help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Published ahead of print on June 12, 2003, doi:10.1165/rcmb.2003-0024OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-0024OCv1
29/6/750    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kalayci, O.
Right arrow Articles by Lilly, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kalayci, O.
Right arrow Articles by Lilly, C. M.
American Journal of Respiratory Cell and Molecular Biology. Vol. 29, pp. 750-756, 2003
© 2003 American Thoracic Society
DOI: 10.1165/rcmb.2003-0024OC

Monocyte Chemoattractant Protein-4 Core Promoter Genetic Variants

Influence on YY-1 Affinity and Plasma Levels

Omer Kalayci, Esra Birben, Liqing Wu, Tsuyoshi Oguma, Karin Storm van's Gravesande, Venkat Subramaniam, Holly K. Sheldon, Eric S. Silverman and Craig M. Lilly

Combined Program in Pulmonary and Critical Care Medicine, Brigham and Women's Hospital, Harvard Medical School, and Respiratory Physiology Program, Harvard School of Public Health, Boston, Massachusetts

Address correspondence to: Craig M. Lilly, Pulmonary and Critical Care Division, Brigham and Women's Hospital, 75 Francis Street, PBB 3rd Floor Clinics Building, Boston, MA 02115. E-mail: clilly{at}partners.org


   Abstract
Top
 Abstract
Introduction
 Material and Methods
 Results
 Discussion
 References
 
Monocyte chemoattractant protein-4 (MCP-4) is a CC chemokine implicated in the recruitment of eosinophils, monocytes, and T-lymphocytes in diseases of mucosal inflammation, including asthma. We tested the hypothesis that there is a genetic basis for differences in MCP-4 expression among individuals by evaluating the effects of core promoter variants on MCP-4 expression. We identified two single-nucleotide T-to-C polymorphisms in the MCP-4 core promoter that occur 896 and 887 base pairs preceding the transcription initiation site. The –887 variant alters a consensus binding motif for the transcription factor YY-1. Electrophoretic mobility shift assay demonstrated that YY-1 containing nuclear extracts from tumor necrosis factor-{alpha}–stimulated peripheral blood mononuclear cells had greater avidity for the wild-type (YY-1 motif intact) sequence than for the variant sequence. Increasing doses of a YY-1 expression vector induced significantly greater reporter activity from MCP-4 core promoter expression constructs of the wild-type compared with the variant sequence in transient transfection experiments. The external validity of these observations was demonstrated by measuring plasma levels of MCP-4 from individuals with the alternative forms of the gene. Individuals bearing haplotypic variants of the MCP-4 core promoter that avidly bind the transcription factor YY-1 had higher plasma levels of MCP-4 than did individuals with variants with lower binding avidity (490, 360, and 360 pg/ml; P < 0.01). Our findings suggest that the MCP-4 core promoter YY-1 binding motif is functional, modulates the transcriptional regulation of the MCP-4 gene, and that part of the variance in the systemic expression of MCP-4 is determined by core promoter genetic variants.

Abbreviations: base pairs, bp • electrophoretic mobility shift assay, EMSA • interleukin, IL • monocyte chemoattractant protein-4, MCP-4 • peripheral blood mononuclear cells, PBMCs • polymerase chain reaction, PCR • tumor necrosis factor-{alpha}, TNF-{alpha}


   Introduction
Top
 Abstract
 Introduction
Material and Methods
 Results
 Discussion
 References
 
Monocyte chemoattractant protein-4 (MCP-4) is a member of the CC family of chemokines that is one of the gradient-forming chemoattractants that orchestrate the recruitment of inflammatory cells to sites of mucosal inflammation. MCP-4 is coded for by a 3-exon gene located on human chromosome 17 at q11.2. MCP-4 directs the migration of leukocytes by acting through specific seven-transmembrane domain G protein–coupled receptors that are present on eosinophils, monocytes, and T-lymphocytes (1). Airway tissues, including epithelial cells, respond to allergic stimulation with increased expression of RANTES (2), eotaxin-1 (3), and MCP-4 (4). Increased translation of protein is tightly linked to increased expression of mRNA both in vitro and in vivo (3–5). The mechanisms that account for the coordinated but differential expression of chemokines are now being elucidated. One important mechanism for modulating mRNA expression is the activity of transcription factors on core promoter elements. Indeed, the transcription factors that regulate expression of eotaxin-1 (6) and RANTES (7, 8) have been described in in vitro systems, and a role for the transcription factor nuclear factor-{kappa}B in eotaxin expression has been demonstrated in a murine model (9). The human MCP-4 core promoter region has been analyzed (10), but the transcription factors governing MCP-4 expression in humans have not been studied in vivo. Advances in our understanding of the transcription factors that orchestrate chemokine expression hold great promise for the therapeutic manipulation of recruitment of inflammatory cells. One approach that allows association of a specific transcription factor with chemokine expression is that of correlating core promoter genetic variants with altered affinity of transcription factor binding and chemokine expression in human cells. We therefore sought naturally occurring variants in the MCP-4 core promoter region that influence MCP-4 expression by altering transcription factor binding. We studied the effects of such a variant in a human population with known variation in MCP-4 expression. We report two novel single-nucleotide polymorphisms at the core promoter region of MCP-4 and present evidence that differences in plasma MCP-4 levels are associated with altered YY-1–mediated gene transcription.


   Material and Methods
Top
 Abstract
 Introduction
 Material and Methods
Results
 Discussion
 References
 
Subject Selection and Measurement of MCP-4 Protein
Genomic DNA was extracted from Epstein-Barr virus–immortalized lymphocytes prepared from peripheral blood of 20 patients who met American Thoracic Society (ATS) criteria for asthma and of 20 apparently healthy control subjects who had no history of asthma, atopy, or significant medical illness. To determine the effects of the variant on the systemic expression of MCP-4, we collected genomic DNA and plasma from 479 subjects with asthma and from 214 healthy subjects. Subjects in the group with moderate chronic-stable asthma were recruited from 40 sites in the United States as previously described (11). All patients met the ATS criteria for diagnosis of asthma and had reversibility of airflow obstruction of at least 15% with a short-acting ß-agonist. Healthy subjects had no history of significant medical disease. Nuclear extracts were prepared from peripheral blood mononuclear cells of healthy subjects. All subjects gave written informed consent on forms that had the prior approval of the appropriate institutional review boards.

Plasma samples anticoagulated with EDTA were stored at –80°C, thawed, and levels of MCP-4 determined by enzyme-linked immunosorbent assay as previously described (4).

Identification of Variants
Forty samples of genomic DNA were screened for mutations of the protein-coding regions, intron-exon boundaries, and the 5'- and 3'-flanking regions of the MCP-4 gene using single-strand conformational polymorphism (SSCP) analysis as previously described (12). Oligonucleotide primers, as designated in Table 1, were designed according to the reported nucleotide sequence (GenBank accession no. AJ000979). All DNA samples with altered electrophoretic mobility were reamplified, and the nucleotide sequences were directly determined (ABI PRISM 377; Applied Biosystems, Foster City, CA).


View this table:
[in this window]
[in a new window]
  		TABLE 1 Primer sequences used for detection of genetic variants

 
Determination of MCP-4 Core Promoter Genotype
MCP-4 genotype was determined by restriction fragment length polymorphism analysis. We introduced a distinguishing enzyme restriction site in the polymerase chain reaction (PCR) with modified primers when such a site did not occur naturally.

The following oligonucleotide primers (5' to 3') were used: T-887C, sense, TTTCACTGGCTTATTTTGC; antisense, GCCCTCAGAGCAAAGAAGTG; T-896C, sense, AAGTCTTGGAGCTAGGGATGAGTGGGAAAGGGACAGGT; antisense, GCCCTCAGAGCAAAGAAGTG. PCR was performed with Taq polymerase (Promega, Madison, WI) with a final concentration of 2 mM MgCl2. Both PCR reactions were done at an annealing temperature of 59°C for 36 cycles. Restriction enzyme digestion was performed on 10 µl of amplified DNA with MseI for –887 and AvaII for –896 (New England Biolabs, Beverly, MA). After digestion, PCR fragments were resolved by electrophoresis on a 1.5% agarose gel containing ethidium bromide and visualized by ultraviolet translumination. The length of the digestion-resistant wild-type –896 amplicon was 146 base pairs (bp), and the products of the digested variant amplicon were 36 and 110 bp. The size of the digestion-resistant variant –887 amplicon was 217 bp, and the products of the digested wild-type amplicon were 119 and 98 bp.

Molecular Haplotyping of MCP-4 Promoter
MCP-4 promoter haplotype was measured directly by an allele-specific PCR step followed by restriction enzyme digestion of the amplicon(s). Genomic DNA was amplified with the primer specified to the wild-type allele at –896 (sense, 5' GGATGAGTGG GAAAGGGACATGTT; antisense, 5' GCCCTCAGAGCAAAGAAGTG) at an annealing temperature of 66°C for 25 cycles. Under these conditions, only alleles having the wild-type nucleotide (T) at position –896 were amplified. The PCR product was subjected to an MseI digestion that selectively hydrolyzed the wild-type allele (T) at –887. A control sample, with each of the alternative sequences, was correctly genotyped in each set of amplification and digestion reactions, and genotype was consistently concordant with the results of sequencing reactions in a subset of samples.

Electrophoretic Mobility Shift Assays
Nuclear extracts were prepared from tumor necrosis factor-{alpha} (TNF-{alpha})–stimulated (10 ng/ml for 4 h) peripheral blood mononuclear cells (PBMCs) as previously described (6). Double-stranded oligonucleotides containing both MCP-4 core promoter variants and all haplotypic combinations were synthesized: –896 variant/–887 variant (CC) (AAGGGACATGTCCAACCATTCTAAGCCATT); –896 wild-type/–887 wild-type (TT) (AAGGGACATGTTCA ACCATTTTAAGCCATT); –896 wild-type/–887 variant (TC) (AAGGGACATGTTCAACCATTCTAAGCCATT); –896 variant/–887 wild type (CT) (Gene Link, Hawthorne, NY). Oligonucleotides were radiolabeled with [{alpha}-32P]deoxycytidine 5'-triphosphate with the Klenow fragment enzyme (New England Biolabs) and purified by gel filtration (Chroma Spin +ST-10 columns; Clontech Laboratories, Palo Alto, CA).

Protein-DNA binding reactions were performed with 5–10 µg of nuclear extract protein and 1 µl of labeled oligonucleotide (50,000 cpm), 1 µl of polynucleotide (dIdC), in 100 mM Tris (pH 7.5), 10 mM EDTA, 10 mM DTT, and 50% glycerol in a total volume of 20 µl. After incubation at room temperature for 30 min, protein–DNA complexes were resolved on a 7% nondenaturing acrylamide gel in a 1x Tris-borate-EDTA buffer at room temperature and visualized by autoradiography. Under these conditions radio-dense banding was not observed when the nuclear extract or labeled probe was omitted.

Supershift and cold competition experiments were performed by preincubating nuclear extracts with 2 µg of specific polyclonal antibodies (Santa Cruz Biotechnology, Santa Cruz, CA) or excess annealed cold oligonucleotide, respectively, for 10 min before the addition of the labeled probes.

Transient Transfection Analysis with Promoter Reporter Constructs
Genomic DNA from individuals with the alternative MCP-4 haplotypes (T-896/T-887, T-896 /C-887, and C-896/C-887) was subjected to PCR amplification as described above. Amplicons were cloned and ligated into pGL-3 basic plasmid (Promega) at KpnI and XhoI sites with standard techniques (TOPO TA Cloning Kit; Invitrogen, Carlsbad, CA). A549 bronchial type II alveolar cells were studied in transiently transfected A549 cells, grown to 80% confluence in 6-well plates, and cotransfected with a ß-galactosidase expression construct in a pSV plasmid (Promega) using lipofectAMINE and lipofectAMINE plus (Invitrogen) in accordance with the manufacturer's instructions. Lysate luciferase and ß-galactosidase enzyme activities were measured following an overnight incubation in accordance with the manufacturer's directions (Promega). Firefly luciferase activity was normalized to ß-galactosidase activity to control for differences in transfectional efficiency. Cotransfection experiments were conducted with a previously validated YY-1 overexpression construct in a pCDNA 1 (Invitrogen) plasmid that was the kind gift of Steve Georas (13).

Statistical Analysis
Group comparisons of plasma MCP-4 levels and reporter construct activity were done by ANOVA, two-way-repeated measures ANOVA, or ANOVA based on ranks as appropriate. Hardy-Weinberg equilibrium and allele frequencies between asthmatic and healthy subjects were compared with the chi-square statistic. A P value less than 0.05 was considered significant.


   Results
Top
 Abstract
 Introduction
 Material and Methods
 Results
Discussion
 References
 
Identification of MCP-4 Core Promoter Variants T-887C and T-896C
We identified two single-nucleotide T-to-C transition polymorphisms in the MCP-4 core promoter region at 887 and 896 in the 5' direction from the first base pair in the translation initiation site in exon 1 (Figure 1) . The –887 variant altered the sequence of a consensus binding motif for the transcription factor YY-1 (CCATTTT). The more common T form has a sequence predicted to bind YY-1; the variant C form does not (Figure 1). The disequilibrium coefficient for the two variants was 25% of its maximal value as calculated from directly measured haplotype frequencies. In every case in which a variant allele was present at the –896 locus, a variant allele also was present at –887. Seventy-eight (67%) of the 116 alleles with the variant at the –887 locus also had a variant allele at the –896 locus (Table 2). We did not detect other variants of the core promoter or exons of the MCP-4 gene.



View larger version (45K):
[in this window]
[in a new window]
  		Figure 1. Structure of the MCP-4 gene and location of the variants at the core promoter region. Coding regions of the exons are in black, and the noncoding regions are in gray. The positions of the variants –887 and –896 are shown relative to the translation initiation site. The box indicates the location of the YY-1 consensus-binding motif. Variant detection by SSCP and genotyping by restriction fragment length polymorphism of the T-887C variant are displayed below.

 

View this table:
[in this window]
[in a new window]
  		TABLE 2 Distribution of T-896C and T-887C genotypes

 
Effects of the T-887C Variant on Nuclear Protein Avidity
Electrophoretic mobility shift assay (EMSA) was performed with nuclear extracts obtained from human cell types known to produce MCP-4 (4). In TNF-{alpha}–stimulated PBMCs, oligonucleotides with the –887T wild-type sequence bound complex A of Figure 2 with greater affinity than did a probe with the variant –887C sequence, and the specificity of this binding was demonstrated in a study with excess unlabeled oligonucleotide and an irrelevant oligonucleotide (Figure 2). An equivalent result was obtained when nuclear extracts were obtained from A549 cells (data not shown). Control studies with an irrelevant oligonucleotide and excess unlabeled oligonucleotide demonstrated specific binding (Figure 2).



View larger version (67K):
[in this window]
[in a new window]
  		Figure 2. EMSA and binding-specificity studies. Nuclear proteins from TNF-{alpha}–stimulated PBMCs bound oligonuclotide probes that have the –887T wild-type variant more avidly than those that have the –887C variant sequence. A binding-specificity study demonstrated that adherence of the nuclear protein to the probes was abrogated by addition of unlabeled (cold) wild-type MCP-4 promoter oligonucleotides but not by an irrelevant oligonucleotide. Three specific bands labeled A, B, and C are present.

 
Identification of YY-1 Nuclear Extracts and Binding Affinity for Alternative MCP-4 Promoter Sequences
To determine which DNA-binding proteins specifically bound the MCP-4 core promoter region altered by the variant, we performed EMSA with supershift analysis. The addition of antibodies to YY-1 resulted in a supershift of all of the specific bands that appeared in the EMSA (Figure 3) . This change in electrophoretic mobility appears to be specific to the YY-1 antibody because antibodies to other transcription factors, including Pbx-1, c-Myb, GATA-3, and C/EBP-ß and Oct-1 (Figure 3), failed to induce a supershift. Probes with the wild-type –887T sequence bound YY-1 with greater affinity than did probes having the –887C variant sequence (Figure 3; band "A").



View larger version (79K):
[in this window]
[in a new window]
  		Figure 3. Antibody to the transcription factor YY-1 but not to other transcription factors further retarded the electrophoretic mobility of nuclear extracts bound to the region of the MCP-4 promoter containing the YY-1 binding motif. The electrophoretic mobility of bands A, B, and C was further retarded by the antibody to YY-1.

 
Effects of the T-887C Variant on MCP-4 Promoter Activity
The effects of the variant on MCP-4 promoter activity were determined in a promoter-reporter assay system. MCP-4–expressing airway epithelial A549 cells (4) were transiently transfected with constructs having the sequence of genomic DNA corresponding to each of the naturally occurring haplotypes placed adjacent to a luciferase reporter element. Haplotypes bearing the wild-type T at position -887 had significantly greater promoter activity than did the C-bearing variant in an assay using 1,500 ng of target construct (n = 5, Figure 4) . The difference in reporter activity was significantly higher for the wild-type T-bearing vector at each dose of construct studied (500 ng, C 1,100 ± 200 units, T 1,500 ± 280, P = 0.04; 750 ng, C 4,700 ± 750 units, T 7,700 ± 2000, P = 0.0001; 1,000 ng, C 4,900 ± 900 units, T 6,400 ± 960, P = 0.009; 1,750 ng, C 8,100 ± 790 units, T 9,500 ± 850, P = 0.02).



View larger version (18K):
[in this window]
[in a new window]
  		Figure 4. Promoter-reporter studies. Reporter activity was significantly higher in airway epithelial A549 cells transfected with constructs bearing a 1,164-bp insert with the wild-type T allele at position –887 than in those with the variant C allele at position –887.

 
Effects of YY-1 on MCP-4 Promoter Activity
Increasing doses of a YY-1 expression construct were associated with substantial increases in MCP-4 core promoter reporter construct activity. YY-1 expression was associated with significantly greater reporter construct activity for cells transfected with the wild-type –896T/–887T than with the variant –896C/–887C construct (Figure 5 , n = 3, P < 0.001; two-way repeated measure ANOVA; replicated in experiments using equal total amounts of transfected DNA).



View larger version (25K):
[in this window]
[in a new window]
  		Figure 5. Increasing doses of a YY-1 expression construct are associated with increasing reporter activity of MCP-4 core promoter–reporter constructs. MCP-4 core promoter–reporter constructs having the wild-type (T-896/T-887, black bars) sequence had significantly greater YY-1–induced reporter activity than the variant sequence (C-896/C-887, gray bars; n = 3, P < 0.001).

 
Effects of the T-887C Variant on the Systemic Expression of MCP-4 Protein
Plasma levels of MCP-4 were measured in 693 subjects for whom haplotypic information was available. This population was comprised of 369 men and 324 women aged 31 ± 0.7 and 32 ± 0.7 (537 European Americans, 94 African Americans, 42 Hispanics, and 20 Asians). Plasma MCP-4 levels were not significantly related to and did not have significant interaction with any of the demographic variables. The distribution of each of the genetic variants met the conditions of the Hardy-Weinberg equilibrium. The frequency of the –896 variant allele was 0.063 and that of the –887 variant was 0.084 (Table 2). This study was not powered to detect and did not detect significant differences in the frequency of the variants between our healthy subjects and those with asthma (P > 0.05 by chi-square). Consistent with our promoter-reporter studies, plasma levels of MCP-4 were significantly lower in individuals bearing the T-887C variant than in those bearing the T–896C variant. Individuals bearing the –887C variant on both alleles had lower levels than heterozygotes (P = 0.001 and P = 0.014; Figure 6A) .



View larger version (19K):
[in this window]
[in a new window]
  		Figure 6. (A) Natural logarithm-transformed plasma MCP-4 levels as a function of –887 promoter genotype. Individuals bearing –887 T alleles on both chromosomes had significantly higher plasma MCP-4 levels (380 pg/ml; 95% CI 360 –410; n = 588) than heterozygotes (290 pg/ml; 95% CI 260 –340; n = 94) and individuals bearing two copies of the variant –887 C form (200 pg/ml; 95% CI 120 –360; n = 11; P < 0.01 –877 homozygote T versus others). (B) Natural logarithm-transformed plasma MCP-4 levels as a function of MCP-4 core promoter haplotype (the designation TT includes levels from individuals with –896T/-887T on both chromosomes; TC [–896T/-887C] and CC [–896C/-887C] includes levels from individuals with one or more copy of the designated haplotype). Individuals who bear haplotypic variants that include the –887C variant had significantly lower levels of plasma MCP-4 than did those having the wild-type –887 T allele (TT 380 pg/ml [95% CI 360 –400]; CT 280 pg/ml [95% CI 220 –360]; CC 290 pg/ml [95% CI 240 –340]).

 
MCP-4 Protein Levels as a Function of Promoter Haplotype
We detected three of the four potential haplotypes in our population. These define six groups of individuals with unique combinations of these haplotypes; the population frequency of these groups is presented in Table 3. Due to the small numbers of individuals with the uncommon haplotypes, we sorted individuals into three groups: A group of individuals with the most common (TT) haplotype at both alleles, a group of individuals with one or more of the least common (CT) allele, and the remaining individuals who had at least one (CC) allele. Individuals who bear haplotypic variants that include the –887C variant had significantly lower levels of plasma MCP-4 than did those who are homozygous for the wild-type allele (–887T; Figure 6B). To confirm that these findings could not be ascribed to inclusion of minorities in our population, we performed an analysis that was restricted to the European American members of our population. The plasma MCP-4 levels differed significantly among the groups (P < 0.01, n = 537), with individuals bearing two copies of the most common (TT) haplotype having the highest MCP-4 levels.


View this table:
[in this window]
[in a new window]
  		TABLE 3 Frequency of haplotypic variants

 

   Discussion
Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
References
 
We describe two genetic variants in the promoter region of MCP-4 (CCL-13) and report their functional consequences in vivo and in vitro. The T-887C variant alters a consensus transcription factor–binding motif for YY-1 (5'-CCATNTT-3'). Nuclear extracts from PBMCs stimulated with MCP-4–inducing concentrations of TNF-{alpha} bound the wild-type sequence more avidly than the variant T-877C sequence. These MCP-4 core promoter binding protein(s) were shown to contain transcription factor YY-1 immunoreactivity in a supershift assay. Promoter-reporter constructs with sequences that bound YY-1 more avidly (-887T) had greater promoter activity than did variant constructs. Increasing doses of a YY-1 expression vector were associated with increased reporter activity of MCP-4 core promoter constructs. This source of exogenous YY-1 produced significantly greater reporter activity from the –887T wild-type than from the variant MCP-4 core promoter construct.

These findings suggested that individuals bearing the –887C allele would have impaired ability to transcribe the MCP-4 gene and reduced ability to produce MCP-4. We therefore measured MCP-4 levels as a function of promoter genotype in a population of individuals with substantial variance in plasma MCP-4 levels. We found that individuals bearing the T-877 wild-type sequence had higher plasma levels of MCP-4 than did individuals bearing the –887C variant form, and individuals homozygous for the variant had lower levels than did heterozygotes. Similarly, we found that individuals bearing haplotypic variants with impaired YY-1 binding avidity had significantly lower plasma levels of MCP-4 than did individuals bearing YY-1–avid alleles.

Although our study was powered to find greater than 100-pg/ml differences in plasma MCP-4 levels among the haplotypes, it was not powered or designed to associate MCP-4 levels with asthma or its related phenotypes. Accordingly, this study provides little evidence for, but cannot exclude, a relationship between these variants and susceptibility to a diagnosis of asthma.

YY-1 belongs to the GLI-krüppel family of transcription factors that have pleitropic functions. It is known to initiate, activate, or repress transcription (14), depending on the binding motif and interactions through its protein-binding domain (15–17). The MCP-4 YY-1 binding motif lacks the repressor-associated adenosine or thymidine residue at position –881, and has a cytidine residue at position –891 that is conserved among YY-1 motifs in genes that are activated by YY-1. Our promoter-reporter and plasma studies consistently associate this wild-type motif with increased expression of MCP-4. YY-1 is ubiquitously expressed, being present in most cell types (18), and a growing number of genes have been found to contain a potential YY-1 binding site in their core promoter region. YY-1 is known to interact with NFAT to activate the interferon-{gamma} promoter activity (19), to downregulate interleukin (IL)-5 promoter activity in a human T cell line (20), and to upregulate IL-4 gene expression in lymphocytes. Increased binding of YY-1 to the CXCR4 promoter was shown to downregulate CXCR4 production (21, 22). Protein–protein interactions regulate YY-1 activity. Transcriptional activation is enhanced by Sp-1 binding to the YY-1 protein-binding domain. On the other hand, interaction of YY-1 with c-Myc represses transcription of several genes. Our study now links this transcription factor to increased chemokine expression. MCP-4 expression is increased both in asthma and in airway epithelial cells stimulated with the asthma-associated cytokine TNF-{alpha}. We demonstrate not only that, in the context of TNF-{alpha}, YY-1 binds the MCP-4 core promoter consensus-binding site, but also that abrogation of this site by a naturally occurring variant is associated with lower levels of MCP-4. Our EMSA findings, when considered in the context of the corresponding plasma MCP-4 levels and the results of promoter-reporter assays and their response to the YY-1 expression construct, suggest that YY-1 acts as an activator of the human MCP-4 promoter. It appears that YY-1 not only promotes allergic responses by promoting IL-4 transcription (13) but also acts to enhance chemokine transcription. Three models have been proposed to explain YY-1-mediated activation (17): (i) direct interaction between YY-1 and general factors; (ii) recruitment of a coactivator that modifies or interacts with other transcriptional factors; and (iii) interaction with other proteins that causes YY-1 to activate a promoter that was repressed by YY-1 in the absence of these factors. Our study does not allow us to distinguish among these possibilities. However, the fact that EMSA displays three distinct YY-1–containing bands with different electromobility patterns suggests that it associates with other proteins. The least mobile of these bands appears in the context of stimulation known to induce MCP-4 in human cells and has greater binding avidity for sequences that have greater MCP-4–promoter activity and are more responsive to YY-1 in reporter assays. It is therefore likely that protein-protein interactions are involved in YY-1–induced MCP-4 transcriptional activation.

In the paradigm of allergic inflammation, increased presence of transcript is tightly linked to expression of chemokine proteins. The transcriptional regulation of many chemokine genes, including eotaxin and RANTES (7), has been reported in vitro. The MCP-4 promoter has been evaluated by Hein and coworkers (10), who identified several transcription-factor consensus binding motifs, including the YY-1 motif. We extend these findings by demonstrating that this YY-1 binding motif is operational and relevant to the regulation of the transcriptional activity of MCP-4. This variant that decreases YY-1 binding avidity explains part of the variation in the systemic expression of MCP-4 and demonstrates that some of the differences in chemokine expression among individuals are genetically determined.

Our study has some important limitations. Although our study linked YY-1 to baseline systemic expression of MCP-4 and its induction in airway epithelial cells, it does not define the role of YY-1 in the regulation of MCP-4 in other cell types. Second, our study does not address the important question of which protein–protein interactions are critical for YY-1 transcriptional activation of MCP-4.

In conclusion, we describe two novel mutations of the MCP-4 core promoter and provide evidence that the T-887C mutation has functional consequences. In addition to being associated with lower systemic levels of MCP-4 and reduced promoter activity, this mutation occurs in a consensus binding site for the pleiotropic transcription factor YY-1 and decreases its binding avidity and ability to support transcription in reporter assays. These findings link the transcription factor YY-1 to the constitutive systemic expression of the chemokine MCP-4 and demonstrate that part of the variance in MCP-4 expression is genetically determined.


   Acknowledgments
 
This work was supported by National Heart, Lung, and Blood Institute grants HL/AI-64104 and HL63222. The authors thank Steve Georas for his generous gift of the YY-1 expression construct.

Received in original form January 22, 2003

Received in final form June 9, 2003


   References
Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
 References
 

  1. Luster, A. D. 1998. Chemokines–chemotactic cytokines that mediate inflammation. N. Engl. J. Med. 338:436–445.[Free Full Text]
  2. Ying, S., Q. Meng, K. Zeibecoglou, D. S. Robinson, A. Macfarlane, M. Humbert, and A. B. Kay. 1999. Eosinophil chemotactic chemokines (eotaxin, eotaxin-2, RANTES, monocyte chemoattractant protein-3 (MCP-3), and MCP-4), and C–C chemokine receptor 3 expression in bronchial biopsies from atopic and nonatopic (Intrinsic) asthmatics. J. Immunol. 163:6321–6329.[Abstract/Free Full Text]
  3. Lilly, C. M., H. Nakamura, H. Kesselman, C. Nagler-Anderson, K. Asano, E. A. Garcia-Zepeda, M. E. Rothenberg, J. M. Drazen, and A. D. Luster. 1997. Expression of eotaxin by human lung epithelial cells: induction by cytokines and inhibition by glucocorticoids. J. Clin. Invest. 99:1767–1773.[Medline]
  4. Lamkhioued, B., E. A. Garcia-Zepeda, S. Abi-Younes, H. Nakamura, S. Jedrzkiewicz, L. Wagner, P. M. Renzi, Z. Allakhverdi, C. Lilly, Q. Hamid, and A. D. Luster. 2000. Monocyte chemoattractant protein (MCP)-4 expression in the airways of patients with asthma. Induction in epithelial cells and mononuclear cells by proinflammatory cytokines. Am. J. Respir. Crit. Care Med. 162:723–732.[Abstract/Free Full Text]
  5. Lilly, C. M., H. Nakamura, O. I. Belostotsky, K. J. Haley, E. A. Garcia-Zepeda, A. D. Luster, and E. Israel. 2001. Eotaxin expression after segmental allergen challenge in subjects with atopic asthma. Am. J. Respir. Crit. Care Med. 163:1669–1675.[Abstract/Free Full Text]
  6. Jedrzkiewicz, S., H. Nakamura, E. S. Silverman, A. D. Luster, N. Mansharamani, K. H. In, G. Tamura, and C. M. Lilly. 2000. IL-1beta induces eotaxin gene transcription in A549 airway epithelial cells through NF-kappaB. Am. J. Physiol. Lung Cell. Mol. Physiol. 279:L1058–L1065.[Abstract/Free Full Text]
  7. Song, A., T. Nikolcheva, and A. M. Krensky. 2000. Transcriptional regulation of RANTES expression in T lymphocytes. Immunol. Rev. 177:236–245.[CrossRef][Medline]
  8. Ammit, A. J., A. L. Lazaar, C. Irani, G. M. O'Neill, N. D. Gordon, Y. Amrani, R. B. Penn, and R. A. Panettieri, Jr. 2002. Tumor necrosis factor-alpha-induced secretion of RANTES and interleukin- 6 from human airway smooth muscle cells: modulation by glucocorticoids and beta-agonists. Am. J. Respir. Cell Mol. Biol. 26:465–474.[Abstract/Free Full Text]
  9. Yang, L., L. Cohn, D. H. Zhang, R. Homer, A. Ray, and P. Ray. 1998. Essential role of nuclear factor kappa B in the induction of eosinophilia in allergic airway inflammation. J. Exp. Med. 188:1739–1750.[Abstract/Free Full Text]
  10. Hein, H., C. Schluter, R. Kulke, E. Christophers, J. M. Schroder, and J. Bartels. 1999. Genomic organization, sequence analysis and transcriptional regulation of the human MCP-4 chemokine gene (SCYA13) in dermal fibroblasts: a comparison to other eosinophilic beta-chemokines. Biochem. Biophys. Res. Commun. 255:470–476.[CrossRef][Medline]
  11. Nakamura, H., S. T. Weiss, E. Israel, A. D. Luster, J. M. Drazen, and C. M. Lilly. 1999. Eotaxin and impaired lung function in asthma. Am. J. Respir. Crit. Care Med. 160:1952–1956.[Abstract/Free Full Text]
  12. Nakamura, H., A. D. Luster, T. Nakamura, K. H. In, L. A. Sonna, A. Deykin, E. Israel, J. M. Drazen, and C. M. Lilly. 2001. Variant eotaxin: its effects on the asthma phenotype. J. Allergy Clin. Immunol. 108:946–953.[CrossRef][Medline]
  13. Guo, J., V. Casolaro, E. Seto, W. M. Yang, C. Chang, M. C. Seminario, J. Keen, and S. N. Georas. 2001. Yin-Yang 1 activates interleukin-4 gene expression in T cells. J. Biol. Chem. 276:48871–48878.[Abstract/Free Full Text]
  14. Shrivastava, A., and K. Calame. 1994. An analysis of genes regulated by the multi-functional transcriptional regulator Yin Yang-1. Nucleic Acids Res. 22:5151–5155.[Free Full Text]
  15. Usheva, A., and T. Shenk. 1996. YY1 transcriptional initiator: protein interactions and association with a DNA site containing unpaired strands. Proc. Natl. Acad. Sci. USA 93:13571–13576.[Abstract/Free Full Text]
  16. Shi, Y., J. S. Lee, and K. M. Galvin. 1997. Everything you have ever wanted to know about Yin Yang 1. Biochim. Biophys. Acta 1332:F49–F66.[Medline]
  17. Thomas, M. J., and E. Seto. 1999. Unlocking the mechanisms of transcription factor YY1: are chromatin modifying enzymes the key? Gene 236:197–208.[CrossRef][Medline]
  18. Austen, M., B. Luscher, and J. M. Luscher-Firzlaff. 1997. Characterization of the transcriptional regulator YY1: the bipartite transactivation domain is independent of interaction with the TATA box- binding protein, transcription factor IIB, TAFII55, or cAMP-responsive element-binding protein (CPB)-binding protein. J. Biol. Chem. 272:1709–1717.[Abstract/Free Full Text]
  19. Ye, J., M. Cippitelli, L. Dorman, J. R. Ortaldo, and H. A. Young. 1996. The nuclear factor YY1 suppresses the human gamma interferon promoter through two mechanisms: inhibition of AP1 binding and activation of a silencer element. Mol. Cell. Biol. 16:4744–4753.[Abstract]
  20. Mordvinov, V. A., G. T. Schwenger, R. Fournier, M. L. De Boer, S. E. Peroni, A. D. Singh, S. Karlen, J. W. Holland, and C. J. Sanderson. 1999. Binding of YY1 and Oct1 to a novel element that downregulates expression of IL-5 in human T cells. J. Allergy Clin. Immunol. 103:1125–1135.[CrossRef][Medline]
  21. Moriuchi, M., H. Moriuchi, D. M. Margolis, and A. S. Fauci. 1999. USF/c-Myc enhances, while Yin-Yang 1 suppresses, the promoter activity of CXCR4, a coreceptor for HIV-1 entry. J. Immunol. 162:5986–5992.[Abstract/Free Full Text]
  22. Hasegawa, A., M. Yasukawa, I. Sakai, and S. Fujita. 2001. Transcriptional down-regulation of CXC chemokine receptor 4 induced by impaired association of transcription regulator YY1 with c-Myc in human herpesvirus 6-infected cells. J. Immunol. 166:1125–1131.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 GeneticsHome page
R. D. Houston, C. S. Haley, A. L. Archibald, N. D. Cameron, G. S. Plastow, and K. A. Rance
A Polymorphism in the 5'-Untranslated Region of the Porcine Cholecystokinin Type A Receptor Gene Affects Feed Intake and Growth
Genetics, November 1, 2006; 174(3): 1555 - 1563.
[Abstract] [Full Text] [PDF]

Home page
 Eur Respir JHome page
S. N. Georas, J. Guo, U. De Fanis, and V. Casolaro
T-helper cell type-2 regulation in allergic disease
Eur. Respir. J., December 1, 2005; 26(6): 1119 - 1137.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-0024OCv1
29/6/750    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kalayci, O.
Right arrow Articles by Lilly, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kalayci, O.
Right arrow Articles by Lilly, C. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2003 American Thoracic Society.