help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published ahead of print on July 10, 2003, doi:10.1165/rcmb.2003-0118OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-0118OCv1
30/1/118    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhong, H.
Right arrow Articles by Zeng, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhong, H.
Right arrow Articles by Zeng, D.
American Journal of Respiratory Cell and Molecular Biology. Vol. 30, pp. 118-125, 2004
© 2004 American Thoracic Society
DOI: 10.1165/rcmb.2003-0118OC

A2B Adenosine Receptors Increase Cytokine Release by Bronchial Smooth Muscle Cells

Hongyan Zhong, Luiz Belardinelli, Tenning Maa, Igor Feoktistov, Italo Biaggioni and Dewan Zeng

Department of Drug Research and Pharmacological Sciences, CV Therapeutics, Inc., Palo Alto, California; and Department of Medicine and Pharmacology, Vanderbilt University, Nashville, Tennessee

Address correspondence to: Dewan Zeng, Ph.D., CV Therapeutics, Inc., 3172 Porter Drive, Palo Alto, CA 94304. E-mail: dewan.zeng{at}cvt.com


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Adenosine (Ado) has been suggested to play a role in inflammatory airway diseases such as asthma and chronic obstructive pulmonary disease. The goal of this study was to determine the effect of Ado and its receptor subtypes on cytokine release by bronchial smooth muscle cells. The A2B Ado receptor (AdoR) was expressed at the highest level among the four AdoR subtypes. Activation of the A2B AdoR by an Ado analog, 5'-(N-ethylcarboxamido)-adenosine (NECA), increased cAMP accumulation with potency (EC50 value) of 21.2 ± 0.2 µM. The effect of NECA on the expression of the inflammatory cytokines was determined using a cDNA array consisting of 23 cytokine genes and confirmed using real-time reverse transcription–polymerase chain reaction and enzyme-linked immunosorbent assay. NECA increased the release of interleukin-6 and monocyte chemotactic protein-1 proteins with EC50 values of 1.26 ± 0.25 µM and 0.40 ± 0.08 µM, respectively, and the maximal folds of induction were 20.8 ± 1.7– and 6.4 ± 0.7–fold, respectively. Selective agonists for the A1, A2A, and A3 AdoR subtypes had no effect on cytokine release. The effects of NECA were attenuated by selective antagonists of the A2B AdoR. Thus, Ado increases the release of interleukin-6 and monocyte chemotactic protein-1 from bronchial smooth muscle cells via activation of the A2B AdoR. Our findings provide a novel mechanism whereby Ado acts as a proinflammatory mediator in the airway.

Abbreviations: adenosine, Ado • adenosine receptor, AdoR • activator protein-1, AP-1 • bronchial smooth muscle cell, BSMC • 2-p-(2-Carboxyethyl)phenethylamino-5'-N-ethylcarboxamido adenosine, CGS-21680 • chronic obstructive pulmonary disease, COPD • N6-cyclopentyladenosine, CPA • cAMP responsive element-binding protein, CREB • dibutyryl cAMP, DBcAMP • enzyme-linked immunosorbent assay, ELISA • N6-(3-iodobenzyl)-adenosine-5'-N-methyluronamide, IB-MECA • interleukin, IL • 3-isobutyl-8-pyrrolidinoxanthine, IPDX • monocyte chemotactic protein-1, MCP-1 • 5'-(N-ethylcarboxamido)-adenosine, NECA • nuclear factor {kappa}B, NF-{kappa}B • nuclear factor of activated T cells, NFAT • reverse transcription–polymerase chain reaction, RT-PCR • transforming growth factor, TGF


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Asthma is a chronic disease of the conducting airways characterized by airway inflammation, reversible airway obstruction, and hyperresponsiveness (1). The bronchial smooth muscle cell (BSMC) contributes to the pathophysiologic changes that occur in asthma. The well-characterized functions of the BSMC include its contractile properties, which produce immediate airway narrowing, and its ability to proliferate during airway remodeling (2). Recent studies have suggested a further role of BSMCs in lung inflammation as a source of cytokines and chemokines. Upon stimulation with cytokines, BSMCs can release proinflammatory molecules, including interleukin (IL)-1ß, IL-6, granulocyte macrophage colony-stimulating factor (GM-CSF), transforming growth factor (TGF)-ß, and eotaxin (35).

Adenosine (Ado) is a potent signaling nucleoside that can elicit many physiologic responses by activating G-protein–coupled receptors on the target cells. Inhaled Ado caused bronchoconstriction in patients with asthma (6), and the interstitial concentration of Ado was elevated in the lungs of individuals with asthma (7). Thus, adenosine has been implicated in asthma and chronic obstructive pulmonary disease (COPD) (8). The mechanism of the Ado-mediated bronchoconstriction is most likely due to its effect on mediator release from mast cells (912). In addition, Ado modulates the functions of many inflammatory cells such as lymphocytes (13), eosinophils (14), neutrophils (15), and macrophages (16). All of these inflammatory cells are potentially involved in the exacerbation of asthma. As discussed above, increasing evidence indicates that BSMCs play an active role in the inflammatory process by secreting cytokines and chemokines. However, the effect of Ado on inflammatory cytokine release by BSMCs has not been determined.

The goal of the current study was to determine the effects of Ado and its receptor subtypes on cytokine expression and release by BSMCs. We first identified that the A2B Ado receptor (AdoR) is the predominant AdoR subtype in BSMCs. Using a cytokine array, we showed that 5'-(N-ethylcarboxamido)-adenosine (NECA) increased the expression and release of IL-6 and monocyte chemotactic protein (MCP)-1, two important proinflammatory cytokines. In contrast to NECA, selective agonists for the A1, A2A, and A3 AdoR subtypes had no effect on the cytokine expression and release. The selective antagonists of the A2B AdoR attenuated all the effects of NECA. Furthermore, we evaluated the potential involvement of cAMP pathway in NECA-induced IL-6 and MCP-1 production. Our findings indicate that Ado increases the release of IL-6 and MCP-1 by BSMCs via activation of the A2B AdoR and further support that the A2B AdoR antagonist has potential therapeutic utility for the treatment of asthma and COPD.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Dibutyryl cAMP (DBcAMP) and H-89 were purchased from Calbiochem (San Diego, CA). CVT-6694 and 3-isobutyl-8-pyrrolidinoxanthine (IPDX) were made at CV Therapeutics (Palo Alto, CA). All other chemicals (such as forskolin, rolipram, adenosine, NECA, N6-cyclopentyladenosine [CPA], CGS21680, and N6-(3-iodobenzyl)-adenosine-5'-N-methyluronamide [IB-MECA]) were from Sigma (St. Louis, MO).

Human BSMC Culture
Normal human BSMCs were obtained from Clonetics (San Diego, CA) and cultured using smooth muscle cell growth medium supplemented with 5% fetal bovine serum, 0.5 ng/ml epidermal growth factor, 5 µg/ml insulin, 2 ng/ml fibroblast growth factor, 50 µg/ml gentamicin, and 50 ng/ml amphotericin B. BSMCs were grown under a humidified 5% CO2 atmosphere at 37°C. Immunofluorescence staining of BSMCs using a monoclonal anti-human smooth muscle {alpha}-actin antibody (Sigma) demonstrated that the cultures were essentially (> 99%) free of other contaminating cell types. BSMCs from passages 2–5 were used in the following studies.

Stimulation of BSMCs
BSMCs were seeded into 6-well tissue culture plates at a density of 3 x 105 cells/well and allowed to adhere overnight and reach ~ 80% confluence. Cells were washed twice in HBSS, and cultured in serum-free basal medium (Clonetics) containing antibiotics and various agonists or antagonists of AdoRs. For some experiments, cells were preincubated with 20 µM H-89 for 20 min before stimulation with NECA.

RNA Extraction and Real-Time Reverse Transcription–Polymerase Chain Reaction
Total RNA was extracted from BSMCs using the Stratagene Absolutely RNA reverse transcription–polymerase chain reaction (RT-PCR) Miniprep Kit followed by DNase treatment to eliminate potential genomic DNA contamination. cDNA was synthesized from 2 µg of total RNA using TaqMan Reverse Transcription Reagents from PE Applied Biosystems (Foster City, CA). TaqMan real-time PCR analysis was applied using 2 µl cDNA per reaction and YBR Green PCR Core Reagents on ABI Prism Sequence Detection System 5,700 (PE Applied Biosystems) according to the manufacturer's instructions. The primers for AdoRs and ß-actin were designed as previously described (17). Specific primers for IL-6 (forward: 5'CCGGGAACGAAAGAGAAGCT3'; reverse: 5'CGCTTGTGGAGAAGGAGTTCA3') and MCP-1 (forward: 5'CGCCTCCAGCATGAAAGTCT3'; reverse: 5'GGAATGAAGGTGGCTGCTATG3') were designed using Primer Express (PE Applied Biosystems) following the recommended guidelines based on sequences from Genbank. At the end of the PCR cycle, a dissociation curve was generated to ensure that the amplification of a single product, and the threshold cycle times (Ct values) for each gene were determined. Relative mRNA levels were calculated based on the Ct values, normalized to ß-actin in the same sample, and presented as percentages of ß-actin mRNA.

Cytokine Gene Expression Array Analysis
Expression of cytokines was determined using human inflammation response cytokines via the GEArray kit (SuperArray, Inc., Bethesda, MA). The assay was performed according to manufacturer's instructions. [32P]-labeled cDNA probes were generated from 5–10 µg of total RNA. The cDNA probes were then hybridized with gene-specific cDNA fragments spotted on nylon membrane. The relative expression level of each gene was analyzed using a phosphorimager and Image Quant software (Molecular Dynamics, Sunnyvale, CA).

Measurement of cAMP Accumulation
Cells were harvested using 0.0025% trypsin and 2 mM EDTA in phosphate-buffered saline, washed, and resuspended in phenol-free Dulbecco's modified Eagle's medium to a concentration of 1 x 106 cells/ml, and then incubated with 1 U/ml of adenosine deaminase (Sigma) for 30 min at room temperature. A final concentration of 50 µM of the phosphodiesterase IV inhibitor, rolipram, was added to the cells immediately before addition of adenosine receptor agonists, antagonists, and forskolin. After incubating for 15 min at 37°C, cells were lysed and cAMP concentrations were determined using cAMP-Screen Direct System (Applied Biosystems) according to the manufacturer's instructions.

Measurement of IL-6 and MCP-1
The concentrations of IL-6 and MCP-1 in the cell medium were determined using enzyme-linked immunosorbent assay (ELISA) kits obtained from R&D Systems (Minneapolis, MN) according to the manufacturer's instructions. The minimal detection levels of IL-6 and MCP-1 with these kits were 0.7 and 5 pg/ml, respectively.

Transient Transfection and Luciferase Reporter Assay
BSMCs were seeded into 6-well tissue culture plates at a density of 2 x 105 cells/well, and allowed to adhere overnight and reach ~ 50% confluence. Transfection of BSMCs was performed using Fugene 6 transfection reagent (Roche, Indianapolis, IN) according to the manufacturer's instructions. Cells in each well were transfected with 0.5 µg of pAP-1-Luc, pCRE-Luc, pNFAT-Luc, or pNF-{kappa}B-Luc (all from Clontech, Palo Alto, CA), and together with 0.5 µg of pSV-ß-galactosidase (Promega, Madison, WI) to normalize transfection efficiencies. Forty-eight hours after transfection, cells were washed, cultured in serum-free basal medium, and treated with NECA for 4 h. Cells were then harvested, and luciferase and ß-galactosidase activities were assessed using Promega luciferase and ß-galactosidase assay systems.

Statistical Analysis
Data were presented as mean ± SEM. Statistical analysis was performed by using a two-tailed, paired Student's t test. Values of P < 0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of AdoR mRNA in BMSC
Real-time RT-PCR was performed to quantify the levels of AdoR mRNA in BSMCs. Among the four subtypes of AdoRs, the A2B AdoR had the highest transcript levels (0.51 ± 0.05% ß-actin) (shown in Figure 1). Low levels of A1 and A2A AdoR mRNA were also detected (0.0046 ± 0.0003% and 0.0123 ± 0.0002% ß-actin, respectively), whereas transcripts for the A3 AdoR were below detection level. Hence, the rank order of AdoR mRNA levels was A2B >> A2A > A1 >> A3. These data demonstrate that A2B is the predominant AdoR mRNA expressed in BSMCs.



View larger version (9K):
[in this window]
[in a new window]
 
Figure 1. Real-time RT-PCR analysis of AdoR transcripts in BSMCs. Total RNA isolated from BSMCs was subjected to real-time RT-PCR analysis. The relative AdoR mRNA transcript levels were presented as percentages of the expression level of ß-actin mRNA. Data shown are averages ± SEM from four independent experiments. nd, not detected.

 
The Presence of Functional A2B AdoR in BSMC
Activation of the A2A and A2B AdoRs increased cAMP accumulation via coupling to Gs proteins, whereas activation of the A1 and A3 AdoRs decreased cAMP accumulation induced by forskolin. To identify the AdoR subtypes that are functionally expressed in BSMCs, the effects of a stable adenosine analog NECA (which is a nonselective AdoR agonist that activates all four AdoR subtypes including A2B AdoRs) and several selective AdoR agonists on cAMP accumulations were determined. As shown in Figure 2A, NECA increased cAMP accumulations in a concentration-dependent manner, with an EC50 value of 21.2 ± 0.2 µM (n = 3). In contrast, the A2A selective agonist CGS-21680 (10 µM) did not cause a significant increase in cAMP level. In addition, both the A1 AdoR-selective agonist, CPA (1 µM), and the A3 agonist, IB-MECA (1 µM), failed to inhibit the cAMP accumulations caused by forskolin (10 µM, Figure 2B). Because there is no selective agonist for the A2B AdoR, we determined the effect of a selective antagonist to the A2B AdoR (CVT-6694) on the effect of NECA. CVT-6694 has a high affinity for the A2B AdoR (Ki = 7 nM) and very low-affinity for three other AdoR subtypes (Ki values are more than 5 µM for A1, A2A, and A3 AdoRs, manuscript in preparation). As shown in Figure 2A, CVT-6694 (1 µM) completely abolished NECA-induced cAMP accumulation. Collectively, these results indicate that A2B is the functional AdoR in BSMCs, whereas no functional expression of the A1, A2A, or A3 AdoR was detected using cAMP accumulation as a functional readout.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Effects of AdoR agonists and antagonist on cAMP accumulations in BSMCs. (A) Cells were pretreated with ADA (1 U/ml) for 30 min at room temperature to eliminate the endogenous adenosine and then incubated with NECA in the presence (open circle) or absence (open square) of 1 µM A2B adenosine receptor antagonist CVT-6694 or CGS-21680 (open triangle). (B) Cells were incubated with 10 µM forskolin (Fsk) with or without 1 µM CPA and 1 µM IB-MECA. Data shown are averages ± SEM from four independent experiments. *P < 0.05 compared with control; **P < 0.05 compared with NECA-treated cells in A.

 
Effect of NECA on Inflammatory Cytokine Expression Using cDNA Array Analysis
The effect of NECA on the gene expression of the inflammatory cytokines was determined using a cDNA array containing 23 inflammatory cytokine genes. BSMCs were incubated with 100 µM NECA or vehicle for 1 h or 6 h, and total RNA was isolated. [32P]-labeled cDNA probes were generated from 5–10 µg of total RNA, and these cDNA probes were then hybridized to nylon membranes that were spotted with gene-specific cDNA fragments from 23 inflammatory cytokine genes. The expression levels of cytokine genes were normalized to the expression level of ß-actin gene. Among 23 cytokine genes (listed in Table 1), IL-6 and MCP-1 genes showed the greatest induction by NECA. Their expression was increased after treatment with NECA for 1 h but returned to control levels after treatment with NECA for 6 h (Figure 3). In contrast, expression of macrophage migration inhibitory factor, TGF-ß1, and TGF-ß2 were increased slightly by NECA (1.5- to 3-fold NECA versus vehicle), whereas expression of TGF-ß3 and lymphotoxin-{alpha} were not affected by NECA. The expression of the other sixteen genes was below the detection limit by this technique. Because of their large responses to NECA and the well-documented role of IL-6 and MCP-1 in lung inflammation, the remaining study focused on the regulation of IL-6 and MCP-1 by AdoRs.


View this table:
[in this window]
[in a new window]
 
TABLE 1 Names of the inflammatory cytokines on the GEArray

 


View larger version (21K):
[in this window]
[in a new window]
 
Figure 3. Effect of NECA on expression of IL-6 and MCP-1 determined using cDNA array analysis. BSMCs were incubated with 0.1% DMSO (control) or 100 µM NECA for 1 h or 6 h. The expression levels of IL-6 and MCP-1 were normalized to that of ß-actin. Data shown are average ± SEM from three independent experiments. nd, not detected.

 
Activation of A2B AdoR Increased mRNA Expression of IL-6 and MCP-1 in BSMC
To confirm and quantify NECA-induced expression of IL-6 and MCP-1, gene-specific real-time RT-PCR was performed on BSMCs treated with NECA for 1 h. As shown in Figure 4, NECA increased expression of IL-6 (Figure 4A) and MCP-1 (Figure 4C) in a concentration-dependent manner with EC50 values of 1.28 ± 0.39 µM (n = 3) and 0.24 ± 0.05 µM (n = 3), respectively. The mRNA levels of IL-6 and MCP-1 were increased by 59.7 ± 6.1–(IL-6) and 3.6 ± 0.3 (MCP-1)–fold over controls, respectively, after treatment with NECA (10 µM). To determine which subtype of the AdoR mediates the NECA-induced IL-6 and MCP-1 expression, cells were incubated with specific AdoR agonists and antagonists. The A1 AdoR agonist CPA (1 µM), the A2A AdoR agonist CGS21680 (1 µM), and the A3 AdoR agonist IB-MECA (1 µM), all failed to increase IL-6 and MCP-1 expression. In comparison, two selective antagonists for A2B AdoRs, CVT-6694 (1 µM) and IPDX (10 µM), attenuated the effect of NECA. As shown in Figure 4 (B and D), CVT-6694 (1 µM) completely attenuated the NECA-induced expression of IL-6 and MCP-1 (97.4 ± 1.5% and 87.5 ± 2.6% inhibition, respectively). IPDX is a lower affinity antagonist for A2B AdoRs than CVT-6694 with the following affinities or potencies for AdoRs: Ki value for A1 is 24 µM; KB value for A2A is 36 µM; KB value for A2B is 0.6 µM; and Ki value for A3 AdoR is 53 µM (18). IPDX (10 µM) partially attenuated NECA-induced IL-6 and MCP-1 expression (65.8 ± 3.2% and 43.4 ± 10.4% inhibition, respectively). Collectively, these findings provide strong evidence that NECA-induced cytokine expression is mediated by the A2B AdoR subtype.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 4. Effects of AdoR agonist and antagonists on expression of IL-6 and MCP-1 determined using real-time RT-PCR. (A and C) Concentration response curves for the effect of NECA on expression of IL-6 (A) and MCP-1 (C). (B and D) Effect of selective AdoR agonists and antagonists on the expression of IL-6 (B) and MCP-1 (D). BSMCs were incubated with NECA (N, 10 µM), with or without CVT-6694 (6694, 1 µM) or IPDX (10 µM), CPA (1 µM), CGS21680 (CGS, 1 µM), or IB-MECA (1 µM) for 1 h. Cells incubated with 0.1% DMSO vehicle were used as control. The expression levels of IL-6 and MCP-1 were normalized to that of ß-actin. Data shown are the averages ± SEM from three independent experiments. *P < 0.05 compared with control; **P < 0.05 compared with NECA-treated cells in B and D.

 
Activation of the A2B AdoR Increased the Release of IL-6 and MCP-1 From BSMCs
To further confirm the role of adenosine and NECA in cytokine protein production, IL-6 and MCP-1 concentrations in the culture media from cells treated with adenosine or NECA were measured using ELISA. NECA (10 µM) increased IL-6 and MCP-1 release in a time-dependent manner (Figure 5, A and B). The basal level of IL-6 and MCP-1 in the media from vehicle-treated cells was low (7.7 ± 0.4 and 8.7 ± 1.9 pg/ml, respectively, at 24 h), whereas the concentrations of IL-6 and MCP-1 in the media were increased by 20.8 ± 1.7– and 6.4 ± 0.7–fold over controls, respectively, after treatment with NECA (10 µM) for 24 h. In addition, NECA increased the IL-6 and MCP-1 production in a concentration-dependent manner (Figure 5, C and D), with potencies (EC50 values) of 1.26 ± 0.25 µM and 0.40 ± 0.08 µM, respectively (n = 3). Similarly, adenosine increased the IL-6 and MCP-1 production with potencies of 10.1 ± 0.2 µM and 2.0 ± 0.3 µM (Figure 5, C and D). To confirm the role of A2B AdoRs in NECA-induced IL-6 and MCP-1 production, cells were incubated with specific AdoR agonists and antagonists for 24 h. CPA (1 µM), CGS21680 (1 µM), and IB-MECA (1 µM) failed to increase IL-6 (Figure 5E) and MCP-1 (Figure 5F) release. The A2B AdoR antagonists, CVT-6694 (1 µM) and IPDX (10 µM), attenuated NECA-induced production of IL-6 (96.4 ± 2.6% and 90.4 ± 1.7% inhibition, respectively) and MCP-1 (96.1 ± 0.4% and 66.7 ± 1.4% inhibition, respectively) (Figure 5, E and F). These results confirmed that NECA-induced cytokine release is mediated by the A2B AdoR subtype.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 5. Effects of AdoR agonist and antagonists on the release of IL-6 and MCP-1 by BSMCs. (A and B) Time course of the effect of NECA (10 µM) on release of IL-6 (A) and MCP-1 (B). BSMCs were incubated with vehicle (filled bars) or NECA (open bars) for 1, 6, or 24 h. (C and D) Concentration response curves of NECA (squares) and adenosine (triangles). Cells were stimulated with NECA or adenosine for 24 h. (E and F) Effects of selective AdoR agonists and antagonists on the release of IL-6 (E) and MCP-1 (F). BSMCs were incubated with NECA (N, 10 µM) with or without CVT-6694 (6694, 1 µM), or IPDX (10 µM), CPA (1 µM), CGS21680 (CGS, 1 µM), or IB-MECA (1 µM) for 24 h. Media from treated cells were collected, and the concentrations of IL-6 (A, C, E) and MCP-1 (B, D, F) were determined using ELISA. Data shown are averages ± SEM from three independent experiments. *P < 0.05 compared with control; **P < 0.05 compared with NECA-treated cells in E and F.

 
Role of cAMP Pathway in Expression and Release of IL-6 and MCP-1
Activation of A2B AdoRs in BSMCs by NECA increased cAMP accumulation and expression of IL-6 and MCP-1. We determined the potential role of the cAMP pathway in NECA-induced cytokine expression and release in BSMCs. The adenylyl cyclase activator forskolin, a cAMP analog DBcAMP, and a cAMP-dependent kinase inhibitor H-89, were used in this study. DBcAMP (500 µM) and forskolin (10 µM) increased expression and release of IL-6 (Figures 6A and 6C) and MCP-1 (Figures 6B and 6D), whereas H-89 (20 µM) attenuated the effect of NECA on expression (Figures 6A and 6B) and release (Figures 6C and 6D) of IL-6 and MCP-1 (from 159.6 ± 11.5 to 5.9 ± 1.0 pg/ml for IL-6, and from 55.6 ± 6.6 to 12.8 ± 1.8 pg/ml for MCP-1). These findings support the idea that the cAMP pathway plays an important role in NECA-induced cytokine expression and release.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 6. Influence of cAMP pathway on NECA-induced mRNA expression and release of IL-6 and MCP-1. BSMCs were incubated with DBcAMP (DBA, 500 µM), forskolin (Fsk, 10 µM), and NECA (10 µM) in the presence or absence of H-89 (20 µM) for 1 h (A and B) or 24 h (C and D). Cells incubated with 0.1% DMSO were used as control. Data shown are averages ± SEM from three independent experiments. *P < 0.05 compared with control; **P < 0.05 compared with NECA-treated cells.

 
NECA Increased CRE-Mediated Reporter Activity
To further determine the effect of NECA on the activities of transcription factors, activator protein-1 (AP-1), cAMP responsive element-binding protein (CREB), nuclear factor of activated T cells (NFAT), and nuclear factor-{kappa}B (NF-{kappa}B), known to mediate cytokine expression, BSMCs were transfected with pAP-1-Luc, pCRE-Luc, pNFAT-Luc, or pNF-{kappa}B-Luc, and then stimulated with NECA. CREB-mediated luciferase activity increased to 12.39 ± 1.03 fold of control after treatment with NECA (100 µM) for 4 h. However, AP-1–, NFAT-, and NF-{kappa}B–mediated luciferase activity was not significantly altered by NECA treatment (Figure 7A). In addition, NECA induced the CRE-Luc activity in a concentration-dependent manner (Figure 7B), with potency (EC50 value) of 1.41 ± 0.20 µM (n = 3). These findings indicate that NECA activates CREB, but not AP-1, NFAT, or NF-{kappa}B.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 7. Effect of NECA on specific promoter-mediated transcription. (A) BSMCs transfected with pAP-1-Luc, pCRE-Luc, pNFAT-Luc or pNF-{kappa}B-Luc were incubated with NECA (100 µM) for 4 h. (B) BSMCs transfected with pCRE-Luc were incubated with 0.01–100 µM NECA for 4 h. Cells incubated with 0.1% DMSO were used as control. Cells were then harvested, and luciferase and ß-galactosidase activities were assessed. Data shown are average ± SEM from 4–8 replicates. *P < 0.05 compared with control.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The novel findings of this study are that Ado and its stable Ado analog NECA increase the expression and release of IL-6 and MCP-1 by BSMCs, and that this effect of NECA is mediated by the A2B AdoR subtype. To our knowledge, this is the first report on the effect of adenosine and its receptor subtype on inflammatory cytokine releases by BSMCs, and it represents a novel mechanism for the role of Ado in asthma and COPD.

Several reports demonstrated the presence of AdoRs in airway smooth muscle cells from different species. In rat airway smooth muscle cells, transcripts of A1, A2B, and A3 AdoR were detected (19). In contrast, our study demonstrates that in human BSMCs, A2B transcript was highest among the four subtypes of AdoRs; lower levels of A1 and A2A transcripts were also detected, but A3 AdoR transcripts were below detection limit. This difference in AdoR expression between rat and human airway smooth muscle cells is not entirely surprising because differences in AdoR functions in airway smooth muscles from different species have been previously described (20). In addition to gene expression, using cAMP accumulation as a functional readout, we confirmed the presence of functional A2B AdoRs in BSMCs, whereas the presence of functional A1, A2A, and A3 AdoRs were not detected. This result is consistent with another report on the predominant role of the A2B AdoR in mediating cAMP accumulation in human tracheal smooth muscle cells (21).

Adenosine has been suggested to participate in the pathogenesis of allergic airway disease (22) through activation of AdoRs on the inflammatory cells in the airway. However, the role of adenosine and its receptor subtypes on cytokine expression and release by BSMCs had not been previously reported. In this study, we examined the effect of the adenosine analog NECA on cytokine gene expression using an inflammatory cytokine cDNA array, which contains most cytokines implicated in asthma and COPD. Among these 23 human inflammatory cytokines, IL-6 and MCP-1 genes showed the greatest induction by NECA. Expression of some other cytokine genes including macrophage migration inhibitory factor, TGF-ß1, and TGF-ß2, TGF-ß3, and lymphotoxin-{alpha}, was detected in both control and NECA-treated BSMCs using the microarray technology, but NECA has no or minimal effects on the expression of these genes. The effect of NECA on the expression of these five genes was also investigated using real-time RT-PCR. The results from RT-PCR confirmed that NECA did not significantly change the expression of these genes (data not shown). The expression of the other 16 genes was below the detection limit by the array technique. IL-6 and MCP-1 are well-characterized inflammatory cytokines. The elevated concentrations of IL-6 and MCP-1 in bronchoalveolar lavage fluid are characteristic features in humans with asthma (23, 24). IL-6, a pleiotropic cytokine, is considered to be a proinflammatory mediator in airway wall inflammation. The effects of IL-6 include promoting mucus hypersecretion (25), stimulating hyperplasia and hypertrophy of cultured guinea-pig airway smooth muscle (26), and inducing subepithelial fibrosis and myofibroblast hyperplasia (27). MCP-1, a C-C class chemokine, is a mediator of both acute and chronic lung inflammation. The functions of MCP-1 include mediating leukocyte infiltration and activation (28), T cell differentiation (29), and airway hyperresponsiveness (30). Our finding that adenosine increases the release of IL-6 and MCP-1 from BSMCs elucidates a novel mechanism for the effect of adenosine in lung inflammation.

Many physiologic roles of Ado are mediated through cell surface AdoRs. In this study, we provided evidence that the A2B AdoR subtype mediates the effect of the Ado analog NECA on IL-6 and MCP-1 release. Our results show the following: (i) The nonselective agonist NECA increased the expression and release of IL-6 and MCP-1, whereas selective agonists for A1, A2A, and A3 AdoRs, such as CPA, CGS-21680, and IB-MECA, had no effect. These agonists are very potent and, at concentrations that range from 0.1–1 µM, they fully activate their cognate receptors without significant activation of the A2B AdoR; at concentrations higher than 1 µM, they may activate A2B AdoRs. This was the rationale for determining the effect of these agonists at a concentration of 1 µM. (ii) The effects of NECA on cytokine release were attenuated by two selective antagonists of the A2B AdoR subtype with the expected rank order of potency. Collectively, these findings provide strong evidence for the role of the A2B AdoR in upregulating the expression and release of IL-6 and MCP-1 caused by NECA.

Transcriptional regulation of IL-6 has been studied intensively in recent years. The promoter of the human IL-6 gene contains the binding sites for AP-1, CREB, NFAT, and NF-{kappa}B (31). The MCP-1 promoter contains a variety of transcription factor binding sites, including AP-1– and NF-{kappa}B–binding sites (32). In this study, we investigated the potential role of cAMP pathway in NECA-induced expression and release of IL-6 and MCP-1 by BSMCs. Several findings support the role of cAMP pathway: (i) NECA increased cAMP accumulation and expressions of IL-6 and MCP-1, whereas the selective antagonists to A2B AdoR attenuated these effects of NECA; (ii) the adenylyl cyclase activator, forskolin, and the cAMP analog, DB-cAMP, increased cAMP accumulation and expressions of IL-6 and MCP-1; (iii) an inhibitor to cAMP-dependent kinase H-89 attenuated the effect of NECA on expression of IL-6 and MCP-1; and (iv) using various promoter–luciferase constructs transiently transfected into BSMCs, we showed that NECA increased CRE-luciferase activity but had no effect on AP-1–, NFAT-, or NF{kappa}B-mediated transcription in BSMCs. Our findings are in agreement with an early report that demonstrated the CREB binding site, but not the NF{kappa}B binding site, was critical for adenosine induced IL-6 release by COS 7 cells (33).

Closer examination of the agonist concentration-response curves revealed that NECA was more potent at increasing cytokine expression and release than at increasing cAMP accumulation. The EC50 value of NECA to increase cAMP accumulation was 21 µM, whereas the EC50 values of NECA to increase expression of IL-6 and MCP-1 were 1.3 µM (~ 16-fold more potent) and 0.2 µM (~ 100-fold more potent), respectively. It is difficult to reconcile these differences in EC50 values of a given agonist. One plausible explanation is that activation of adenylyl cyclase is proximal to receptor activation and gene expression is distal to receptor activation, and there is progressive amplification of signal along each step of the transduction pathway. Hence, a minor change in cAMP accumulation could result in a major increase in cytokine expression. Regardless of the mechanism that leads to the differences in EC50 values, our study highlighted the importance of determining the agonist potency using the appropriate cellular and physiologic end points rather than using the accumulation of intracellular second messengers.

In summary, the A2B AdoR subtype is the predominant AdoR expressed in BSMCs. Activation of this receptor increased expression and release of IL-6 and MCP-1 in time- and concentration-dependent manners. This process is at least in part mediated via the cAMP pathway. Our findings provide a novel mechanism whereby adenosine acts as a proinflammatory mediator in the airway. Furthermore, these findings suggest that the A2B AdoR antagonist has potential therapeutic utility for the treatment of asthma and COPD.


    Acknowledgments
 
The authors thank Drs. Jeff Zablocki, Venkata Palla, Rao Kalla, Elfatih Elzein, Ms. Thao Perry, and Ms. Xiaofen Li for their contribution to the discovery and chemical synthesis of CVT-6694, and Dr. Jack Wells for chemical synthesis of IPDX.

Received in original form March 28, 2003

Received in final form June 30, 2003


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Holgate, S. T. 2002. Asthma: more than an inflammatory disease. Curr. Opin. Allergy Clin. Immunol. 2:27–29.[Medline]
  2. Hirst, S. J. 2000. Airway smooth muscle as a target in asthma. Clin. Exp. Allergy 30:54–59.
  3. Chung, K. F. 2000. Airway smooth muscle cells: contributing to and regulating airway mucosal inflammation? Eur. Respir. J. 15:961–968.[Abstract]
  4. Coutts, A., G. Chen, N. Stephens, S. Hirst, D. Douglas, T. Eichholtz, and N. Khalil. 2001. Release of biologically active TGF-beta from airway smooth muscle cells induces autocrine synthesis of collagen. Am. J. Physiol. Lung Cell. Mol. Physiol. 280:L999–1008.[Abstract/Free Full Text]
  5. Ammit, A. J., R. K. Hoffman, Y. Amrani, A. L. Lazaar, D. W. Hay, T. J. Torphy, R. B. Penn, and R. A. Panettieri, Jr. 2000. Tumor necrosis factor-{alpha}–induced secretion of RANTES and interleukin-6 from human airway smooth-muscle cells: modulation by cyclic adenosine monophosphate. Am. J. Respir. Cell Mol. Biol. 23:794–802.[Abstract/Free Full Text]
  6. Cushley, M. J., A. E. Tattersfield, and S. T. Holgate. 1984. Adenosine-induced bronchoconstriction in asthma: antagonism by inhaled theophylline. Am. Rev. Respir. Dis. 129:380–384.[Medline]
  7. Driver, A. G., C. A. Kukoly, S. Ali, and S. J. Mustafa. 1993. Adenosine in bronchoalveolar lavage fluid in asthma. Am. Rev. Respir. Dis. 148:91–97.[Medline]
  8. Polosa, R. 2002. Adenosine-receptor subtypes: their relevance to adenosine-mediated responses in asthma and chronic obstructive pulmonary disease. Eur. Respir. J. 20:488–496.[Abstract/Free Full Text]
  9. Cushley, M. J., and S. T. Holgate. 1985. Adenosine-induced bronchoconstriction in asthma: role of mast cell- mediator release. J. Allergy Clin. Immunol. 75:272–278.[CrossRef][Medline]
  10. Marquardt, D. L., C. W. Parker, and T. J. Sullivan. 1978. Potentiation of mast cell mediator release by adenosine. J. Immunol. 120:871–878.[Abstract/Free Full Text]
  11. Feoktistov, I., and I. Biaggioni. 1995. Adenosine A2b receptors evoke interleukin-8 secretion in human mast cells: an enprofylline-sensitive mechanism with implications for asthma. J. Clin. Invest. 96:1979–1986.
  12. Zhong, H., J. L. Chunn, J. B. Volmer, J. R. Fozard, and M. R. Blackburn. 2001. Adenosine-mediated mast cell degranulation in adenosine deaminase-deficient mice. J. Pharmacol. Exp. Ther. 298:433–440.[Abstract/Free Full Text]
  13. Huang, S., S. Apasov, M. Koshiba, and M. Sitkovsky. 1997. Role of A2a extracellular adenosine receptor-mediated signaling in adenosine-mediated inhibition of T-cell activation and expansion. Blood 90:1600–1610.[Abstract/Free Full Text]
  14. Walker, B. A., M. A. Jacobson, D. A. Knight, C. A. Salvatore, T. Weir, D. Zhou, and T. R. Bai. 1997. Adenosine A3 receptor expression and function in eosinophils. Am. J. Respir. Cell Mol. Biol. 16:531–537.[Abstract]
  15. Cronstein, B. N. 1997. Adenosine regulation of neutrophil function and inhibition of inflammation via adenosine receptors. In K. A. Jacobson and M. F. Jarvis, editors. Purinergic approaches in experimental therapeutics. Wiley-Liss, New York. 285–299.
  16. Hasko, G., C. Szabo, Z. H. Nemeth, V. Kvetan, S. M. Pastores, and E. S. Vizi. 1996. Adenosine receptor agonists differentially regulate IL-10, TNF-alpha, and nitric oxide production in RAW 264.7 macrophages and in endotoxemic mice. J. Immunol. 157:4634–4640.[Abstract]
  17. Feoktistov, I., A. E. Goldstein, S. Ryzhov, D. Zeng, L. Belardinelli, T. Voyno-Yasenetskaya, and I. Biaggioni. 2002. Differential expression of adenosine receptors in human endothelial cells: role of A2B receptors in angiogenic factor regulation. Circ. Res. 90:531–538.[Abstract/Free Full Text]
  18. Feoktistov, I., E. M. Garland, A. E. Goldstein, D. Zeng, L. Belardinelli, J. N. Wells, and I. Biaggioni. 2001. Inhibition of human mast cell activation with the novel selective adenosine A(2B) receptor antagonist 3-isobutyl-8-pyrrolidinoxanthine (IPDX)(2). Biochem. Pharmacol. 62:1163–1173.[CrossRef][Medline]
  19. Michoud, M. C., G. Napolitano, K. Maghni, V. Govindaraju, A. Cogo, and J. G. Martin. 2002. Effects of extracellular triphosphate nucleotides and nucleosides on airway smooth muscle cell proliferation. Am. J. Respir. Cell Mol. Biol. 27:732–738.[Abstract/Free Full Text]
  20. Fozard, J. R., and J. P. Hannon. 2000. Species differences in adenosine receptor-mediated bronchoconstrictor responses. Clin. Exp. Allergy 30:1213–1220.[CrossRef][Medline]
  21. Mundell, S. J., M. E. Olah, R. A. Panettieri, J. L. Benovic, and R. B. Penn. 2001. Regulation of G protein-coupled receptor-adenylyl cyclase responsiveness in human airway smooth muscle by exogenous and autocrine adenosine. Am. J. Respir. Cell Mol. Biol. 24:155–163.[Abstract/Free Full Text]
  22. Holgate, S. T., M. K. Church, and R. Polosa. 1991. Adenosine: a positive modulator of airway inflammation in asthma. Ann. NY Acad. Sci. 629:227–236.[Medline]
  23. Broide, D. H., M. Lotz, A. J. Cuomo, D. A. Coburn, E. C. Federman, and S. I. Wasserman. 1992. Cytokines in symptomatic asthma airways. J. Allergy Clin. Immunol. 89:958–967.[CrossRef][Medline]
  24. Alam, R., J. York, M. Boyars, S. Stafford, J. A. Grant, J. Lee, P. Forsythe, T. Sim, and N. Ida. 1996. Increased MCP-1, RANTES, and MIP-1alpha in bronchoalveolar lavage fluid of allergic asthmatic patients. Am. J. Respir. Crit. Care Med. 153:1398–1404.[Abstract]
  25. Martin, L. D., L. G. Rochelle, B. M. Fischer, T. M. Krunkosky, and K. B. Adler. 1997. Airway epithelium as an effector of inflammation: molecular regulation of secondary mediators. Eur. Respir. J. 10:2139–2146.[Abstract]
  26. De, S., E. T. Zelazny, J. F. Souhrada, and M. Souhrada. 1995. IL-1 beta and IL-6 induce hyperplasia and hypertrophy of cultured guinea pig airway smooth muscle cells. J. Appl. Physiol. 78:1555–1563.[Abstract/Free Full Text]
  27. Elias, J. A., Z. Zhu, G. Chupp, and R. J. Homer. 1999. Airway remodeling in asthma. J. Clin. Invest. 104:1001–1006.[Medline]
  28. Lukacs, N. W. 2001. Role of chemokines in the pathogenesis of asthma. Nat. Rev. Immunol. 1:108–116.[CrossRef][Medline]
  29. Karpus, W. J., N. W. Lukacs, K. J. Kennedy, W. S. Smith, S. D. Hurst, and T. A. Barrett. 1997. Differential CC chemokine-induced enhancement of T helper cell cytokine production. J. Immunol. 158:4129–4136.[Abstract]
  30. Campbell, E. M., I. F. Charo, S. L. Kunkel, R. M. Strieter, L. Boring, J. Gosling, and N. W. Lukacs. 1999. Monocyte chemoattractant protein-1 mediates cockroach allergen-induced bronchial hyperreactivity in normal but not CCR2-/- mice: the role of mast cells. J. Immunol. 163:2160–2167.[Abstract/Free Full Text]
  31. Vanden Berghe, W., L. Vermeulen, G. De Wilde, K. De Bosscher, E. Boone, and G. Haegeman. 2000. Signal transduction by tumor necrosis factor and gene regulation of the inflammatory cytokine interleukin-6. Biochem. Pharmacol. 60:1185–1195.[CrossRef][Medline]
  32. Shyy, Y. J., Y. S. Li, and P. E. Kolattukudy. 1990. Structure of human monocyte chemotactic protein gene and its regulation by TPA. Biochem. Biophys. Res. Commun. 169:346–351.[CrossRef][Medline]
  33. Sitaraman, S. V., D. Merlin, L. Wang, M. Wong, A. T. Gewirtz, M. Si-Tahar, and J. L. Madara. 2001. Neutrophil-epithelial crosstalk at the intestinal lumenal surface mediated by reciprocal secretion of adenosine and IL-6. J. Clin. Invest. 107:861–869.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. E. Cagnina, S. I. Ramos, M. A. Marshall, G. Wang, C. R. Frazier, and J. Linden
Adenosine A2B receptors are highly expressed on murine type II alveolar epithelial cells
Am J Physiol Lung Cell Mol Physiol, September 1, 2009; 297(3): L467 - L474.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Zhou, A. Mohsenin, E. Morschl, H. W. J. Young, J. G. Molina, W. Ma, C.-X. Sun, H. Martinez-Valdez, and M. R. Blackburn
Enhanced Airway Inflammation and Remodeling in Adenosine Deaminase-Deficient Mice Lacking the A2B Adenosine Receptor
J. Immunol., June 15, 2009; 182(12): 8037 - 8046.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
J. A. Auchampach, L. M. Kreckler, T. C. Wan, J. E. Maas, D. van der Hoeven, E. Gizewski, J. Narayanan, and G. E. Maas
Characterization of the A2B Adenosine Receptor from Mouse, Rabbit, and Dog
J. Pharmacol. Exp. Ther., April 1, 2009; 329(1): 2 - 13.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Ryzhov, R. Zaynagetdinov, A. E. Goldstein, S. V. Novitskiy, M. M. Dikov, M. R. Blackburn, I. Biaggioni, and I. Feoktistov
Effect of A2B Adenosine Receptor Gene Ablation on Proinflammatory Adenosine Signaling in Mast Cells
J. Immunol., June 1, 2008; 180(11): 7212 - 7220.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
S. Ryzhov, R. Zaynagetdinov, A. E. Goldstein, S. V. Novitskiy, M. R. Blackburn, I. Biaggioni, and I. Feoktistov
Effect of A2B Adenosine Receptor Gene Ablation on Adenosine-Dependent Regulation of Proinflammatory Cytokines
J. Pharmacol. Exp. Ther., February 1, 2008; 324(2): 694 - 700.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. Mohsenin, T. Mi, Y. Xia, R. E. Kellems, J.-F. Chen, and M. R. Blackburn
Genetic removal of the A2A adenosine receptor enhances pulmonary inflammation, mucin production, and angiogenesis in adenosine deaminase-deficient mice
Am J Physiol Lung Cell Mol Physiol, September 1, 2007; 293(3): L753 - L761.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
S. J. Mustafa, A. Nadeem, M. Fan, H. Zhong, L. Belardinelli, and D. Zeng
Effect of a Specific and Selective A2B Adenosine Receptor Antagonist on Adenosine Agonist AMP and Allergen-Induced Airway Responsiveness and Cellular Influx in a Mouse Model of Asthma
J. Pharmacol. Exp. Ther., March 1, 2007; 320(3): 1246 - 1251.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
H. Zhong, Y. Wu, L. Belardinelli, and D. Zeng
A2B Adenosine Receptors Induce IL-19 from Bronchial Epithelial Cells, Resulting in TNF-{alpha} Increase
Am. J. Respir. Cell Mol. Biol., November 1, 2006; 35(5): 587 - 592.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. F. Ethier and J. M. Madison
Adenosine A1 Receptors Mediate Mobilization of Calcium in Human Bronchial Smooth Muscle Cells
Am. J. Respir. Cell Mol. Biol., October 1, 2006; 35(4): 496 - 502.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. D. Douillet, W. P. Robinson III, P. M. Milano, R. C. Boucher, and P. B. Rich
Nucleotides induce IL-6 release from human airway epithelia via P2Y2 and p38 MAPK-dependent pathways
Am J Physiol Lung Cell Mol Physiol, October 1, 2006; 291(4): L734 - L746.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
L. M. Kreckler, T. C. Wan, Z.-D. Ge, and J. A. Auchampach
Adenosine Inhibits Tumor Necrosis Factor-{alpha} Release from Mouse Peritoneal Macrophages via A2A and A2B but Not the A3 Adenosine Receptor
J. Pharmacol. Exp. Ther., April 1, 2006; 317(1): 172 - 180.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. Roman, H. N. Rivera, S. Roser-Page, S. V. Sitaraman, and J. D. Ritzenthaler
Adenosine induces fibronectin expression in lung epithelial cells: implications for airway remodeling
Am J Physiol Lung Cell Mol Physiol, February 1, 2006; 290(2): L317 - L325.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
S. Gessi, K. Varani, S. Merighi, E. Cattabriga, C. Pancaldi, Y. Szabadkai, R. Rizzuto, K.-N. Klotz, E. Leung, S. Mac Lennan, et al.
Expression, Pharmacological Profile, and Functional Coupling of A2B Receptors in a Recombinant System and in Peripheral Blood Cells Using a Novel Selective Antagonist Radioligand, [3H]MRE 2029-F20
Mol. Pharmacol., June 1, 2005; 67(6): 2137 - 2147.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
H. Zhong, L. Belardinelli, T. Maa, and D. Zeng
Synergy between A2B Adenosine Receptors and Hypoxia in Activating Human Lung Fibroblasts
Am. J. Respir. Cell Mol. Biol., January 1, 2005; 32(1): 2 - 8.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
C. D. Douillet, W. P. Robinson III, B. L. Zarzaur, E. R. Lazarowski, R. C. Boucher, and P. B. Rich
Mechanical Ventilation Alters Airway Nucleotides and Purinoceptors in Lung and Extrapulmonary Organs
Am. J. Respir. Cell Mol. Biol., January 1, 2005; 32(1): 52 - 58.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
I. Feoktistov, S. Ryzhov, H. Zhong, A. E. Goldstein, A. Matafonov, D. Zeng, and I. Biaggioni
Hypoxia Modulates Adenosine Receptors in Human Endothelial and Smooth Muscle Cells Toward an A2B Angiogenic Phenotype
Hypertension, November 1, 2004; 44(5): 649 - 654.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-0118OCv1
30/1/118    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhong, H.
Right arrow Articles by Zeng, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhong, H.
Right arrow Articles by Zeng, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2004 American Thoracic Society.