin oxidoreductases at the cell surface where metal reduction occurs (4). The final electron acceptor, molecular O2 generates ·O2-, which reduces Fe3+ and splits the metal chelate apart (5). Uptake of Fe2+ by metal carrier proteins then occurs on the apoplastic surface of the cell.

In addition to carrier proteins, NTBI uptake is associated with ion transport mechanisms yet to be fully characterized but involving specific ion channels. Transmembrane anion exchange (AE) proteins mediate rapid electroneutral exchange of chloride (Cl-) and bicarbonate (HCO3-) across plasma membranes. These proteins also have the capacity to exchange ·O2- for HCO3- (6). At least three isoforms of AE proteins have been identified in mammalian systems: AE1 (Band 3) and AE3 are expressed predominantly in erythrocytes and the nervous system respectively, whereas AE2 is constitutive in several tissues including kidney, gut, and lung (7). AE2 facilitates ·O2- exchange in the intact rabbit lung (8).

Catalytically active iron on the cell surface can contribute to pathologic processes (9); therefore, we considered the possibility that ·O2- and bicarbonate-dependent ferri-reductase activity in lung epithelial cells transports iron into the cell to sequester it safely. We tested this hypothesis in primary cultures of human bronchial epithelial (HBE) cells, which transport NTBI by reducing Fe3+ to Fe2+. We also specifically assessed the role of AE2 in ·O2- transport and iron reduction using multiple approaches.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials
All reagents were obtained from Sigma Chemical Co. (St. Louis, MO) unless otherwise specified.

Cell Harvest and Culture
Before the study, subjects were fully informed of the procedures and risks, and each signed a statement of informed consent. The protocol and consent form were approved by the University of North Carolina School of Medicine Committee on the Protection of the Rights of Human Subjects.

HBE cells were obtained from healthy, nonsmoking adult volunteers by cytologic brushing of the airways during bronchoscopy. They were expanded to passage-3 in bronchial epithelial growth medium (BEGM; Clonetics, San Diego, CA), plated on collagen-coated filters with a 0.4-µm pore size (Trans-CLR; Costar, Cambridge, MA) at a density of 1 x 105 and inserted into 12-well culture plates. The cells were maintained in a 1:1 mixture of BEGM and DMEM-H with singlequot supplements, bovine pituitary extracts (13 mg/ml), bovine serum albumin (1.5 g/mL), and nystatin (20 units/mL) in 0.5 ml in the apical chamber and 1.5 ml in the basal chamber. Fresh media was provided every 48 h. Retinoic acid was added on Day 2 to promote differentiation and an air–liquid interface created on Day 6 by removing the apical media. The cells were maintained until they had uniformly differentiated into ciliated, mucus producing cells ~ 10 d later. In some control studies, human alveolar macrophages were acquired by bronchoalveolar lavage and suspended in RPMI at 1 x 106 cells/ml.

Western Blot Analysis
Cells were washed with ice-cold phosphate-buffered saline (PBS), lysed with buffer containing 1% NP40, 0.5% deoxycholate, 0.1% sodium dodecyl sulfate (SDS) and protease inhibitors (Cocktail Set III; Calbiochem, La Jolla, CA), and sheared through a 22-g needle. Nuclei were pelleted by centrifugation at 500 x g for 5 min and the supernatant removed. Protein content was determined using the Bradford assay (Bio-Rad, Hercules,CA). The remaining sample was mixed with an equal volume of 4x sample loading buffer (0.5 M Tris-HCl, pH 6.8, 10% glycerol, 2% SDS, 0.7 M b-mercaptoethanol, 0.05% bromphenol blue).

Protein samples (50 µg) were separated by electrophoresis on 7.5% SDS-polyacrylamide gels and transferred to nitrocellulose membranes (Bio-Rad). The membranes were blocked with 3% casein and incubated with polyclonal antibody against AE2 at a 1:1,000 dilution. The antibody was produced in mouse ascites fluid using a 14 amino acid peptide of the COOH–terminus of AE2 and purified over protein-G Sepharose. The membranes were stained with horseradish peroxidase–conjugated goat anti-mouse secondary antibody (1:1,000; Santa Cruz Biotechnology, Santa Cruz, CA) and developed with enhanced chemiluminescence (ECL kit; Amersham Pharmacia, Piscataway, NJ).

Immunohistochemistry
Pulmonary AE2 expression was evaluated in airway epithelium of human lungs. Sections of lung were cut, floated on a protein-free water bath, mounted on silane treated slides (Fisher, Raleigh, NC), and air-dried overnight. The slides were heat-fixed at 600°C in a slide dryer (Shandon Lipshaw, Pittsburgh, PA) for 10 min and allowed to cool. Sections were deparaffinized and hydrated in ethanol. Endogenous peroxidase was blocked with H2O2 in methanol (containing 0.6% hydrogen peroxide) for 8 min. Slides were rinsed in 95% alcohol, deionized H2O, and PBS. The slides were treated with Cyto Q Background Buster (Innovex Biosciences, Richmond, VA) for 10 min and incubated with primary antibody to AE2 in 1% bovine serum albumin in PBS at a 1:100 dilution for 45 min at 37°C. Slides were incubated with biotinylated linking antibody (Stat-Q Staining System; Innovex Biosciences) for 10 min at room temperature, washed with PBS, and peroxidase enzyme label (Stat-Q Staining System) applied at room temperature. After incubation and washing with PBS, sections were developed with 3,3' diaminobenzidine tetrahydrochloride, counterstained with hematoxylin, dehydrated through alcohol, cleared in xylene, and cover-slipped with permanent mounting media. The peptide used to develop the Ab is unique to AE2, and successfully outcompeted the Ab in preliminary immunolabeling studies. Negative control samples were processed using pre-immune serum instead of primary antibody.

Iron Measurements
Iron concentrations were quantified using inductively coupled plasma atomic emission spectroscopy (ICPAES) at a wavelength of 238.204 nm (Model P30; Perkin Elmer, Norwalk, CT) after cell digestion in 3N HCl and 10% trichloroacetic acid at 70°C for 18 h. Single element standards were used to calibrate the instrument (Fisher, Pittsburgh, PA). The limit of detection was ~ 10 ppb. The assay for iron uptake by ICPAES was verified by inductively coupled plasma mass spectroscopy (ICPMS) and 57Fe isotopic (Cambridge Isotope Labs, Andover, MA) transport measurements (Thermoelemental PQ Excel ICP Mass Spectrometer).

Assay of Ferri-Reductase Activity
HBE cells were grown to confluence on 75 cm2 tissue culture flasks (Falcon; Becton Dickinson Labware, Plymouth, UK) and the media removed. Ten milliliters of either Hanks' balanced salt solution (HBSS) or HBSS plus human recombinant manganese superoxide dismutase (MnSOD; Boehringer Ingleheim, Ridgefield, CT), 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid (DIDS, 50 µM) or 4-acetamido-4'-isothiocyanatostilbene-2,2'disulfonic acid (SITS, 50 µM) was added. After 10 min, 50 µM ferric ammonium citrate (FAC) and 100 µM bathophenanthroline disulfonate (BPS) in HBSS were added to the flasks. After 1 h at 37°C in an atmosphere of 21% O2 + 5% CO2, the supernatant was removed and the concentration of ferrous chelate of BPS measured by absorbance at 520 nm. Ferrous sulfate in HBSS was used for the standard curve. SOD-inhibitable reduction of Fe3+ also serves as an indirect assay for ·O2- chemically analogous to the cytochrome c reduction assay.

Infection with Adenovirus
HBE cells grown to 80% confluence were infected with AdSOD1 at multiple infection equivalents up to 100 plaque-forming units/cell (10). Control cells were infected with Ad5CMV3, the medium aspirated, and the cells incubated for another 48 h before iron uptake studies. SOD 1 expression was confirmed by Western blot analysis and a standard enzymatic assay of SOD activity.

Reverse Transcriptase–Polymerase Chain Reaction
RNA was obtained from HBE cell lysates prepared in GITC buffer containing 4 M guanidine isothiocyanate, 25 mM sodium citrate (pH 7.0), 0.5% sarkosyl, and 10 mM DTT. After shearing through a 22-g needle, cell lysate was layered over an equal volume of 5.7 M CsCl2 and the total RNA pelleted by centifugation for 2 h at 80,000 rpm (114,000 x g). Reverse transcription (RT) and DNA amplification were performed as described (11).

Oligonucleotides were synthesized using an Applied Biosystems 391 DNA synthesizer (Perkin-Elmer, Foster City, CA) based on sequences in GenBank. The primers used were: GAPDH sense, 5' CCATGGAGAAGGCTGGGG 3'; GAPDH antisense, 5' CAAAGTTGTCATGGATGACC 3'; AE2 sense, 5' TGTAGCAGCAACCACCTGGAGT 3'; AE2 antisense, 5' GCAGGAAGAAGGCGATGAAGAA 3'; gp91phox sense, 5' CGCTGGAAACCCTCCTATGA 3'; gp91phox antisense, 5' CCTGCACAGCCAGTAGAAGTAGAT 3'.

cDNA was amplified for 26 cycles for GAPDH and 36 cycles for AE2 gp91phox was amplified 30 to 32 cycles for alveolar macrophages and up to 40 cycles for HBE cells. PCR products were analyzed by gel electrophoresis through a 2% agarose gel in 0.5x Tris/borate/EDTA buffer. Gels were stained with ethidium bromide and photographed under ultraviolet illumination. Bands were quantified using the Kodak 1D Image Analysis Software (Eastman Kodak, Rochester, NY). Optical densities for the AE2 mRNA band were normalized against those of GAPDH.

Real-Time RT–Polymerase Chain Reaction and Sequencing of AE2 mRNA
RNA prepared from HBE cell lysate was reverse transcribed and DNA amplification performed. Real-time quantitative RT–polymerase chain reaction (PCR) was performed with fluorogenic cDNA amplification using an ABI Prism 7,700 Sequence Detector System (Applied Biosystems, Foster City, CA) (11). The primers and double-labeled fluorogenic probes wereas follows. AE2: probe, 5'-TAM-CCCTGGCCGTGCTCTTTGGAATTT-TAMRA-3'; sense, 5'-TTGTGGGCCTCTCCATAGTTATC-3'; antisense, 5'-GATCCCGTTAAGGGAGGTGACT-3'. GAPDH: probe, 5'-JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA-3'; sense, 5'-GAAGGTGAAGGTCGGAGTC-3'; antisense, 5'-GAAGATGGTGATGGGATTTC-3'.

Quantification of AE2 and GAPDH was based on standard curves prepared from serially diluted cDNA from bronchial epithelial (BEAS2B) cells. AE2 mRNA abundance in the samples was standardized against GAPDH. PCR products were sequenced at the University of North Carolina Automated Sequencing Facility (Chapel Hill, NC).

Oligonucleotide Inhibition of AE2 Expression
Antisense morpholino oligonucleotides (Gene Tools, Corvallis, OR) targeted at the AE2 MRNA were designed and synthesized as follows: 5' splice site in exon 17 (AS-1; GCCTTTAAGCCCACGCACCCGGC); 5' splice site in exon 20 (AS-2; GAGGCAACGTACCCACAAGCAGGGC); 5' splice site in exon 13 (AS-3; GCCGTACCCTTATCTTGGGCAG); Start codon (AS-4; TGCGGCTTTCAGGGCAACGAGGCGG).

The oligonucleotides (1.0 µM final concentration) were delivered to the cells by ethoxylated polyethylenimine (EPEI) delivery solution (Gene Tools) as described in the supplier's protocol. Briefly, 5.6 µl of morpholino oligonucleotide (500 µM in water) were mixed with EPEI (5.6 µl) and 188 µl water. After 20 min, the complexes were diluted with 1.8 ml Opti-Mem (Life Technologies, Rockville, MD) and 500 µl of complex pipetted gently onto the cells in transwell plates. After a 3-h incubation at 37°C, the complexes were removed from the cells. Treated cells were assessed 18 h later for AE2 expression and ferri-reductase activity.

Statistics
The minimum number of replicates for all measurements was three. Group and graphical data are expressed as mean values ± SE. Differences among groups were tested using ANOVA and Scheffe's test. Significance was assumed at P < 0.05.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
AE2 Expression in the Lung and Bronchial Epithelial Cells
Immunohistochemical staining demonstrated strong constitutive AE2 protein expression in human lungs (Figure 1). AE2 expression was most prominent in airway epithelial cells of bronchi and bronchioles, although it was also detectable in blood vessels. The presence of AE2 mRNA in HBE cells of different subjects was readily demonstrated by RT-PCR (Figure 2A). Quantitative real-time RT-PCR analysis demonstrated an AE2/GAPDH of 1.75 ± 0.09 for control HBE cells (n = 4). The identity of the PCR products was determined by sequencing to be specific for AE2 (Gene Bank Accession number: U62531). Membrane protein was identified in different batches of cells as a 95- to 100-kD band by Western analysis (Figure 2B). This antibody recognizes a 165-kD AE2 isoform in stomach, a 110- to 115-kD isoform in isolated vessels, and a 95- to 100-kD isoform in lung (8, 12), consistent with different transcriptional and/or post-translational product regulation.



View larger version (121K):
[in this window]
[in a new window]
  		Figure 1. Immunohistochemical staining for AE2 protein in human lung. Slides were incubated with AE2 antibody followed by biotinylated linking antibody and peroxidase label. Sections were developed with 3,3' diaminobenzidine-tetrahydrochloride and counterstained with hematoxylin. Antibody binding is demonstrated in the airway lining cells (brown color). In addition, alveolar macrophages and vascular endothelium bound antibody, whereas epithelial cells in the alveolar region did not stain. Final magnification: x400. Nearby sections do not stain if probed with pre-immune serum or antibody containing AE2 peptide (negative control; inset).

 


View larger version (80K):
[in this window]
[in a new window]
  		Figure 2. AE2 expression in HBE cells. (A) Agarose gel electrophoresis of PCR product band (lanes 1, 2, and 3 are products from different batches of cells). The gels were stained with ethidium bromide and photographed under ultraviolet illumination. Constitutive AE2 mRNA was evident in all three batches of HBE cells. (B) Western analysis for AE2 protein in HBE cells. Protein samples were separated on a 7.5% SDS polyacrylamide gel and transferred to a nitrocellulose membrane. The membrane was incubated with a mouse polyclonal antibody (1:1,000 dilution), stained with a horseradish peroxidase–conjugated goat anti-mouse antibody (1:1,000), and developed with enhanced chemiluminescence. AE2 protein was clearly present in the three batches of HBE cells. Equal loading of protein confirmed by Coomassie blue staining (not shown).

 
Cellular Iron Transport
Differentiated HBE cells were grown replete with iron, and basal intracellular iron content was 600–700 ng/mg of protein. When the cells were exposed on the apical surface to 100 µM FAC (in 50 µl HBSS) a time-dependent increase was detected in the concentration of nonheme metal in the cells (Figure 3A). The metal in the basal compartment increased similarly with respect to time (Figure 3B). The ability of HBE cells to transport iron was verified using 57Fe, a stable isotope. Adding 57FeCl3 (100 µM) to the apical chamber of the transwell increased nonheme 57Fe concentration in the cells similarly to exposure to FAC (Figure 3C). The amount of metal in the basal compartment also increased similarly (Figure 3D). Iron uptake in HBE cells depended on iron concentration. Addition of constant volumes of FAC at concentrations up to 200 µM increased the content of nonheme iron in the cells in a concentration-dependent fashion (Figure 4A). The amount of iron in the basal chamber also increased as a function of the initial concentration of FAC (Figure 4B).



View larger version (45K):
[in this window]
[in a new window]
  		Figure 3. Time-dependent uptake of iron by HBE cells. Cells were grown on transwell plates, the media changed to HBSS, and the cells exposed to 50 µl 100 µM FAC. After washing in HBSS, the cells were scraped into 2 ml 3 N HCl in 10% trichloroacetic acid and hydrolyzed at 70°C for 18 h. Iron was measured using ICPAES ({lambda} 238.204). In addition, 1 ml media was withdrawn from the basal chamber, hydrolyzed in the same volume of 6 N HCl in 20% trichloroacetic acid, and iron measured by ICPAES. There were significant increases in iron concentrations in the cells with time exposed to FAC (A). The concentration of metal in the basal chamber was also higher after exposure to FAC (B). ICPMS was used to verify measurements of iron uptake after exposing HBE cells to 50 µ{lambda} 100 µM 57FeCl3 (Cambridge Isotope Labs). 57Fe in the cells and the basal compartment were assayed as described above by ICPMS. 57Fe concentrations significantly increased in both the cells (C) and the basal chamber (D) with time. *P < 0.05 relative to 0 min exposure.

 


View larger version (58K):
[in this window]
[in a new window]
  		Figure 4. Concentration-dependent iron uptake by HBE cells. Cells were washed in HBSS, scraped into 2 ml 3 N HCl in 10% trichloroacetic acid, and hydrolyzed at 70°C for 18 h. Iron content was measured using ICPAES ({lambda} 238.204). In addition, 1 ml media was withdrawn from the basal chamber, hydrolyzed, and iron measured byICPAES. There was a concentration-dependent increase in the cells after exposure to FAC (A). The basal chamber also demonstrated an elevated metal concentration (B). *P < 0.05 relative to 0 min incubation.

 
Cellular iron transport depended on the metal's valence state. When ferric citrate or ferrous citrate was added to the apical surface of the cells, iron transport into the cells was much greater after ferrous citrate (Figure 5). Bicarbonate requirement for ·O2- reduction of Fe3+ and iron uptake was tested using bicarbonate-free HBSS to expose the cells to FAC. Bicarbonate-free buffer totally inhibited Fe3+ reduction and iron transport at constant pH, suggesting that iron transport depended on anion exchange (Figure 5).



View larger version (28K):
[in this window]
[in a new window]
  		Figure 5. Iron valence state and uptake in HBE cells. Cells were grown to confluence on transwell plates in standard media, then changed to HBSS. Either 100 µM ferric citrate or 100 µM ferrous citrate (50 µl) was added to the apical chamber. One to four hours later, cells were washed, scraped into 2 ml 3 N HCl in 10% trichloroacetic acid, and hydrolyzed at 70°C for 18 h. Iron was then measured using ICPAES ({lambda} 238.204). Cellular iron increased more rapidly after exposure to ferrous (gray bars) than ferric iron (black bars, *P < 0.05 for Fe2+ versus Fe3+). Ferric iron uptake was blocked by omitting bicarbonate from the buffer (white bars).

 
Fe3+ uptake was inhibited independently by ferric and ferrous chelator, which supported the concept that iron was transported as Fe2+. Selectivity for Fe2+ was demonstrated using equimolar ferrous or ferric chelators (1,10 phenanthroline and deferoxamine, respectively, 100 µM) in HBSS buffer. Both chelators equally effectively abolished uptake of iron as FAC (not shown). The capacity of HBE cells to reduce Fe3+ chemically was evaluated and found to be time-dependent (Figure 6A). To exclude a role for organic acids (e.g., malate or lactate released by the cells) in iron reduction, the acids were added with FAC to HBE cells. The presence of malate (0–500 µM disodium salt) or lactate (0–500 µM sodium salt) in HBSS decreased cellular iron uptake instead of facilitating it (not shown). Small organic acids, which form stable coordination complexes with Fe3+, are capable of binding iron and impeding uptake, which appears to have been their primary effect in our system. The ability of HBE cells to reduce Fe3+ to Fe2+ was also diminished significantly when MnSOD (0–200 U/ml) was present in the buffer (Figure 6B). In addition to the effect of SOD on ferrireduction, both DIDS and SITS similarly inhibited the reduction of Fe3+ (Figure 6B).



View larger version (29K):
[in this window]
[in a new window]
  		Figure 6. Ferri-reduction by HBE cells. To provide a larger number of cells, HBE cells were grown in 75 cm2 tissue culture flasks to 90–100% confluence submerged in BEGM. The media was switched to HBSS and 50 µM FAC and 100 µM BPS was added. After incubation at 37°C (at 5% CO2), supernatant was removed and the concentration of the ferrous chelate of BPS was measured by absorbance at 520 nm. Relative to [Fe2+-BPS] at 0 min, the concentration of ferrous chelate significantly increased at all other time points (A). The experiment was repeated. After the media was removed, 10 ml of either HBSS or HBSS containing 100 U MnSOD/ml, 100 µM DIDS, or 10 µM SITS was added. Ten minutes later, 50 µM FAC and 100 µM BPS were added to the flasks. After 1 h at 37°C (5% CO2), supernatant was removed and the ferrous chelate of BPS was measured. MnSOD, DIDS, and SITS all significantly decreased ferrous chelate formation after exposure of HBE cells to FAC (B).

 
SOD and Cellular Iron Transport
SOD in the buffer at 100 U/ml or more decreased iron transport into the cell (Figure 7A) and into the basal chamber (Figure 7B). This required active SOD because heat-inactivated enzyme had no effect on iron transport (not shown). The effect of increasing cellular SOD on iron transport was also studied in HBE cells infected with adenoviral vector AdSOD1, which increases the expression of SOD (10). In these experiments, enzyme activity in the 9000 x g supernatant of cell homogenates increased from < 1 U/mg protein (control vector) to > 8 U/mg protein after infection with AdSOD1 (P < 0.05). Comparable to adding SOD to the apical chamber, cytoplasmic overexpression of active SOD1 protein significantly diminished uptake of iron by the HBE cells (Figure 7C).



View larger version (41K):
[in this window]
[in a new window]
  		Figure 7. Inhibition of iron uptake in HBE cells by superoxide dismutase. Cells grown on transwells were exposed to SOD (0–200 U/ml) in HBSS media. After 10 min, 50 µl of 100 µM FAC was added to the apical chamber. After 4 h, the cells were washed in HBSS, scraped into 2.0 ml 3 N HCl in 10% trichloroacetic acid, and hydrolyzed at 70°C for 18 h. The basal compartment also was sampled and hydrolyzed. Iron content was measured using ICPAES ({lambda} 238.204). Incubation with SOD significantly diminished the uptake of iron by the cells (A) and in the basal chamber (B). *P < 0.05 compared with HBE cells not exposed to SOD. To obtain adequate numbers of cells infected with AdSOD1 vector, HBE cells were grown submerged in BEGM rather than at an air–liquid interface. Infections were done with AdSOD1 at 100 plaque-forming units/cell (C). Relative to HBE infected with Ad5CMV3 (nonrecombinant control vector), the cells with SOD overexpression showed diminished iron uptake after exposure to FAC (black bars). *P < 0.05 compared with vector control.

 
The ability of SOD to inhibit both chemical reduction of ferric ion and metal transport implicated ·O2- generation in the ferri-reductase activity of the cells. If anion exchange proteins transport ·O2- physiologically, they must account for a portion of the ·O2- present at the surface of the plasma membrane. When stillbene inhibitors of anion exchange protein, DIDS or SITS, were added during exposure of HBE to FAC, both Fe3+ reduction and cellular iron transport were inhibited (Figures 8A and 8B). These data support the bicarbonate effect and strongly implicate AE2 in iron uptake by HBE cells.



View larger version (57K):
[in this window]
[in a new window]
  		Figure 8. Inhibition of iron uptake in HBE by DIDS (black bars) and SITS (gray bars). Cells were grown at an air–liquid interface, and the media switched to HBSS before adding 0–100 µM DIDS or SITS. Ten minutes later, 100 µM FAC was added to the incubation. After 4 h, the cells were washed in HBSS, scraped into 2 ml 3 N HCl and 10% trichloroacetic acid, and hydrolyzed at 70°C for 18 h. The basal compartment was also sampled and hydrolyzed. Iron was then measured using ICPAES ({lambda} 238.204). Both DIDS and SITS significantly decreased cellular uptake of iron by the cells (A) and the amount measured in the basal chamber (B). *P < 0.05 relative to HBE cells exposed to neither DIDS nor SITS.

 
Another important source of extracellular ·O2-, NAD(P)H oxidoreductase, was considered as a factor in iron reduction and uptake by HBE cells. Using RT-PCR, mRNA for gp91phox was quantified in both HBE cells and human alveolar macrophages. In alveolar macrophages, gp91phox mRNA was readily detectable at 30 cycles; however, no message was detectable in HBE cells at 40 cycles. Furthermore, of NAD(P)H oxidoreductase inhibitors, DPI and apocyanin, had no effect on Fe3+ reduction or iron transport by HBE cells (not shown).

Effect of Loss of AE2 Function
To test the effect of loss of AE2 protein function, HBE cells were incubated with antisense morpholino oligonucleotides before iron studies. These oligonucleotides had minimal effect on the mRNA for AE2 by RT-PCR (not shown), but significantly diminished expression of the protein (Figure 9). The oligonucleotide with the greatest effect on AE2 expression was directed at the start codon (AS-4). In addition to the decline in AE2 protein after treatment with the antisense oligonucleotides, cell iron uptake was substantially inhibited after antisense treatments (Figures 10A and 10B).



View larger version (22K):
[in this window]
[in a new window]
  		Figure 9. Antisense oligonucleotides diminished AE2 protein expression in HBE cells. After a 20-min incubation of the delivery agent (EPEI) with the HBE cells, the complexes were diluted with Opti-Mem and gently pipetted onto the cells in transwell plates. The complexes were removed from the cells after a 3-h incubation at 37°C. After 18 h, protein was collected for Western analysis. AE2 protein is shown in control cells (HBSS). Expression of AE2 protein was not affected by EPEI treatment, decreased by AS-3 treatment, and strongly inhibited after AS-4 treatment. Equal protein loading was confirmed by Coomassie staining (not shown).

 


View larger version (59K):
[in this window]
[in a new window]
  		Figure 10. Diminished iron uptake in HBE cells by antisense oligonucleotide treatment. HBE cells were treated with the delivery agent (EPEI) for 20 min, and the complexes were diluted with Opti-Mem in the transwell plates. The complexes were removed from the cells after a 3-h incubation at 37°C. Eighteen hours later, media was switched to HBSS, and the cells exposed to 50 µl of 100 µM FAC. After 4 h, the cells were washed, scraped into 2 ml 3 N HCl in 10% trichloroacetic acid, and hydrolyzed at 70°C for 18 h. The basal compartment was also sampled and hydrolyzed. Iron was measured using ICPAES ({lambda} 238.204). Cells treated with AS-4 showed significant decreases in iron uptake (A). Similarly, AS-4 prevented iron transport to the basal chamber of the transwell (B). *P < 0.05 relative to HBSS.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
All living cells transport NTBI from the outer plasma membrane to various intracellular pools (13–15). Like several other cell types, iron transport by HBE cells involves a ferri-reductase, i.e., reduction of ferric iron to the ferrous state. Outside the cell, this process chemically splits the chelate, allowing uptake of only the metal (16). When HBE cells are exposed to Fe3+, Fe2+ soon appears in the media despite net metal uptake, indicating effective ferri-reductase activity. Reduction is a rate-limiting step in the uptake of iron by certain cells, and a slower rate of uptake of Fe3+ than Fe2+ by HBE cells suggests that Fe3+ reduction limits iron transport more than metal translocation across the plasma membrane.

HBE cells take up iron in a time- and concentration-dependent manner. Iron uptake is inhibited by the extracellular iron chelator deferoxamine, comparable to findings in other cell types (15, 17). Uptake inhibition results directly from Fe3+ chelation, which prevents both the reduction to Fe2+ and cell transport. Because ferrous chelators also effectively inhibit ferric iron transport, Fe2+ rather than Fe3+ is favored in metal uptake (18). Thus, NTBI is transported only after reduction of Fe3+, which occurs before binding of the metal and membrane translocation by cationic metal carrier proteins (19).

Some cells can use small organic compounds such as malate and lactate to reduce Fe3+ and facilitate ferri-reductase activity (20, 21). In HBE cells, however, organic acids did not promote but rather decreased iron uptake, probably by formation of stable coordination complexes with Fe3+. In contrast, extracellular MnSOD diminished both chemical reduction of Fe3+ to Fe2+ and iron transport into the cells. Similarly, increasing SOD1 expression in the cytoplasm blocked iron uptake by the cells. These experiments indicate a critical role of ·O2- at the cell membrane for Fe3+ reduction. Previously, direct participation of ·O2- in Fe3+ reduction and transport has been found only in plant cells (2, 3, 22, 23).

A number of sources of ·O2- generation at or near the plasma membrane are present in mammalian cells including mitochondria, NAD(P)H oxidoreductase, xanthine oxidase, and mixed function oxidase systems (24). The well characterized membrane ·O2- generating system, NAD(P)H oxidoreductase, may reduce iron (25). However, mRNA for the transmembrane component of the oxidase gp91phox was not detectable in HBE cells. Furthermore, two potent inhibitors of NAD(P)H oxidoreductases (DPI and apocynin) had no effect on either Fe3+ reduction or Fe2+ uptake by these cells.

Another source of ·O2- at the cell membrane is anion exchange proteins. In this and other studies of lung epithelial cells, mRNA and protein for AE2 have been found (7, 26). In most tissues, including the lung, AE2 functions as an electroneutral transmembrane exchanger for Cl- and HCO3- (27, 28). However, like AE1 in erythrocytes (6), lung AE2 also clearly releases ·O2- in the presence of HCO3- (8). In this study, elimination of extracellular HCO3- prevented both iron reduction and iron transport by HBE cells. Stilbene AE inhibitors, DIDS or SITS, almost completely abolished both Fe3+ reduction and iron transport into HBE cells. Stilbene compounds bind at low concentrations to the outward-facing site of AE proteins to prevent anion binding (28) and inhibit extracellular appearance of ·O2- (8, 29). This result is comparable to data in hepatocytes (30), although DIDS did not prevent iron uptake in those cells (31). However, DIDS clearly diminishes iron transport by reticulocytes (32) and K562 cells (33) as it does in HBE cells. The functional requirement for AE2 in iron uptake by HBE cells is also analogous to the role of AE1 protein in copper transport by erythrocytes (34).

Treatment with specific antisense oligonucleotides blocked the expression of AE2 protein and diminished iron uptake, which confirmed a role for AE2 in iron uptake by HBE cells. Whether AE2 facilitates nutritional iron uptake in HBE cells cannot be determined because our studies were conducted under iron-replete conditions (35). Nutritional iron handling also requires metal transport across the plasma membrane, and we have not excluded AE2's participation. After exposure to high concentrations of iron, however, most cells rapidly downregulate transferrin receptor (36). Thus, transferrin-dependent iron transport usually does not contribute to the antioxidant role of ferritin in metal sequestration. Other mechanisms are used to transport excess metal to intracellular ferritin for storage and detoxification, such as NTBI, which can be incorporated into ferritin (31). These studies support a role for AE2 in the uptake of NTBI by airway epithelial cells for subsequent sequestration.

Finally, our cells were studied under conditions wherein the ·O2- reaction with extracellular Fe3+ required AE2 function. Though sources of ·O2- such as NADPH oxidase could not be implicated here, other membrane sources of this radical are almost certainly present. However, they did not release sufficient ·O2- to reduce Fe3+ and facilitate iron uptake under these experimental conditions.

Concentrations of iron and iron-related proteins have been studied in lung lavage and tissue of both healthy volunteers (37) and patients with lung disorders (38, 39). Differences between healthy and diseased lung suggest that iron disequilibrium in disease causes oxidative stress in the lower respiratory tract. Normal iron metabolism in the lung can be disrupted in a variety of ways. Among these include accumulation of metal by introduction of an inappropriate chelator (e.g., bacteria, bleomycin or asbestos fibers) and inhibition of proteins responsible for metal uptake by respiratory cells (e.g., pneumonitis after oil fly ash). In these disorders, the iron concentration in the lower respiratory tract is elevated, often in association with elevations in lung ferritin. The mechanism of iron transport into lung cells for sequestration by ferritin likely involves AE2 (Figure 11).



View larger version (82K):
[in this window]
[in a new window]
  		Figure 11. AE2 exchanges superoxide generated by the cell for extracellular bicarbonate. Superoxide reduces ferric to ferrous iron, and the ferrous product is transported into the cell by Nramp2 (DMT1) where it is sequestered, e.g., in ferritin.

 
In conclusion, the effective transport of NTBI by HBE cells depends on chemical reduction of Fe3+ to Fe2+ by extracellular ·O2- generated in the cell. Transmembrane ·O2- exchange requires extracellular HCO3-, and is inhibited by stilbenes and antisense oligonucleotides to AE2 transcripts. The findings support the novel concept that AE2 is an obligatory component of ferri-reductase activity required for NTBI transport by airway epithelial cells. NTBI transport could serve either or both functions: acquiring metabolic iron or removing catalytically active metal from the epithelium. On the epithelial surface of the lung, the latter mechanism may serve primarily to diminish oxidative stress rather than support nutritional requirements because apical metal is redistributed to the basal surface of the cell. An antioxidant effect would be realized through dissipation of ·O2-, clearance of the metal for storage in a catalytically less reactive form, or transfer to the vascular compartment for distribution to other sites in the body.

Received in original form March 6, 2003

Received in final form May 5, 2003


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Thorstensen, K., and I. Romslo. 1984. Uptake of iron from transferrin by isolated hepatocytes. Biochim. Biophys. Acta 804:200–208.[Medline]
  2. Cakmak, I., D. A. M. van de Wetering, H. Marschner, and H. F. Bienfait. 1987. Involvement of superoxide radical in extracellular ferric reduction by iron-deficient bean roots. Plant Physiol. 85:310–314.[Abstract/Free Full Text]
  3. de la Guardia, M. D., and E. Alcantara. 1996. Ferric chelate reduction by sunflower (Helianthus annuus L.) leaves: influence of light, oxygen, iron-deficiency and leaf age. J. Exp. Bot. 47:669–675.
  4. Buckhout, T. J., P. F. Bell, D. G. Luster, and R. L. Chaney. 1989. Iron-stress induced redox activity in tomato (Lycopersicum esculentum Mill.) is localized on the plasma membrane. Plant Physiol. 90:151–156.[Abstract/Free Full Text]
  5. Bienfait, H. F. 1985. Regulated redox processes at the plasmalemma of plant root cells and their function in iron uptake. J. Bioenerg. Biomembr. 17:73–83.[CrossRef][Medline]
  6. Lynch, R. E., and I. Fridovich. 1978. Permeation of the erythrocyte stroma by superoxide radical. J. Biol. Chem. 253:4697–4699.[Abstract/Free Full Text]
  7. Wang, Z., P. J. Schultheis, and G. E. Shull. 1996. Three N-terminal variants of the AE2 Cl-/HCO3- exchanger are encoded by mRNAs transcribed from alternative promoters. J. Biol. Chem. 271:7835–7843.[Abstract/Free Full Text]
  8. Nozik-Grayck, E., C. A. Piantadosi, J. Van Adelsberg, S. L. Alper, and Y.-C. T. Huang. 1997. Protection of perfused lung from oxidant injury by inhibitors of anion exchange. Am. J. Physiol. 273:L296–L304.
  9. Mateos, F., J. H. Brock, and J. L. Perez-Arellano. 1998. Iron metabolism in the lower respiratory tract. Thorax 53:594–600.[Free Full Text]
  10. Jaspers, I., W. Zhang, A. Fraser, J. M. Samet, and W. Reed. 2001. Hydrogen peroxide has opposing effects on IKK activity and I{kappa}B{alpha} breakdown in airway epithelial cells. Am. J. Respir. Cell Mol. Biol. 24:769–777.[Abstract/Free Full Text]
  11. Ghio, A. J., J. D. Carter, J. M. Samet, W. Reed, J. Quay, L. A. Dailey, J. H. Richards, and R. B. Devlin. 1998. Metal-dependent expression of ferritin and lactoferrin by respiratory epithelial cells. Am. J. Physiol. 274:L728–L736.
  12. Brosius, F. C., R. L. Pisoni, X. Cao, G. Deshmukh, D. Yannoukakos, A. K. Stuart-Tilley, C. Haller, and S. L. Alper. 1997. AE anion exchanger mRNA and protein expression in vascular smooth muscle cells, aorta, and renal microvessels. Am. J. Physiol. 273:F1039–F1047.
  13. Muir, W. A., U. Hopfer, and M. King. 1984. Iron transport across brush-border membranes from normal and iron-deficient mouse upper small intestine. J. Biol. Chem. 259:4896–4903.[Abstract/Free Full Text]
  14. Wright, T. L., P. Brissot, W.-L. Ma, and R. A. Weisiger. 1986. Characterization of non-transferrin-bound iron clearance by rat liver. J. Biol. Chem. 261:10909–10914.[Abstract/Free Full Text]
  15. Morgan, E. H. 1988. Membrane transport of non-transferrin-bound iron by reticulocytes. Biochim. Biophys. Acta 943:428–439.[Medline]
  16. Raja, K. B., I. T. Bjarnason, R. J. Simpson, and T. J. Peters. 1987. In vitro measurement and adaptive response of Fe3+ uptake by mouse intestine. Cell Biochem. Funct. 5:69–76.[CrossRef][Medline]
  17. Richardson, D. R., and E. Baker. 1992. Intermediate steps in cellular iron uptake from transferrin. Detection of a cytoplasmic pool of iron, free of transferrin. J. Biol. Chem. 267:21384–21389.[Abstract/Free Full Text]
  18. Riedel, H.-D., A. J. Remus, B. A. Fitscher, and W. Stremmel. 1995. Characterization and partial purification of a ferrireductase from human duodenal microvillus membranes. Biochem. J. 309:745–748.
  19. Raja, K. B., R. J. Simpson, and T. J. Peters. 1992. Investigation of a role for reduction in ferric iron uptake by mouse duodenum. Biochim. Biophys. Acta 1135:141–146.[Medline]
  20. Landsberg, E.-Ch. 1981. Organic acid synthesis and release of hydrogen ions in response to Fe deficiency stress of mono- and dicotyledonous plant species. J. Plant Nutr. 3:579–591.
  21. Van Duijn, M. M., J. Van der Zee, J. VanSteveninck, and P. J. A. Van den Broek. 1998. Ascorbate stimulates ferricyanide reduction in HL-60 cells through a mechanism distinct from the NADH-dependent plasma membrane reductase. J. Biol. Chem. 273:13415–13420.[Abstract/Free Full Text]
  22. Macri, F., E. Braidot, E. Petrussa, M. Zancani, and A. Vianello. 1992. Ferric ion and oxygen reduction at the surface of protoplasts and cells of Acer pseudoplatanus. Bot. Acta. 105:97–103.
  23. Bruggemann, W., K. Maas-Kantel, and P. R. Moog. 1993. Iron uptake by leaf mesophyll cells: the role of the plasma membrane-bound ferric-chelate reductase. Planta 190:151–155.
  24. Cross, A. R., and O. T. G. Jones. 1991. Enzymic mechanisms of superoxide production. Biochim. Biophys. Acta 1057:281–298.[Medline]
  25. Lesuisse, E., M. Casteras-Simon, and P. Labbe. 1996. Evidence for the Saccharomyces cerevisiae ferrireductase system being a multicomponent electron transport chain. J. Biol. Chem. 261:13578–13583.
  26. Lubman, R. L., S. I. Danto, D. C. Chao, C. E. Fricks, and E. D. Crandall. 1995. Cl--HCO3- exchanger isoform AE2 is restricted to the basolateral surface of alveolar epithelial cell monolayers. Am. J. Respir. Cell Mol. Biol. 12:211–219.[Abstract]
  27. Kemp, P. J., and C. A. R. Boyd. 1993. Chemical probes for anion transporters of mammalian cell membranes. Pflugers Arch. 425:28–33.[CrossRef][Medline]
  28. Cabantchik, Z. I., and R. Greger. 1992. Chemical probes for anion transporters of mammalian cell membranes. Am. J. Physiol. 262:C803–C827.
  29. Kennedy, T. P., N. V. Rao, C. Hopkins, L. Pennington, E. Tolley, and J. R. Hoidal. 1989. Role of reactive oxygen species in reperfusion injury of the rabbit lung. J. Clin. Invest. 83:1326–1335.
  30. Wright, T. L., and J. R. Lake. 1990. Mechanisms of transport of nontransferrin-bound iron in basolateral and canalicular rat liver plasma membrane vesicles. Hepatology 12:498–504.[Medline]
  31. Barisani, D., C. L. Berg, M. Wessling-Resnick, and J. L. Gollan. 1995. Evidence for a low Km transporter for non-transferrin-bound iron in isolated rat hepatocytes. Am. J. Physiol. 269:G570–G576.
  32. Chan, R. Y., and T. T. Loh. 1988. Pertubation of intracellular pH by DIDS on endocytosis of transferrin and iron uptake in rabbit reticulocytes. Biochem. Biophys. Res. Commun. 150:1256–1262.[CrossRef][Medline]
  33. Inman, R. S., and M. Wessling-Resnick. 1993. Characterization of transferrin-independent iron transport in K562 cells. J. Biol. Chem. 268:8521–8528.[Abstract/Free Full Text]
  34. Alda, J. O., and R. Garay. 1990. Chloride (or bicarbonate)-dependent copper uptake through the anion exchanger in human red blood cells. Am. J. Physiol. 259:C570–C576.
  35. Kaplan, J., I. Jordan, and A. Sturrock. 1991. Regulation of the transferrin-independent iron transport system in cultured cells. J. Biol. Chem. 266:2997–3004.[Abstract/Free Full Text]
  36. Leibold, E. A., and B. Guo. 1992. Iron-dependent regulation of ferritin and transferrin receptor expression by the iron-responsive element binding protein. Annu. Rev. Nutr. 12:345–368.[CrossRef][Medline]
  37. Ghio, A. J., J. D. Carter, J. H. Richards, L. E. Brighton, J. C. Lay, and R. B. Devlin. 1998. Disruption of normal iron homeostasis after bronchial instillation of an iron-containing particle. Am. J. Physiol. 274:L396–L403.
  38. Stites, S. W., B. Walters, A. R. O'Brien-Ladner, K. Bailey, and L. J. Wesselius. 1998. Increased iron and ferritin content of sputum from patients with cystic fibrosis or chronic bronchitis. Chest 114:814–819.[Abstract/Free Full Text]
  39. Ghio, A. J., J. D. Carter, J. H. Richards, L. D. Richer, C. K. Grissom, and M. R. Elstad. 2003. Iron and iron-related proteins in the lower respiratory tract of patients with acute respiratory distress syndrome. Crit. Care Med. 31:395–400.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
D. J. R. Lane and A. Lawen
Non-transferrin Iron Reduction and Uptake Are Regulated by Transmembrane Ascorbate Cycling in K562 Cells
J. Biol. Chem., May 9, 2008; 283(19): 12701 - 12708.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. L. Turi, X. Wang, A. T. McKie, E. Nozik-Grayck, L. B. Mamo, K. Crissman, C. A. Piantadosi, and A. J. Ghio
Duodenal cytochrome b: a novel ferrireductase in airway epithelial cells
Am J Physiol Lung Cell Mol Physiol, August 1, 2006; 291(2): L272 - L280.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
X. Wang, Y. Wu, J. G. Stonehuerner, L. A. Dailey, J. D. Richards, I. Jaspers, C. A. Piantadosi, and A. J. Ghio
Oxidant Generation Promotes Iron Sequestration in BEAS-2B Cells Exposed to Asbestos
Am. J. Respir. Cell Mol. Biol., March 1, 2006; 34(3): 286 - 292.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Q. Liu, I. N. Zelko, and R. J. Folz
Reoxygenation-induced Constriction in Murine Coronary Arteries: THE ROLE OF ENDOTHELIAL NADPH OXIDASE (gp91phox) AND INTRACELLULAR SUPEROXIDE
J. Biol. Chem., June 4, 2004; 279(23): 24493 - 24497.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-0070OCv1
29/6/653    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ghio, A. J.
Right arrow Articles by Piantadosi, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ghio, A. J.
Right arrow Articles by Piantadosi, C. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2003 American Thoracic Society.