help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Published ahead of print on June 5, 2003, doi:10.1165/rcmb.2002-0110OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-0110OCv1
30/1/12    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ricci, A.
Right arrow Articles by Bronzetti, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ricci, A.
Right arrow Articles by Bronzetti, E.
American Journal of Respiratory Cell and Molecular Biology. Vol. 30, pp. 12-19, 2004
© 2004 American Thoracic Society
DOI: 10.1165/rcmb.2002-0110OC

Neurotrophin and Neurotrophin Receptor Protein Expression in the Human Lung

Alberto Ricci, Laura Felici, Salvatore Mariotta, Francesco Mannino, Giovanni Schmid, Claudio Terzano, Giuseppe Cardillo, Francesco Amenta and Elena Bronzetti

Dipartimento di Scienze Cardiovascolari e Respiratorie, Università di Roma La Sapienza, Rome; Unità Operativa di Chirurgia Toracica, Ospedale Carlo Forlanini, Rome; and Dipartimento di Farmacologia e Medicina Sperimentale, Università di Camerino, Camerino, Italy

Address correspondence to: Alberto Ricci, M.D., Dipartimento di Scienze Cardiovascolari e Respiratorie, Università di Roma La Sapienza, Ospedale Sant'Andrea, Via di Grottarossa, 1035–1039, 00189 Roma, Italy. E-mail: alberto.ricci{at}uniroma1.it


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Neurotrophins (NTs) promote survival and differentiation of central and peripheral neurons, and display several activities also in non-neuronal cells. Human lungs synthesize and release NTs, which are probably involved in the pathophysiology of pulmonary disturbances. In this article the expression and anatomic localization of nerve growth factor, brain-derived neurotrophic factor, and NT-3 and of corresponding high-affinity receptors TrkA, TrkB (full-length and truncated [TR-] isoforms), TrkC, and of the low-affinity p75 receptor, were assessed in surgical samples from adult human lung by reverse transcriptase–polymerase chain reaction, Western blot, and immunohistochemistry. NTs and their cognate receptor mRNA and protein transcripts were detected by reverse transcriptase–polymerase chain reaction and immunoblotting, respectively, nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF) mRNA and corresponding protein transcripts being the most expressed. High levels of TrkB-[TR-] mRNA and of its protein transcript were also demonstrated, whereas a low expression of p75 mRNA and of corresponding protein transcript were found. Microanatomic analysis of immunohistochemical study revealed that bronchial epithelial cells were immunoreactive for different NTs, with a higher intensity of BDNF immune staining compared with other NTs, but did not express NT receptor immunoreactivity. Alveolar cells were immunoreactive for TrkA and TrkC receptor protein, but did not display immunoreactivity for NTs or other receptors investigated. Gland cells expressed NT and high-affinity NT receptor immunoreactivity, but not p75 receptor immunoreactivity. NT and low-affinity receptor immunoreactivity was observed within neurons and satellite cells of parasympathetic ganglia as well as in nerve fiber–like structures supplying the bronchopulmonary tree. An obvious immunoreactivity for NTs and NT receptor protein was also observed in intrapulmonary branches of pulmonary artery. Pulmonary lymphocytes and macrophages express nerve growth factor and high-affinity NT receptor immunoreactivity. The role of NTs in non-neuronal tissue including lung has not been clarified yet. The widespread expression of NTs and their receptors in different components of the lung suggests that these factors may contribute to regulate cell function in human lung.

Abbreviations: bronchus-associated lymphoid tissue, BALT • brain-derived neurotrophic factor, BDNF • nerve growth factor, NGF • neurotrophins, NTs • reverse transcriptase–polymerase chain reaction, RT-PCR


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Neurotrophins (NTs) are a family of polypeptide growth factors, including nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), NT-3, NT-4/5, and NT-6 (1). They bind two types of cell surface receptors characterized by different binding affinities and molecular weight. High-affinity NT receptors have a molecular weight of 140–145 kD and display tyrosine-specific protein kinase (Trk) activity. Low-affinity NT receptor (p75) is a glycoprotein receptor, with a molecular weight of 75 kD (1). NGF recognizes specifically the TrkA receptor. BDNF and NT-4/5 activate TrkB receptor, whereas NT-3 activates primarily the TrkC receptor, and to a lesser extent the TrkA and TrkB receptors (2).

The physiologic role of NTs includes promoting differentiation and survival of developing neurons in the central and peripheral nervous system (3). More recently, it has been shown that NTs stimulate differentiation and proliferation of cell types from all three germ layers (2, 4). Trk genes are expressed by a variety of non-neuronal tissues (5), where NTs exhibit pleiotropic responses (2). The expression of detectable amounts of high- and low-affinity NT receptor mRNAs, originally thought to be restricted to sensory, cranial- and dorsal root ganglia and to cells of neural crest origin (6, 7), was reported in lung (5, 8, 9). The expression of BDNF mRNA in lung epithelium (10) as well as of NTs and NT receptors in human pulmonary arteries was also described (11).

It was hypothesized that NTs may play a role in lung function and in the pathophysiology of allergic inflammation (12, 13), but the expression and localization of these factors in the lung was investigated only sparsely (5, 10, 11). The present study was designed to assess the expression and distribution of NTs and high- and low-affinity NT receptors in human lung by molecular biology (reverse transcriptase–polymerase chain reaction [RT-PCR]), immunochemical (Western blot analysis), and immunohistochemical techniques.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Subjects and Tissue Preparation
Surgical samples of lung were obtained from smoking (10) and nonsmoking (5) patients (9 males and 6 females, age range 45–65 yr) undergoing pulmonary lobectomy for nonmalignant pulmonary neoplasms. Specimens used were obtained from portions of parenchyma surrounding the lesions and did not reveal pathologic findings. Specimens were dissected out and homogenized (for RT-PCR and Western blot analysis) or fixed in a buffered 10% formalin solution for 24 h (for immunohistochemistry). Fixed specimens were dehydrated in ethanol and embedded in paraffin. Serial 10-µm-thick sections were obtained using a rotatory microtome, mounted on gelatine-coated coverslips, and processed for immunohistochemistry (see below).

RT-PCR Analysis
Total RNA was extracted from frozen adult human lung (n = 15) at 37°C by using Trizol reagent (Gibco BRL, Gaithersburg, MD) and purified over a cesium chloride cushion by ultra-centrifugation. Total RNA isolated from human lung specimens was treated with DNase I (RQI RNase-free DNase; Promega, Madison, WI) at 37°C for 30 min, at 1 U/10µg total RNA to eliminate contamination by genomic DNA. One microgram of treated total RNA was subjected to transcription into cDNA using a standard method using murine leukemia virus reverse transcriptase (Perkin-Elmer, Boston, MA). Total RNA nonincubated with transcriptase was used in subsequent experiments as a negative control. Resulting cDNA products were amplified by AmpliTaq polymerase (Perkin-Elmer) using oligonucleotides. Primers designed using published NT protein and NT receptor sequences are listed below. NGF 5'CGCTCATCCATCCCATCCCATCTTC, 3'CTTGACAAGGTGTGAGTCGTGGT; BDNF 5'AGGGTTCCGGCGCCACTCCTGACCCT, 3'CTTCAGTTGGCCTTTGTGATACCAGG; NT-3 5'CGAAACGCGTATCGCAGGAGCATAAG, 3'GTTTTTGACTCGGCCTGGCTTCTCTT; TrkA 5'TCTTCACTGAGTTCCTGGAG, 3'TTCTCCACCGGGTCTCCAGA; TrkB full length 5'TACACTTGTACTAAAATACA, 3'GTGTCCCCGATGTCATTCGC; TrkB [TR-] truncated isoform 5'TAAAACCGGTCGGGAACATC, 3'ACCCATCCAGTGGGATCTTA; TrkC 5'CATCCATGTGGAATACTACC, 3'TGGGTCACAGTGATAGGAGG; p75 5'AGCCCACCAGACCGTGTGTG, 3'TTGCAGCTGTTCCACCTCTT. These primers yield oligomer products of distinctive size: NGF, 267 bp; BDNF, 161 bp; NT-3, 203 bp; TrkA, 229 bp; TrkB, 245 bp; TrkB[TR-], 161 bp; TrkC, 228 bp; p75, 663 bp. After 95°C hot start, cycling proceeded for 35 cycles with 2 min at 95°C, 2 min at 62°C using NGF, NT-3, and TrkC primers, at 65°C using BDNF primer, at 60°C with TrkA, TrkB, TrkB[TR-] and p75 primers, followed by 1 min at 72°C. Products were then resolved by electrophoresis.

Sequencing
Sequencing analysis was performed, for each primer set, for RT-PCR products from one adult human lung and from rat brain cDNA. The RT-PCR products were run onto a 10% acrylamide gel and the excised bands were PCR-amplified using appropriate primer sets. PCR products were then purified through MicroSpin S300 Columns (Pharmacia Biotechnology, Upsala, Sweden), sequenced in both DNA strands by ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Applied Biosystems, Fremont, CA) on an automated Applied ABI 377A DNA sequencer (Perkin Elmer). The data obtained were analyzed using a computer assisted sequence software (Sequence Navigator Software; Perkin Elmer). Sequences were comared with the GenBank database (Genetics Computer Group, Madison, WI).

Assessment of Specificity of Antibodies Used
The first step of the study consisted in assessment of the specificity of antibodies used that were obtained from commercial sources. For detecting of NTs and NT receptors the following antisera were used: (i) rabbit anti-NGF polyclonal antibody. It displays less than 1% crossreactivity against recombinant human NT-3, NT-4, and BDNF (sc-548; Santa Cruz Biotechnology, Santa Cruz, CA); (ii) rabbit polyclonal antibody anti-BDNF. It did not crossreact with NT-3 or NGF (sc-546; Santa Cruz); (iii) rabbit polyclonal antibody anti NT-3. It did not crossreact with BDNF or NGF (sc-547; Santa Cruz); (iv) rabbit polyclonal TrkA immunoglobulin. It recognizes an epitope corresponding to aminoacids 763 to 777, mapping adjacent to the carboxy terminus of human trkA p140, noncrossreactive with TrkB or TrkC (sc-118; Santa Cruz); (v) rabbit polyclonal TrkB immunoglobulin it recognizes an epitope corresponding to aminoacids 794 to 808 of mouse trkB p145, noncrossreactive with TrkA or TrkC (sc-012; Santa Cruz); (vi) rabbit polyclonal TrkB [TK-] immunoglobulin. It recognizes the carboxy terminus of the truncated [TK-] TrkB protein precursor, gp95 of mouse origin. Specific recognition of mouse, rat, and human TrkB [TK-] gp95, noncrossreactive with TrkB gp145, TrkA gp140 or TrkC gp140 (sc-119; Santa Cruz); (vii) rabbit polyclonal TrkC immunoglobulin. It recognizes an epitope corresponding to aminoacids 798 to 812 of porcine trkC p140 noncrossreactive with TrkA or TrkB (sc-117; Santa Cruz); (viii) goat polyclonal antibody to human p75 NT receptor; It recognizes the amino acid sequence mapping the carboxy terminus of the p75 NT receptor precursor of human origin, noncrossreactive with other growth factor receptors (sc-6188; Santa Cruz).

The specificity of the Trk antibodies was assessed in membranes obtained from detergent lysates of SF9 cells, infected with recombinant baclovirus encoding human TrkA, TrkB, and TrkC receptors. Melanoma cells expressing human p75 were used as a reference cell population for p75 receptor analysis. Homogenates of rat brain were used as reference tissue for both NT and NT receptor analysis (5). Immunochemical analysis displayed in material obtained from reference cells or tissue the same migration profile typical of NTs and NT receptor protein investigated (see RESULTS), suggesting the suitability of antibodies for the subsequent analysis in pulmonary tissue.

Western Blot Analysis
Lung homogenates were centrifuged at 1,500 x g to remove nuclei and cell debris. The supernatant was re-suspended in an immunoprecipitation assay buffer containing phenylmethylsulfonylfluoride, aprotinin, and leupeptin. Aliquots of supernatant were used for protein assay against a standard of bovine serum albumin. Defined amounts (50 µg) of proteins were loaded on to 10% stacking sodium dodecyl sulfate–polyacrylamide gel and electrophoresed through a 10% sodium dodecyl sulfate–polyacrylamide gel. After electrophoresis, proteins were transferred to nitrocellulose paper. Antibodies were dissolved in 0.1 M phosphate-buffered saline containing bovine serum albumin (1%) and Tween 20 (0.05%). Optimal antibody concentrations were established in a series of preliminary experiments. The specificity of immune reaction was assessed using antibodies pre-adsorbed with corresponding peptides. Anti-NGF, anti-BDNF, and anti–NT-3 antibodies (diluted 1:3,000) and anti-TrkA, anti-full, and truncated TrkB isoforms anti-TrkC (diluted 1:500) and anti-p75NT (diluted 1:50) receptor antibodies were then applied. The product of immune reaction was revealed using secondary anti-rabbit (for all antisera except those raised against p75 NT receptor) or anti-goat (for anti-p75 NT receptor antibodies) horseradish peroxidase–conjugated immunoglobulin (Ig)G. These IgGs were dissolved in phosphate-buffered saline containing nonfat milk (5%) and Tween 20. The immune reaction was then detected using a specific Western blotting detection reagent (ECLTM RPN 2106; Amersham International, Buckinghamshire, UK) and developed using a chemiluminescence film (Hyperfilm; Amersham International). Positive bands were analyzed by a scanning densitometer driven by an Image Quant software.

Immunohistochemistry
Serial 5-µm-thick sections were obtained from formalin-fixed tissues. Paraffin-embedded specimens were cut using a rotatory microtome. Sections were mounted on gelatin-coated slides and processed for immunohistochemistry as described elsewhere (11). Briefly, from each paraffin block, consecutive sections were exposed in sequence to anti-NGF, anti-BDNF, and anti–NT-3 antibodies (diluted: 1:1,000) and to the same antibodies preadsorbed with human ßNGF (10 µg/ml), human BDNF (10 µg/ml), human NT-3 (10 µg/ml), or to anti-TrkA, anti-TrkB, anti-TrkB[TR-], anti-TrkC (diluted: 1:100), anti-p75 (diluted: 1:10) antibodies alone or preadsorbed with the corresponding blocking peptides (10 µg/ml). Optimal antisera dilutions and incubation times were assessed in a series of preliminary experiments. After incubation, slides were rinsed twice in phosphate buffer and exposed for 30 min at 25°C to anti-rabbit (for NT and Trk immunohistochemistry) or anti-goat (for p75NT receptor immunohistochemistry) secondary antibodies diluted 1:100. The product of immune reaction was revealed using 0.05% 3,3-diaminobenzidine in 0.1% H2O2 as a chromogen. Sections were then washed, dehydrated in ethanol, mounted in a synthetic mounting medium, and viewed at a light microscope. Endogenous peroxidase activity was blocked by H2O2, whereas nonspecific IgG binding to glass and tissue was prevented by adding a 3% fetal calf serum to the incubation medium. Further details on the immunohistochemistry protocol are reported in a previous study by our group (11). The background of immune reaction was evaluated by incubating some sections with a nonimmune serum, followed by processing with secondary antibodies.

Image Analysis
The intensity of the immunoreaction developed within bronchial surface and gland epithelium, bronchial and vascular smooth muscle, intrapulmonary ganglionic neurons, alveolar cells, intramucosal bronchus-associated lymphoid tissue (BALT), and alveolar or interstitial macrophages was assessed microdensitometrically with a IAS 2,000 image analyzer (Delta Sistemi, Rome, Italy) connected via a TV camera to a light microscope. The system was calibrated taking as zero the background obtained in sections exposed to preimmune serum. Ten cells of each type investigated were delineated by a diaphragm (diameter 100 µm2) in seven slides per subject (five test slides and two control slides) exposed to different antisera. Analysis therefore included 70 different cells of each population per subject and was made at a final magnification of x250. The intensity of immune staining (test - control value) was assessed by a program of the image analyzer expressing the intensity of immune reaction in arbitrary units. Assessmant of the intensity of immune staining on a linear scale based on the amount of deposition of diaminobenzidine product reaction was made according protocols developed in receptor histochemistry research (14).

Statistics
Values of Western blot densitometry and image analysis are means of measurements of parameters examined per single subject. Quantitative data of the size and intensity of immune bands of NT or NT receptors and of the intensity of immune staining for NTs and NT receptors in different cell populations was made by ANOVA followed by Duncan's multiple range test as a post hoc test. A P < 0.05 was taken as a cutoff of significance.

Chemicals
Rabbit anti-NGF, anti-BDNF, anti–NT-3, anti-TrkA, TrkB, TrkB-[TK-], TrkC, and goat anti-p75 NT receptor indicated above, ß-NGF (sc-548P), BDNF (sc-546), NT-3 (sc-547P), and the following blocking peptides used for raising the corresponding antibodies: TrkA (sc-118P), full length (sc-012P) and truncated isoforms of TrkB (sc-119P), TrkC (sc-117P), and p75 NT (sc-6188P), were purchased from Santa Cruz. Horseradish peroxidase–conjugated secondary antibodies for Western blotting, anti-goat (sc-2033), and anti-rabbit (sc-2004) were purchased from Santa Cruz. Anti-goat peroxidase–conjugated secondary IgGs and anti-rabbit IgG peroxidase–conjugated secondary IgGs were purchased from Sigma Chemical Co. (St. Louis, MO) and Boehringer Mannheim (Germany), respectively. Other chemicals were obtained from Sigma Chemical Co. or Merck (Darmstadt, Germany).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
RT-PCR Analysis
RT-PCR analysis was performed to identify NT and NT receptor transcripts in specimens obtained from different subjects investigated. The specificity of each fragment was checked by both electrophoresis and by sequencing. NGF, BDNF, and NT-3 primers amplified at 267 bp, 161 bp, and 203 bp, respectively (Figure 1A). TrkA, TrkB, TrkB[TR-], TrkC, and p75 primers amplified at 229 bp, 245 bp, 161 bp, 228 bp, and 663 bp, respectively (Figure 1) (15).



View larger version (73K):
[in this window]
[in a new window]
  		Figure 1. NT and NT receptor transcripts expression in adult lung. Amplification of NGF, BDNF, and NT-3 (A) and of TrkA, TrkB, TrkB[TR-], TrkC, and p75 (B) transcripts in three pulmonary samples (lung parenchyma) from male and female smoking (lanes 1 and 2, respectively) and nonsmoking (lane 3) patients (Figure 2), analyzed for the presence of the different transcripts. The size of the RT-PCR products is indicated on the right (MW, lane 6). Accordingly, to ensure complete removal of potential DNA contamination; the total RNA isolated from human lung specimens was treated with DNase I. Total RNA not incubated with the transcriptase was used in the subsequent experiments as a negative control (nRT, lane 5). Positive control was generated using rat brain samples (Br, lane 4). No apparent differences were found in RT-PCR analysis performed in all the subjects, related to sex, age, and smoking or nonsmoking history.

 


View larger version (48K):
[in this window]
[in a new window]
  		Figure 2. Western blot analysis of NGF, BDNF, and NT-3 antibodies. Lane 1: Immunoblots with human ß-NGF and membranes obtained from rat brain exposed to different antibodies tested. Lane 2: Immunoblots with human ß-NGF and membranes obtained from rat brain exposed to different antibodies tested preabsorbed with the corresponding NTs. The antibodies preabsorbed with the corresponding NTs did not develop bands of immunoreactivity. Lane 3: Immunoblots with membranes obtained from human lung specimens from adult male smoking patients undergoing pulmonary lobectomy for nonmalignant neoplasms. Lane 4: Immunoblots with membranes obtained from human lung using antibodies preabsorbed with the corresponding NTs. The preabsorbed antibodies did not develop bands of immunoreactivity. Histograms summarize values of microdensitometry for the respective blots normalized to actin. Densitometry values were obtained by multiplying % optical density x area occupied by immune bands (expressed in µm2). These values are the mean ± SEM of data obtained from single subjects examined within the different groups. Antibodies preadsorbed with corresponding peptides did not develop bands of immunoreactivity (lanes 2 and 4). *P < 0.01 versus BDNF and NT-3.

 
No apparent differences were found in RT-PCR analysis related to sex, age, and smoking or nonsmoking history for different parameters assessed (data not shown).

Western Blot Analysis
The results of immunoblot analysis for NT immunoreactivity and NT receptor immunoreactivity in pulmonary tissue and reference material are shown in Figures 2 and 3, respectively. NGF antibody was bound to a single band at ~ 14 kD in lung and in brain homogenates (Figure 2, lanes 1 and 3). BDNF antibody reacted with a single band at ~ 14 KDa (Figure 2, lanes 1 and 3). NT-3 antibody reacted with a single band of ~ 14 kD (Figure 2, lanes 1 and 3). The use of antibodies preadsorbed with corresponding NTs caused the disappearance of bands of immunoreactivity in pulmonary and in brain tissue (Figure 2, lane 2).



View larger version (31K):
[in this window]
[in a new window]
  		Figure 3. Western blot analysis of TrkA, TrkB, TrkB [TR-], TrkC, and p75 antibodies. Lane 1: Immunoblots with membranes obtained from rat brain exposed to different antibodies tested. Lane 2: Immunoblots with membranes obtained from infected SF9 cells exposed to TrkA, TrkB, TrkB[TR-], and TrkC antibodies and from human melanoma cells exposed to p75-NT receptor antibody. Lane 3: Immunoblots with membranes obtained from rat brain exposed to different antibodies tested preabsorbed with the corresponding blocking peptides. The antibodies preabsorbed with the corresponding peptides did not develop bands of immunoreactivity. Lane 4: Immunoblots with membranes obtained from human lung specimens from adult male nonsmoking patients undergoing pulmonary lobectomy for nonmalignant neoplasms. Lane 5: Immunoblots with membranes obtained from human lung using antibodies preabsorbed with the corresponding blocking peptides. The preabsorbed antibodies did not develop bands of immunoreactivity. Histograms summarize values of microdensitometry for the respective blots normalized to actin. Densitometry values were obtained by multiplying % optical density x area occupied by immune bands (expressed in µm2). These values are the mean ± SEM of data obtained from single subjects examined within the different groups. *P < 0.01 versus TrkA, TrkC, and p75.

 
TrkA antibody reacted with a single band of 140 kD both in pulmonary tissue and in infected SF9 cells (Figure 3, lanes 1 and 3), as well as TrkB antibody (Figure 3, lanes 1 and 3). TrkB-[TR-] antibody was bound to an immune band of 95 kD (Figure 3, lanes 1 and 3), whereas TrkC antibody was bound to an immune band of ~ 140 kD (Figure 3, lanes 1 and 3). p75-NT receptor antibody reacted with a band of 75 kD both in pulmonary tissue and in human melanoma cells (Figure 3, lanes 1 and 3). The use of antibodies preadsorbed with corresponding receptor blocking peptides caused the disappearance of bands of immunoreactivity both in pulmonary tissue and in reference cells (Figure 3, lane 2).

NGF was the NT most expressed in human pulmonary tissue, followed in descending order by BDNF and NT-3 (Figure 2) as revealed by microdensitometric analysis of bands of immunoreactivity (Figure 2, right-hand panels) normalized to actin (Figures 2 and 3, lane 4). NT receptor microdensitometry showed that the two isoforms of TrkB receptor were the most expressed followed in descending order by TrkA, TrkC and p75 (Figure 3, right-hand panels).

Immunohistochemistry
Neurotrophin immunoreactivity. In ciliated bronchial epithelium a slight NGF immunoreactivity, an intense BDNF immunoreactivity and a slight NT-3 immunoreactivity were observed (Table 1 and Figure 4). In bronchial smooth muscle and in bronchial gland epithelium, the intensity of immune staining was similar for the 3 NTs, although bronchial gland immunoreactivity was stronger than in smooth muscle (Table 1 and Figure 4). An obvious NT immunoreactivity was noticeable in neurons and to a lesser extent in satellite cells of intrapulmonary (parasympathetic) ganglia (Table 1 and Figure 5). Intrapulmonary nerve fiber–like structures were also immunoreactive for NTs, and their number was higher than that of immunostained ganglionic neurons (Table 1 and Figure 5). Microdensitometric analysis performed on nerve cell bodies revealed a moderate immunoreactivity for NGF and BDNF and a slight immune reaction for NT-3 (Table 1). No NT immunoreactivity was found in alveolar cells (data not shown), whereas BALT (Table 1 and Figure 6) and alveolar or interstitial macrophages displayed NGF but not BDNF or NT-3 immunoreactivity (Table 1). In BALT, NGF immunoreactivity was located primarily parafollicularly (Figure 6).


View this table:
[in this window]
[in a new window]
  		TABLE 1 NT immunoreactivity microdensitometry in human lung

 


View larger version (197K):
[in this window]
[in a new window]
  		Figure 4. Micrographs of representative NT and NT receptor immunostaining in sections of human lung specimens from adult male smoking patients undergoing pulmonary lobectomy for nonmalignant neoplasms, showing bronchial epithelial cells, smooth muscle, and bronchial glands. Nonspecific (NS) immunostaining was obtained when the section was exposed to the antibodies preabsorbed with the corresponding blocking peptides. Note the localization of specific immunostaining using NGF and BDNF antibodies within ciliated cells (CC), basal cells (BC), and smooth muscle cells (sm). Sierous bronchial gland cell bodies developed a specific NGF and TrkA immunoreactivity (arrowheads), as well as interstitial fusiform cell bodies that resemble fibroblasts (arrows). BM, basal membrane; M, mucous cells. Calibration bar: 25 µm.

 


View larger version (190K):
[in this window]
[in a new window]
  		Figure 5. Micrographs of NTs and NT receptors immunostaining in sections of human postganclionic neurons (n) and within nerve fibers (f) from adult male or female smoking patients undergoing pulmonary lobectomy for nonmalignant pulmonary neoplasms. NS, nonspecific immunostaining. Some neurons express NT receptor and p75 immunoreactivity. Satellite cells display NT and NT receptor immunoreactivity. Calibration bar: 25 µm.

 


View larger version (106K):
[in this window]
[in a new window]
  		Figure 6. Micrographs of intramucosal bronchus-associated lymphoid tissue (BALT) from an adult smoking male patient exposed to NGF and TrkA antibodies. Note the intense immunoreaction developed within parafollicular area in which are located CD3 immunoreactive lymphocytes. No immunostaining was observed in the follicular central area. Calibration bar: 25 µm.

 
The tunica media of different-sized intrapulmonary branches of the pulmonary artery displayed NT immunoreactivity, slightly more pronounced for NGF and BDNF compared with NT-3 (Table 1). The intensity of immune staining was similar irrespective of the size of vessels investigated (data not shown).

Neurotrophin receptor immunoreactivity. Ciliated bronchial epithelium did not display Trk or p75-NT receptor protein immunoreactivity (Table 2). In bronchial smooth muscle a moderate Trk but not p75-NT receptor protein immunoreactivity was noticeable, TrkB-[TR-] immunoreactivity being the most expressed (Table 2). A faint Trk receptor immunoreactivity was also observed in bronchial glands, which were negative for p75-NT receptor protein immunoreactivity (Table 2 and Figure 4). Ganglionic neurons did not display Trk receptor immunoreactivity, but were immunoreactive for p75-NT receptor protein (Table 2 and Figure 5). Nerve fiber–like profiles displayed a moderate immunoreactivity for both high and low affinity NT receptors (Table 2 and Figure 5). Pulmonary alveoli were immunoreactive for Trk A and Trk C, but not for other NT receptors investigated (Table 2 and Figure 7). BALT was immunoreactive for TrkA only (Table 2 and Figure 6), whereas macrophages displayed immunoreactivity for high-affinity NT receptors. Among these receptors, Trk B displayed the most intense immunostaining, followed by TrkA, TrkC, and TrkB-[TR-] receptor protein immunoreactivity (Table 2).


View this table:
[in this window]
[in a new window]
  		TABLE 2 NT receptor immunoreactivity microdensitometry in human lung

 


View larger version (107K):
[in this window]
[in a new window]
  		Figure 7. Micrographs of TrkA and TrkC immunostaining in the alveolus of smoking patients. Note the immunoreactivity within membranous pneumocytes and type 2 cells (arrowheads) that protrude into the alveolar lumen (L). NS, nonspecific immunostaining. Calibration bar: 25 µm.

 
High- and low-affinity NT receptor protein immunoreactivity was also observed within the wall of different-sized pulmonary artery branches (Table 2).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The present study provides direct evidence that different components of human lung express NGF, BDNF, and NT-3 as well as the corresponding high- and low-affinity NT receptors. This work represents an extension of previous investigations of our group that have demonstrated NTs and their receptors in alveolar macrophages (16), in the pulmonary vascular tree (11), and in lung cancer (17). Our findings confirm evidence that NTs are not confined to central nervous system or to neuronal elements, but are also present in non-neuronal tissues such as human lung. The demonstration of a different pattern of expression and localization of NTs and their receptors in lung suggest that NTs may have a functional role.

The expression of NTs and NT receptors in target organs of the peripheral nervous system was reported. These growth factors promote the survival and function of local neurons (1). Nevertheless, the occurrence of NT synthesis and the expression of NT membrane receptors on non-neuronal cells of adult lung implies that locally produced NTs are able to exert direct functional and biological activities on cells endowed with these receptors. Our observations support the hypothesis that biological actions of NTs within lung can be exerted in a broader range of sites throughout the entire life span and in different pathologic conditions (17, 18).

Epithelial cells of adult human bronchial mucosa express BDNF, and to a lesser extent NGF and NT-3 immunoreactivity. These data are in line with previous evidence of an abundant production of BDNF and NGF by adult visceral epithelia under basal and proinflammatory conditions (10, 19–21). In situ or cultured human bronchial epithelial cells express NTs, and their production was significantly augmented if stimulated by interleukin-1ß or tumor necrosis factor-{alpha} (20). In addition, BDNF mRNA was found in the lung epithelium (10, 19). Therefore, epithelial cells may participate by increasing NT production in allergic inflammation (18, 22, 23). Lung epithelium is not immunoreactive for NT receptors. This suggests that NTs may act as paracrine factors in regulating functional properties of neuronal and non-neuronal structures in adulthood as described in visceral epithelia (2, 5, 10). These observations are consistent with the findings of unaltered respiratory epithelium in knockout BDNF +/- mice (10).

Bronchial smooth muscle expresses NTs and NT receptor immunoreactivity. Changes of bronchial and bronchiolar smooth muscle are a prominent histopathologic feature of asthma and may contribute to airway hyperresponsiveness. NTs are potential mediators of airway inflammation during asthma and lung injury (18, 23); it is therefore possible that NTs may promote respiratory smooth muscle mitogenesis, hyperplasia, and/or a proapoptotic effect and remodeling, similar to that described in hypertensive vascular smooth muscle (24). The demonstration of an NT system in bronchial smooth muscle adds new insights on a modulatory role of NTs on airway smooth muscle. On the other hand, NT production by smooth muscle may represent a trophic signal promoting the development of innervation. In line with this hypothesis is the demonstration of qualitative and/or quantitative changes of peripheral neurons as a consequence of locally produced NTs as well as the development of hyperinnervation in transgenic mice overexpressing NGF (25). The occurrence of NT and NT receptor immunoreactivity in bronchial glands suggests that NTs may also control glandular function in these glands acting as paracrine and/or autocrine factors.

Alveolar cells do not display NT immunoreactivity, but express TrkA and TrkC receptor immunoreactivity. These findings, which are consistent with a previous study (19), suggest that these cells are sensitive to the influence of NTs synthesized and released elsewhere in lung.

NT and low-affinity NT receptor immunoreactivity was also demonstrated in pulmonary parasympathetic ganglia, with immune reaction located in nerve and satellite cells. The role of NTs in modulation of parasympathetic neuron phenotype and function has been already described in several organs (26, 27). Interactions between parasympathetic and sympathetic nerves represent an important regulatory mechanism control lung visceral target function. The presence of parasympathetic intrapulmonary ganglion cells displaying p75 receptor immunoreactivity is in line with identification of a p75 receptor axonal transport mechanism for NTs in efferent vagal neurons belonging to the dorsal motor nucleus (28). In addition, neural tissue in fetal mouse lung explants exhibits a striking increase in the amount of p75 receptor when stimulated with neurotrophic factors, suggesting a role for this receptor during lung development (29). The larger number of NT-immunoreactive nerve fibers compared with parasympathetic nerve cell bodies displaying NT immunoreactivity suggests that these fibers belong also to the sympathetic component of autonomic nervous system in which the presence of NTs is documented (1).

The expression of NTs and NT receptors within immune cells, pulmonary macrophages, and in BALT confirms the possible role of these growth factors in the modulation of airway immune functions. The observations of the present study extend and tend to support previous findings reporting NT and NT receptor immunoreactivity in alveolar macrophages and pulmonary interstitium (16, 19). Both lymphocytes and antigen-presenting cells like macrophages express TrkA receptor and store and synthesize NTs. BALT is present in healthy adults and may be considered as a part of lung immunologic defense (16, 30). Our findings are in line with and support the view that NTs are in a key position to exert an effect on immune-competent cell functions in lung health and disease (31).

The demonstration of NT and NT receptor immunoreactivity in human intrapulmonary arteries supports and extends our previous study showing similar findings in the main branches of exptrapulmonary arteries (11). The expression of NTs and NT receptors in intrapulmonary arteries also suggests the occurrence of a similar mechanism of trophic control along the pulmonary arterial tree.

The above findings, which are consistent with those of a recent investigation in mice (21), demonstrate that NTs are constitutively expressed by the resident cells of human lung. NTs participate in the cross-talk between the lung resident cells and immune cells that may be involved in the pathophysiology of a variety of lung disorders (23–33). Furthermore, NTs, by regulating mesenchymal cell function, may also participate to abnormal repair processes resulting in progressive fibrosis and end-stage lung disease (34).

Received in original form July 10, 2002

Received in final form May 13, 2003


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Lewin, G. R., and Y. A. Barde. 1996. Physiology of neurotrophins. Annu. Rev. Neurosci. 19:289–317.[CrossRef][Medline]
  2. Shibaiama, E., and H. Koizumi. 1996. Cellular localization of the trk neurotrophin receptor family in human non-neuronal tissues. Am. J. Pathol. 148:1807–1818.[Abstract]
  3. Barbacid, M. 1994. The Trk family of neurotrophin receptors. J. Neuroimmunol. 25:1386–1403.
  4. Thomson, T. M., W. J. Rettig, P. G. Chesa, S. H. Green, A. C. Mena, and L. J. Old. 1988. Expression of human nerve growth factor receptor on cell derived from all three germ layers. Exp. Cell Res. 174:533–539.[CrossRef][Medline]
  5. Lomen, H. C., and E. M. Shooter. 1995. Widespread neurotrophin receptor expression in the immune system and other non-neuronal rat tissue. J. Neurochem. 64:1780–1789.[Medline]
  6. Martin-Zanca, D., M. Barbacid, and L. F. Parada. 1990. Expression of the trk proto-oncogene is restricted to the sensory cranial and spinal ganglia of neural crest origin in mouse development. Genes Dev. 4:683–694.[Abstract/Free Full Text]
  7. Kaplan, D. R., B. L. Hempstead, D. Martin-Zanca, M. V. Chao, and L. F. Parada. 1991. The trk proto-oncogene product: a signal transducing receptor for nerve growth factor. Science 252:554–558.[Abstract/Free Full Text]
  8. Barbacid, M., F. Lamballe, D. Pulido, and R. Klein. 1991. The trk family of tyrosine protein kinase receptors. Biochim. Biophys. Acta 1072:235–261.
  9. Valenzuela, D. M., P. C. Maisonpierre, D. J. Glass, E. Rojas, L. Nunez, Y. Kong, D. R. Gies, T. N. Stitt, N. Y. Ip, and G. D. Yancopoulos. 1993. Alternative forms of rat trkC with different functional capabilities. Neuron 10:963–974.[CrossRef][Medline]
  10. Lommatzsch, M., A. Braun, A. Mannsfeldt, V. A. Botchkarev, N. V. Botchkareva, R. Paus, A. Fischer, G. R. Lewin, and H. Renz. 1999. Abundant production of brain-derived neurotrophic factor by adult visceral epithelia implications for paracrine and target-derived neurotrophic functions. Am. J. Pathol. 155:1183–1193.[Abstract/Free Full Text]
  11. Ricci, A., S. Greco, F. Amenta, E. Bronzetti, L. Felici, I. Rossodivita, M. Sabbatini, and S. Mariotta. 2000. Neurotrophins and neurotrophin receptors in human pulmonary arteries. J. Vasc. Res. 37:355–363.[CrossRef][Medline]
  12. Bonini, S., A. Lambiase, S. Bovini, F. Angelucci, L. Magrini, L. Manni, and L. Aloe. 1996. Circulating nerve growth factor levels are increased in humans with allergic diseases and asthma. Proc. Natl. Acad. Sci. USA 93:10955–10960.[Abstract/Free Full Text]
  13. Virchow, J. C., P. Julius, M. Lommatzsch, W. Luttmann, H. Renz, and A. Braun. 1998. Neurotrophins are increased in bronchoalveolar lavage fluid after segmental allergen provocation. Am. J. Respir. Crit. Care Med. 158:2002–2005.[Abstract/Free Full Text]
  14. Barili, P., E. Bronzetti, A. Ricci, D. Zaccheo, and F. Amenta. 2002. Microanatomical localization of dopamine receptor protein immunoreactivity in the rat cerebellar cortex. Brain Res. 854:130–138.
  15. Labouyrie, E., P. Dubus, A. Groppi, F. X. Mahon, J. Ferrer, M. Parrens, J. Reiffers, A. de Mascarel, and J. P. Merlio. 1999. Expression of neurotrophins and their receptors in human bone marrow. Am. J. Pathol. 154:405–415.[Abstract/Free Full Text]
  16. Ricci, A., S. Greco, S. Mariotta, L. Felici, F. Amenta, and E. Bronzetti. 2000. Neurotrophin and neurotrophin receptor expression in alveolar macrophages: an immunocytochemical study. Growth Factors 18:193–202.[Medline]
  17. Ricci, A., S. Greco, S. Mariotta, L. Felici, E. Bronzetti, A. Cavazzana, G. Cardillo, F. Amenta, A. Bisetti, and G. Barbolini. 2001. Neurotrophins and neurotrophin receptors in human lung cancer. Am. J. Respir. Cell Mol. Biol. 25:439–446.[Abstract/Free Full Text]
  18. Hoglund, C. O., F. de Blay, J.-P. Oster, C. Duvernelle, O. Kassel, G. Pauli, and N. Frossard. 2002. Nerve growth factor levels and localization in human asthmatic bronchi. Eur. Respir. J. 20:1110–1116.[Abstract/Free Full Text]
  19. Yamamoto, M., G. Sobue, K. Yamamoto, S. Terao, and T. Mitsuma. 1996. Expression of mRNA for neurotrophic factors(NGF, BDNF, NT-3 and GDNF) and their receptors (p75NGFR, TrkA, TrkB and TrkC) in the adult human peripheral nervous system and non neuronal tissues. Neurochem. Res. 21:929–938.[Medline]
  20. Fox, A. J., H. J. Patel, P. J. Barnes, and M. G. Belvisi. 2001. Release of nerve growth factor by human pulmonary epithelial cells: role in airway inflammatory diseases. Eur. J. Pharmacol. 424:159–162.[CrossRef][Medline]
  21. Hikawa, S., H. Kobayashi, N. Hikawa, T. Kusakabe, H. Hiruma, T. Takenaka, T. Tomita, and T. Kawakami. 2002. Expression of neurotrophins and their receptors in peripheral lung cells of mice. Histochem. Cell Biol. 118:51–58.[Medline]
  22. Noga, O., G. Hanf, C. Schaper, A. O'Connor, and G. Kunkel. 2001. The influence of inhalative corticosteroids on circulating nerve growth factor, brain derived neurotrophic factor and neurotrophin-3 in allergic asthmatics. Clin. Exp. Allergy 31:1906–1912.[CrossRef][Medline]
  23. Renz, H. 2001. The role of neurotrophins in bronchial asthma. Eur. J. Pharmacol. 429:231–237.[CrossRef][Medline]
  24. Bono, F., I. Lamarche, and J. M. Herbert. 1997. NGF exhibits a pro-apoptotic activity for human vascular smooth muscle cells that is inhibited by TGFbeta1. FEBS Lett. 416:243–246.[CrossRef][Medline]
  25. Hoyle, G. W., R. M. Graham, J. B. Finkelstein, K. P. Nguyen, D. Gozal, and M. Friedman. 1998. Hyperrinnervation of the airways in transgenic mice overexpressing nerve growth factor. Am. J. Respir. Cell Mol. Biol. 18:149–157.[Abstract/Free Full Text]
  26. Hasan, W., and P. Smith. 2000. Nerve growth factor expression in parasympathetic neurons: regulation by sympathetic innervation. Eur. J. Neurosci. 12:4391–4397.[CrossRef][Medline]
  27. Smith, P. G., J. D. Warn, J. J. Steinle, D. Krizsan-Agbas, and W. Hasan. 2002. Modulation of parasympathetic neuron phenotipe and function by sympathetic innervation. Auton. Neurosci. 96:33–42.[CrossRef][Medline]
  28. Helke, C. J., K. M. Adryan, J. Fedorowicz, H. Zhuo, J. S. Park, R. Curtis, H. E. Radley, and P. S. Distefano. 1998. Axonal transport of neurotrophins by visceral afferent and efferent neurons of the vagus nerve of the rat. J. Comp. Neurol. 393:102–117.[CrossRef][Medline]
  29. Tollet, J., A. W. Everett, and M. P. Sparrow. 2002. Development of neural tissue and airway smooth muscle in fetal mouse lung explants. Am. J. Respir. Cell Mol. Biol. 26:420–429.[Abstract/Free Full Text]
  30. Richmand, I., G. E. Pritchard, T. Ashcroft, A. Avery, P. A. Corris, and E. H. Walters. 1993. Bronchus associated lymphoid tissue (BALT) in human lung: its distribution in smokers and non smokers. Thorax 48:1130–1134.[Abstract]
  31. Levi-Montalcini, R., S. D. Skaper, R. Dal Toso, L. Petrelli, and A. Leon. 1996. Nerve growth factor: from neurotrophin to neurokine. Trends Neurosci. 19:514–520.[CrossRef][Medline]
  32. Cosgaya, J. M., and A. Aranda. 1995. Nerve growth factor regulates transforming growth factor-beta 1 gene expression by both transcriptional and posttranscriptional mechanisms in PC12 cells. J. Neurochem. 65:2484–2490.[Medline]
  33. Olgart, C., and N. Frossard. 2001. Humal lung fibroblasts secrete nerve growth factor: effect of inflammatory cytokines and glucocorticoids. Eur. Respir. J. 18:115–121.[Abstract/Free Full Text]
  34. Micera, A., E. Vigneti, D. Pickholtz, R. Reich, O. Pappo, S. Bovini, F. X. Maquart, L. Aloe, and F. Levi-Schaffer. 2001. Nerve growth factor displays stimulatory effects on human skin and lung fibroblasts, demonstrating a direct role for this factor in tissue repair. Proc. Natl. Acad. Sci. USA 98:6162–6167.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Cell Biol.Home page
B. D. Sachs, G. S. Baillie, J. R. McCall, M. A. Passino, C. Schachtrup, D. A. Wallace, A. J. Dunlop, K. F. MacKenzie, E. Klussmann, M. J. Lynch, et al.
p75 neurotrophin receptor regulates tissue fibrosis through inhibition of plasminogen activation via a PDE4/cAMP/PKA pathway
J. Cell Biol., July 30, 2007; 177(6): 1119 - 1132.
[Abstract] [Full Text] [PDF]

Home page
 Toxicol SciHome page
A. K. Farraj, N. Haykal-Coates, A. D. Ledbetter, P. A. Evansky, and S. H. Gavett
Neurotrophin Mediation of Allergic Airways Responses to Inhaled Diesel Particles in Mice
Toxicol. Sci., November 1, 2006; 94(1): 183 - 192.
[Abstract] [Full Text] [PDF]

Home page
 J. Appl. Physiol.Home page
T. Taylor-Clark and B. J. Undem
Transduction mechanisms in airway sensory nerves
J Appl Physiol, September 1, 2006; 101(3): 950 - 959.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Y. S. Prakash, A. Iyanoye, B. Ay, C. B. Mantilla, and C. M. Pabelick
Neurotrophin effects on intracellular Ca2+ and force in airway smooth muscle
Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L447 - L456.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Q. Yao, M. A. Haxhiu, S. I. Zaidi, S. Liu, A. Jafri, and R. J. Martin
Hyperoxia enhances brain-derived neurotrophic factor and tyrosine kinase B receptor expression in peribronchial smooth muscle of neonatal rats
Am J Physiol Lung Cell Mol Physiol, August 1, 2005; 289(2): L307 - L314.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Crit. Care Med.Home page
M. Lommatzsch, K. Schloetcke, J. Klotz, K. Schuhbaeck, D. Zingler, C. Zingler, O. Schulte-Herbruggen, H. Gill, P. Schuff-Werner, and J. C. Virchow
Brain-derived Neurotrophic Factor in Platelets and Airflow Limitation in Asthma
Am. J. Respir. Crit. Care Med., January 15, 2005; 171(2): 115 - 120.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. Ahamed, R. T. Venkatesha, E. B. Thangam, and H. Ali
C3a Enhances Nerve Growth Factor-Induced NFAT Activation and Chemokine Production in a Human Mast Cell Line, HMC-1
J. Immunol., June 1, 2004; 172(11): 6961 - 6968.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-0110OCv1
30/1/12    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ricci, A.
Right arrow Articles by Bronzetti, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ricci, A.
Right arrow Articles by Bronzetti, E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2004 American Thoracic Society.