Published ahead of print on June 26, 2003, doi:10.1165/rcmb.2003-0020OC
American Journal of Respiratory Cell and Molecular Biology. Vol. 30, pp. 61-68, 2004
© 2004 American Thoracic Society DOI: 10.1165/rcmb.2003-0020OC
The CCT Promoter Directs High-Level Transgene Expression in Distal Lung Epithelial Cell Lines
Jiming Zhou,
Yong You,
Joseph Zabner,
Alan J. Ryan and
Rama K. Mallampalli
Departments of Internal Medicine and Biochemistry, and the Department of Veterans Affairs Medical Center, The University of Iowa College of Medicine, Iowa City, Iowa
Address correspondence to: Rama K. Mallampalli, M.D., Pulmonary Division, C-33K, GH, Department of Internal Medicine, University of Iowa College of Medicine, Iowa City, IA 52242. E-mail: rama-mallampalli{at}uiowa.edu
 |
Abstract
|
|---|
Gene therapy requires the presence of a robust and yet small promoter to drive high-level expression of desired proteins. In comparative analysis, we investigated the promoter strength of the CTP:phosphocholine cytidylyltransferase promoter (CCT ) with other commonly used promoters, which were all cloned into a similar background vector (PGL3 basic). Transient promoterreporter assays in murine lung epithelial (MLE-12) cells revealed that the core CCT promoter (240 bp) was observed to exhibit a 40-fold, 8-fold, and 3-fold higher level of activity compared with the simian virus 40, human cytomegalovirus, and Rous sarcoma virus promoters, respectively. The CCT promoter was significantly more active than the Clara cell 10, thymidine kinase, and phosphoglycerate kinase promoters. This pattern of high-level expression for CCT was detected primarily in cell lines of distal lung epithelial origin (MLE-12, RLE, H441) and was reduced in other cell lines (A549, CHO, HepG 2). CCT promoter-reporter activity, CCT transcript levels, and immunoreactive protein levels increased significantly in the presence of all-trans retinoic acid. The CCT promoter, in a retinoic acidinducible manner, efficiently directed expression of murine erythropoietin in MLE-12 cells. Collectively, these observations suggest that the CCT construct might be useful to drive high-level, regulatable expression of heterologous proteins in alveolar epithelia.
Abbreviations: adeno-associated virus, AAV CTP:phosphocholine cytidylyltransferase, CCT cytomegalovirus, CMV murine lung epithelial cells, MLE-12 cells polymerase chain reaction, PCR respiratory syncytial virus, RSV simian virus 40, SV40
 |
Introduction
|
|---|
High-level, sustained transgene expression appears to be a key factor in achieving successful gene therapy for genetic diseases. This requires the inclusion of a targeted and highly efficient promoter to drive expression of the gene of interest. For optimal gene expression, the exogenous DNA must often include a polyadenylation signal, relevant tissue-specific enhancers, and a core promoter of sufficient strength. In addition, these DNA constructs often need to be small enough to incorporate into newer viral vectors, such as adeno-associated virus (AAV), which have recently attracted interest in the field of gene therapy (1, 2). AAV's relatively small packaging capacity of 5.0 kB underscores the importance of identifying small promoters that have unique DNA regulatory elements and yet exhibit robust activity allowing for efficient DNA packaging and high-level transgene expression (3, 4).
Currently available promoters used to drive expression of foreign proteins include sequences from viruses such as the cytomegalovirus (CMV) immediate early genes, simian virus 40 (SV40), Rous sarcoma virus (RSV), and adenovirus (58). In vivo transgene expression appears to be of limited duration with some of these promoters. Promoters derived from several mammalian genes may extend transgene expression in vivo or in vitro (6, 9). Some of these promoters are chimeras or cAMP regulatable and thus provide potentially novel approaches for expression of desired proteins (1012). Despite these strategies, the identification of promoters that sufficiently drive transgene expression in vivo and yet allow for efficient packaging into smaller viral vectors represents a significant challenge.
CTP:phosphocholine cytidylyltransferase (CCT) is a key regulatory enzyme required for phosphatidylcholine (PtdCho) synthesis. The enzyme catalyzes a slow reaction in all eukaryotic cells converting cholinephosphate to cytidine diphosphocholine (CDP-choline) via the Kennedy pathway (13). Although CCT is a ubiquitous, essential enzyme, relatively high activities are detected in the lung and within alveolar type II epithelial cells relative to other tissues as the lung is actively involved in the generation of PtdCho, the major phospholipid component of pulmonary surfactant (1416). Accordingly, pharmacologic or genetic maneuvers directed at upregulating CCT activity are associated with increased surfactant PtdCho levels, whereas genetic defects in CCT expression may result in apoptosis (1720).
Three CCT isoforms exist in cells: CCT , CCTß1, and CCTß2. All CCT isoforms are catalytically active, and CCT is the predominant species in mature alveolar epithelia (21, 22). CCT was purified to homogeneity over a decade ago (23). Subsequently, CCT cDNAs from several species were cloned (2426). The genomic organization of murine CCT has been recently determined: it spans 40 kB, has two transcription start sites, and the 5' flanking region lacks TATA or CAAT boxes but contains GC-rich regions typical of promoters found in housekeeping genes (27). Transcriptional analysis indicates that the proximal 5' terminal 200-bp sequence contains consensus elements for several ubiquitous transcription factors (28, 29). Recent studies in our laboratory have determined that the core promoter is localized to a relatively small DNA sequence ( 200 bp), exhibits robust activity, and is further induced by the presence of a putative sterol-regulated enhancer located between 156 and 147 bp (30). Thus, these observations led us to hypothesize that the CCT promoter might direct high-level, regulatable expression of transgenes in vitro. In the present study, we investigated the ability of the core CCT promoter to drive transgene expression using transfectional analysis with promoterreporter constructs. In comparative analysis, the CCT promoter was more active than other commonly used promoters in alveolar epithelial cell lines. In addition, the CCT core sequence was sufficient to drive high-level expression of the heterologous protein, murine erythropoietin, in lung epithelial cells.
 |
Materials and Methods
|
|---|
Materials
The A549, CHO, H441, HepG2, RLE, and murine lung epithelial (MLE-12) cell lines were purchased from American Type Culture Collection (Manassas, VA). Briefly, the A549 was originally derived from a human lung adenocarcinoma, the CHO cell line was derived as a subclone from an ovary of an adult Chinese hamster, and the H441 cell line was established from a papillary lung adenocarcinoma; the HepG2 line was from a hepatocellular carcinoma, the RLE (rat lung epithelial-T-antigen negative) cell line originated from spontaneous immortalization of alveolar type II epithelial cells, and the MLE line originated from pulmonary tumors in a mouse transgenic for the SV40 large T antigen under control of the human surfactant protein C gene promoter region. The luciferase plasmids, pGL3-basic, pGL3-promoter (harboring the SV40 promoter), and pSV-ß-Gal and luciferase assay system were purchased from Promega (Madison, WI). The pBK-CMV plasmid was purchased from Stratagene (La Jolla, CA). The ploxPneo-1 plasmid was a gift from Dr. A. Nagy (Dept. of Molecular and Medical Genetics, University of Toronto, Toronto, ON, Canada [31]), pGL2-CC10 was a gift from Dr. E. Morrisey (Dept. of Medicine, University of Pennsylvania, Philadelphia, PA [32]), and pcDNA3.1-erythropoietin was provided by Dr. J. Zabner (Dept. of Internal Medicine, the University of Iowa, Iowa City, IA). The polyclonal antibody to murine erythropoietin was purchased from R&D Systems (Minneapolis, MN) and the rabbit polyclonal CCT antibody against synthetic peptide was generated as described (21). All restriction enzymes were purchased from New England Biolabs (Beverly, MA). The pREP4 and pCR4-TOPO plasmids and Escherichia coli Top10 competent cells were obtained from Invitrogen (Carlsbad, CA), and the FuGENE6 transfection reagent was purchased from Roche Diagnostics (Indianapolis, IN). The Geneclean2 Kit was obtained from Bio101 (Carlsbad, CA). The luciferase assay system was obtained from Promega, and the Galacto-light plus kit was from TROPIX (St. Louis, MO). The all-trans-retinoic acid and Tri-Reagent were purchased from Sigma Chemical Co. The Advantage cDNA polymerase was from Clontech, (Palo Alto, CA). All DNA sequencing was performed by the University of Iowa DNA core facility. Luciferase and ß-galactosidase activities were determined using a TD-20/20 luminometer (Turner Designs, Sunnyvale, CA).
Cell Culture
A549 cells and CHO cells were maintained in minimal essential medium (MEM) supplemented with 10% fetal bovine serum (FBS). The H441 cells and MLE-12 cells were grown in Dulbecco's Modified Eagle's Medium: nutrient mixture F-12 (DMEM/F12) with 2% FBS and HepG2 cells were grown in similar medium but supplemented with 10% FBS. All cell cultures were incubated at 37°C with 5% CO2. The RLE cells were grown in Ham's F12 medium containing 2 mM L-glutamine and 10% FBS.
Plasmid Construction of pGL3-CMV, pGL3-RSV, and pGL3-TK
Commercially available plasmids pBK-CMV and pREP4 vector were used as templates for polymerase chain reaction (PCR) amplification of the CMV, RSV, and TK promoters. Primers used for amplification of CMV, RSV, and TK promoters were: 5' CMV primer, actcgagcta gcggatctgacggttc; 3' CMV primer, agatctcggg gtcattagtt catagg; 5' RSV primer, actcgaactctcagtacaatctgctc; 3' RSV primer, agatctggcg tttattgtat cgagc; 5' TK primer, actcgagtttgctggcggtgtcc; and 3' TK primer, agatctgcagggtcgctcggtgttc. An Xho1 site was added to the end of all 5' primers, whereas a BgILL site was added to the end of all 3' primers to allow for convenient cloning into pGl3-basic.
PCR was performed using Advantage cDNA polymerase and the following profile: 94°C for 2 min, then 94°C for 30 s, and 68°C for 3 min for a total of 18 cycles. The resulting PCR products (CMV, RSV, and TK fragments) were ligated into the pCR4-TOPO vector before transformation into E. colicompetent cells. The CMV (590 bp), RSV (571 bp), and TK (163 bp) fragments were then directionally subcloned into the pGL3-basic vector using BglII and Xho1 sites. All promoter sequences and orientation were confirmed by DNA sequencing.
Plasmid Construction of pGL3-CCT, pGL3-CC10, and pGL3-PGK
The murine CCT core promoter fragment (-169/+71) was generated using PCR as described using the following primers: 5'-agcgttcggctcagtcac-3' (left) and 5'-tcaactcctccaggctcc-ggt-3' (right) (33). The cloned fragment included the proximal 5' flanking region, two adjacent transcription start sites, and up to 71 nt of the first exon corresponding to the 5' untranslated region of the mouse CCT transcript (28). This fragment was then directionally cloned into pGL3 basic. The CC10 promoter fragment was removed from pGL2-CC10 and also cloned into pGL3-basic using Kpn1 and Xho1 sites. Likewise, the PGK promoter fragment was excised from the ploxPneo-1 plasmid and cloned into pGL3-basic using Sma1 and Xho1 restriction sites. These promoter sequences and orientation were also confirmed by DNA sequencing.
Transfectional Analysis
Newly constructed pGL3-CMV, pGL3-RSV, pGL3-TK, pGL3-CC10, pGL3-PGK, pGL3-CCT, and the pGL3-promoter (SV40) plasmids were used for subsequent transient transfection experiments. Cells maintained in growth medium were harvested using 0.25% trypsin plus 0.1% EDTA, plated into 12-well tissue culture dishes and allowed to reach 80% confluence before transient transfection. Transfections were performed for 120 min in 0% FBS medium using Fugene 6 reagent and 0.75 µg/well of test plasmid and 0.25 µg/well of pSVß-gal, which was used to control for transfection efficiency. Levels of endogenous ß-galactosidase were negligible in cell lines studied. Immediately after transfections, cells were transferred to medium containing FBS and allowed to recover for various times before cell lysates were harvested in reporter lysis buffer for analysis of luciferase and ß-galactosidase activities. In some studies, cells were exposed to 1 µM all trans-retinoic acid for 330 h after a 12-h recovery before analysis of reporter activity.
Detection of CCT Transcripts Using Real-Time PCR Analysis
Total cellular RNA from MLE cells was obtained using Tri-Reagent. Taqman reverse transcription reagents (Applied Biosystems) were used to generate cDNA from cellular RNA. Real-time PCR was then performed on cDNA using the Applied Biosystems 7,700 real-time PCR instrument and the Taqman Universal PCR master mix. CCT mRNA detection primers were: 5' primer, cctggaaatg tttggtccaga; 3' primer, ctctgcttgg gactgatgg. The Fam-labeled probe was: agggaaaagg tcggatgctg cagg. Taqman rodent GAPDH control regents (VIC probe) were used as the internal control. Standard curves were generated for CCT and compared with GAPDH using serial dilutions of mRNA and found to be linear from 0.0850 ng RNA in the reaction mixture. This range included effective concentrations used in experiments to quantitatively detect CCT transcripts.
Heterologous Expression of Murine Erythropoietin in Lung Epithelia
To determine if the CCT promoter could efficiently drive expression of a heterologous protein in vivo, a pcDNA-CCT-erythropoietin expression vector was constructed by the following steps. First, CCT was amplified by PCR using pGL3-CCT240 as a template with the 5' primer gactagtagc gttcggctca gtcac containing a Spe1 site and the 3' primer caagctttca actcctccag gctc containing a HindIII site. Second, the CMV promoter of pcDNA3.1-erythropoietin was removed by digestion with Spe1/Hind3 and replaced by the CCT240 promoter fragment. The newly constructed pcDNA-CCT-erythropoietin expression vector was verified by DNA sequencing.
Immunoblot Analysis
For immunoblot analysis, equal amounts of protein from cell homogenates were used. Each sample was adjusted to give a final concentration of 60 mM Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 0.1% bromphenol blue, and 5% ß-mercaptoethanol, and heated at 100°C for 5 min. Samples were then electrophoresed through a 10% SDS-polyacrylamide gel and transferred to a polyvinylidene difluoride membrane. Murine erythropoietin and immunoreactive CCT were detected by using a 1:1,000 dilution of primary antibody and an ECL Western blotting detection system as instructed by the manufacturer.
Statistical Analysis
Data are present as means ± SEM. Statistical significance was accepted at the P < 0.05 level by unpaired t test and ANOVA for multiple group analysis.
 |
Results
|
|---|
Comparative Analysis of Viral and Mammalian Promoters
The core CCT promoter containing 240 nt (-168/+71) was compared with other commonly used viral and mammalian promoters for luciferase activity. To make valid comparisons of between individual promoters, we cloned all promoters into the same expression vector system (pGL3). The CCT promoter exhibited a 40-fold, 8-fold, and 3-fold higher level of luciferase activity compared with the SV 40, human CMV, and RSV promoters, respectively, when studied within MLE cells (Figure 1A). When compared in head-to-head studies with mammalian promoters, the CCT promoter also showed robust luciferase activity whereas minimal activity was detected for the CC10, PGK, and TK promoters (Figure 1B). This high level of activity was significantly reduced after deleting 100 bp of the proximal 5' flanking sequence of CCT (data not shown). Additional studies were performed to assess the kinetics of promoter strength by assaying reporter activity at various times following plasmid transfection (Figure 2). The CCT and RSV promoters both exhibited a gradual increase in activity with a peak at 24 h. The temporal pattern of CCT promoter-luciferase activity mirrored RSV promoter expression, but was greater in magnitude and more sustained versus RSV after 20 h of analysis. MLE cells rapidly reach confluence and undergo cell death 30 h after transfection, making long-term analysis (> 28 h) of promoter activity relatively prohibitive. When long-term analysis was performed in H441 cells, CCT expression was detected up to 48 h (data not shown). Thus, the core CCT sequence exhibits high-level constitutive activity in murine lung epithelial cells.
Cell Specificity of CCT Promoter Activity
To determine whether high-level expression of CCT promoter activity was a more widespread phenomenon, we tested activity in other cell types. In all cell lines tested, the CCT promoter showed significantly greater activity than the empty (PGL3 basic) vector. In particular, both MLE and RLE cells expressed 30- to 50-fold greater promoter activity compared with PGL3 basic, and significantly greater activity compared with A549, CHO, and HepG2 cells (Figure 3). These results indicate that CCT promoter expression is relatively cell-specific, with highest activity in distal lung epithelia.
Regulation of the CCT Promoter
We tested whether CCT promoter activity could be further stimulated by physiologic agents that are known to modulate gene expression. Retinoic acid upregulates activity of a variety of promoters and stimulates phosphatidylcholine synthesis (3436). Thus, we examined if retinoic acid might increase CCT promoter activity in lung epithelial cells. MLE cells exposed to all trans-retinoic acid at 1 µM retinoic acid for 3 h were determined to have a 2-fold induction of CCT promoter activity compared with control (Figure 4A). In contrast, the retinoid had no effect on TK reporter activity. In separate studies, real-time PCR analysis revealed that retinoic acid treatment increased CCT mRNA 3-fold compared with control at 24 h of analysis (Figure 4B). These changes in CCT by retinoic acid were associated with an increase in levels of immunoreactive CCT protein (Figures 4C4D). Collectively, these results indicate that retinoic acid can stimulate CCT expression by stimulating CCT gene transcriptional activity.
Heterologous Expression of Murine Erythropoietin by the CCT Promoter
To complement studies of reporter analysis to assess promoter strength, we next examined whether the CCT promoter was capable of driving expression of heterologous proteins. The CCT promoter was cloned upstream of the murine erythropoietin transgene and the resulting construct, pcDNA3.1-CCT-Epo, was used to compare with the CMV promoter construct (pcDNA3.1-CMV-Epo) in transfectional studies. Surprisingly, a moderate amount of detectable endogenous erythropoietin was observed in MLE cells on immunoblots, which existed overwhelmingly as 117-kD trimers (Figure 5). Cells transfected with the pcDNA3.1-CCT-Epo construct exhibited high-level expression of erythropoietin comparable in magnitude to cells transfected with the pcDNA3.1-CMV-Epo plasmid (Figure 5A). Cells transfected with pcDNA3.1-CCT-Epo also exhibited induction of erythropoietin protein levels in response to retinoic acid, whereas there was no effect of the agent on endogenous erythropoietin (Figure 5B). Thus, the CCT promoter can effectively drive the expression of a transgene in lung epithelia in a retinoic regulated manner.
 |
Discussion
|
|---|
A major factor influencing the level of expression of foreign genes is the strength of the chosen promoter (37, 38). The purpose of this study was to examine the activity of the CCT promoter in comparative analysis with several commonly used viral and mammalian promoters. We cloned these gene promoters into identical, enhancerless pGL3-basic luciferase backgrounds to allow for valid comparisons of reporter activity between individual constructs. Using these methods, we observed that the CCT core promoter exhibits robust, inducible activity compared with other promoters, and that this activity is most prominently detected in cells of distal lung epithelial origin. When the murine erythropoietin gene was cloned downstream of the CCT promoter, the protein was expressed at high levels, indicative of its ability to drive the synthesis of recombinant proteins.
Prior studies have generally indicated that the human CMV, SV40, and human elongation factor one- (EF-1 ) promoters are among the strongest in mammalian cells (6, 39, 40). Although highly active in vitro, transgene expression appears to be of limited duration in vivo with some of these promoters presumably due to promoter turnoff (6). To circumvent these limitations, recent approaches have incorporated heterologous enhancers into vectors to optimize gene expression (11, 12, 37). We did not directly test CCT promoter strength against these vectors harboring such enhancers, including the CMVEF-1 enhancer or modified CMV constructs that are commercially available (12, 41). Rather, when compared with the core CMV, RSV, and SV40 promoters cloned into pGL3 basic, our studies consistently demonstrated greater activity for CCT in reporter analysis. Not surprisingly, CCT was also more active in MLE cells than TK, generally regarded as a minimal promoter, and CC10 and PGK, promoters that are active in hematopoietic cell lines (4244).
Some of the differences between the strength of the CCT promoter and other promoters may be attributed, in part, to cell-specificity of expression. For example, in many cell types the CMV promoter is more active than RSV, although in MLE cells this was not the case (8, 45, 46)(Figure 1). Further, the CC10 and PGK promoters are highly active in H441 and 293T cells, respectively, but were almost totally inactive in MLE cells (43, 44). When tested in other cell lines, such as H441 and CHO, we observed that these promoters retained activity (data not shown). Moreover, unlike other promoters, the CCT promoter exhibited significant activity in all cell lines tested; the greatest activity, however, was seen in RLE and MLE with lower expression detected in A549 and CHO cells.
High-level CCT promoter expression in RLE and MLE cell lines suggest that optimal promoter activity is seen in cells of distal lung epithelial or alveolar origin. The observation that CCT promoter activity was highest in cell lines from distal lung epithelia is consistent with the enzyme's role in surfactant PtdCho biosynthesis in alveolar epithelial cells. Absence of comparable robust expression within A549 cells, originally derived from a human lung adenocarcinoma, was, however, somewhat unexpected. This may be attributed to either species differences, the malignant nature of A549 cells, or the fact that these cells exhibit some features more compatible with cells of proximal airway epithelial origin (4751). Further, although these cells express some markers of distal (alveolar type II cell) lung phenotype, studies in our laboratory (data not shown) and by others show that these cells also have relatively low levels of surfactant PtdCho (52). Although the CCT promoter is ubiquitously expressed, high-level distal lung epithelial expression suggests that cell-restricted transactivating factors or coactivators that are not yet fully unidentified play a role in controlling gene activity. In this regard, we and others have shown that sterol-regulatory element binding proteins increase gene transcription in response to lipid deprivation (30, 53). Our observations for high-level CCT promoter activity in cells of alveolar origin resembles cellular expression of related promoters intimately involved in the biosynthesis of other key surfactant components. For example, cis-acting DNA elements contained within a 378-bp fragment, a 275-bp fragment, and a 215-bp fragment of the 5' flanking regions of the surfactant apoprotein A, surfactant apoprotein B, and surfactant apoprotein C genes, respectively, are sufficient to confer expression to alveolar epithelia (5456). It remains to be determined if the 240-bp fragment of the CCT gene is sufficient to direct distal lung epithelial expression in vivo. Overall, these observations suggest that the CCT promoter exhibits relatively broad cellular activity. Further, activity of various promoters is influenced largely by the availability of cell-specific transcriptional regulatory elements needed to support gene activation.
A new finding in our studies is that CCT transcriptional activity is upregulated in response to all-trans retinoic acid. Regulatable genes modulated by heat, or by nutritional or pharmacologic factors such as retinoic acid, represent a potentially attractive feature of promoters used in gene therapy (34, 57, 58). Our results showing activation of the CCT gene by retinoic acid are consistent with prior studies demonstrating that retinoic acid promotes differentiation of alveolar epithelia and increases phosphatidylcholine synthesis (35, 36, 59). Retinoic acid induction of CCT protein and transcripts suggests that effects of this agent on phosphatidylcholine synthesis might be secondary to enhanced CCT gene transcription (35, 36). Retinoic acid regulation of other promoters is well described and appears to be mediated by transactivation of genes by retinoic acid receptor (RAR)-retinoid X receptor (RXR) heterodimers (6062). Database search of the CCT sequence reveals that RARRXR consensus binding elements are not present in the CCT promoter (28). However, it has recently been shown that retinoic acid also activates genes via a consensus -activated sequence (GAS) element which is present within the proximal 5' flanking region (-100/+71) of the CCT gene (63, 64). Alternatively, it is possible that retinoic acid acts indirectly by regulating other DNA-binding partners that enhance CCT gene transcription. Nevertheless, the results suggest that modulation of CCT promoter activity by retinoic acid might serve as a complementary strategy to increase expression of heterologous proteins in vivo. In this regard, erythropoietin was highly expressed in a retinoic acidregulated manner when the transgene was under control of the CCT promoter. This effect was comparable to the level of induction driven by CMV. These results are notable because in these experiments we used a commercially available mammalian expression vector, pcDNA3.1, that contains the specific CMV enhancer-promoter region, a ß-globin/IgG chimeric intronic enhancer, and an SV40 polyadenylation signal to enhance transgene expression. These cis-acting elements, however, may not have optimally activated the CCT promoter. In fact, when we used the pGL3 luciferase system, which unlike pcDNA3.1 only allows for enhancer-independent promoter activity, CCT promoter activity was greater than CMV. To examine whether these findings for CCT promoter activity are replicated in vivo, in preliminary studies we have generated CCT promoterreporter transgenic mice that harbor 2 kb of the proximal 5' flanking region of the CCT gene that exhibit high-level, sustained transgene expression in murine lungs (unpublished data).
Finally, recent approaches to increase gene expression have incorporated strong viral promoters into newer generation vectors such as the AAV (1, 38). Previous adenoviral vectors were limited because they elicited inflammatory host responses; adenoviral gene products also modulate viral promoters, such as CMV, that are incorporated into these vectors, thereby potentially influencing transgene expression (6567). AAV vectors, however, direct longer duration expression of desired genes with less host immune responses, but they have limited packaging capacity for exogenous DNA (3). These limitations have led to interest in identifying core promoters that are of sufficient strength and yet are small enough to allow for AAV packaging. The CCT promoter is relatively small in size (240 bp) compared with several promoters tested in this study; the SV40 (203 bp) and TK (163 bp) are of comparable size but exhibited much less activity in MLE cells. Indeed, in preliminary studies deletion analysis of the proximal 5' flanking region of murine CCT gene reveals that a smaller 208-bp promoter fragment retains all of the core promoter activity (data not shown). Thus, such studies defining the optimal molecular properties of the CCT sequence that confers regulatable expression of desired genes in vivo within the context of viral packaging might prove invaluable in gene therapy.
 |
Acknowledgments
|
|---|
This study was supported by a Merit Review Award from the Office of Research & Development, Department of Veteran's Affairs, the Cystic Fibrosis Foundation (ENGELH98S0), and NIH R01 Grants HL55584, HL68135, and HL71040 (to R.K.M.). The authors also thank Jennifer Nguyen for technical assistance and Dr. Christie Thomas for critical review of the manuscript.
Received in original form January 17, 2003
Received in final form June 13, 2003
 |
References
|
|---|
- Wang, D., H. Fischer, L. Zhang, P. Fan, R. X. Ding, and J. Dong. 1999. Efficient CFTR expression from AAV vectors packaged with promoters: the second generation. Gene Ther. 6:667675.[CrossRef][Medline]
- Xu, L., T. Daly, C. Gao, T. R. Flotte, S. Song, B. J. Byrne, M. S. Sands, and K. Parker Ponder. 2001. CMV-beta-actin promoter directs higher expression from an adeno-associated viral vector in the liver than the cytomegalovirus or elongation factor 1 alpha promoter and results in therapeutic levels of human factor X in mice. Hum. Gene Ther. 12:563573.[CrossRef][Medline]
- Dong, J. Y., P. D. Fan, and R. A. Frizzell. 1996. Quantitative analysis of the packaging capacity of recombinant adeno-associated virus. Hum. Gene Ther. 7:21012112.[Medline]
- Flotte, T. R. 2000. Size does matter: overcoming the adeno-associated virus packaging limit. Respir. Res. 1:1618.[CrossRef][Medline]
- Armentano, D., M. P. Smith, C. C. Sookdeo, J. Zabner, M. A. Perricone, J. A. St George, S. C. Wadsworth, and R. J. Gregory. 1999. E4ORF3 requirement for achieving long-term transgene expression from the cytomegalovirus promoter in adenovirus vectors. J. Virol. 73:70317034.[Abstract/Free Full Text]
- Gill, D. R., S. E. Smyth, C. A. Goddard, I. A. Pringle, C. F. Higgins, W. H. Colledge, and S. C. Hyde. 2001. Increased persistence of lung gene expression using plasmids containing the ubiquitin C or elongation factor 1alpha promoter. Gene Ther. 8:15391546.[CrossRef][Medline]
- Jiang, C., S. P. O'Connor, D. Armentano, P. B. Berthelette, S. C. Schiavi, D. M. Jefferson, A. E. Smith, S. C. Wadsworth, and S. H. Cheng. 1996. Ability of adenovirus vectors containing different CFTR transcriptional cassettes to correct ion transport defects in CF cells. Am. J. Physiol. 271:L527L537.
- Johnson, L. G., R. J. Pickles, S. E. Boyles, J. C. Morris, H. Ye, Z. Zhou, J. C. Olsen, and R. C. Boucher. 1996. In vitro assessment of variables affecting the efficiency and efficacy of adenovirus-mediated gene transfer to cystic fibrosis airway epithelia. Hum. Gene Ther. 7:5159.[Medline]
- Zabner, J., S. C. Wadsworth, A. E. Smith, and M. J. Welsh. 1996. Adenovirus-mediated generation of cAMP-stimulated Cl- transport in cystic fibrosis airway epithelia in vitro: effect of promoter and administration method. Gene Ther. 3:458465.[Medline]
- Suzuki, M., R. N. Singh, and R. G. Crystal. 1996. Regulatable promoters for use in gene therapy applications: modification of the 5'-flanking region of the CFTR gene with multiple cAMP response elements to support basal, low-level gene expression that can be upregulated by exogenous agents that raise intracellular levels of cAMP. Hum. Gene Ther. 7:18831893.[Medline]
- Yew, N. S., J. Marshall, M. Przybylska, D. M. Wysokenski, R. J. Ziegler, P. W. Rafter, C. Li, D. Armentano, and S. H. Cheng. 1999. Increased duration of transgene expression in the lung with plasmid DNA vectors harboring adenovirus E4 open reading frame 3. Hum. Gene Ther. 10:18331843.[CrossRef][Medline]
- Kim, S. Y., J. H. Lee, H. S. Shin, H. J. Kang, and Y. S. Kim. 2002. The human elongation factor 1 alpha (EF-1 alpha) first intron highly enhances expression of foreign genes from the murine cytomegalovirus promoter. J. Biotechnol. 93:183187.[CrossRef][Medline]
- Kent, C. 1990. Regulation of phosphatidylcholine biosynthesis. Prog. Lipid Res. 29:87105.[CrossRef][Medline]
- Feldman, D. A., J. W. Dietrich, and P. A. Weinhold. 1980. Comparison of the phospholipid requirements and molecular form of CTP: phosphocholine cytidylyltransferase from rat lung, kidney, brain and liver. Biochim. Biophys. Acta 620:603611.[Medline]
- Weinhold, P. A., M. E. Rounsifer, L. Charles, and D. A. Feldman. 1989. Characterization of cytosolic forms of CTP: choline-phosphate cytidylyltransferase in lung, isolated alveolar type II cells, A549 cell and Hep G2 cells. Biochim. Biophys. Acta 1006:299310.[Medline]
- Miller, B. E., and K. G. Hoo. 1989. Regulation of phosphatidylcholine biosynthesis in activated alveolar type II cells. Am. J. Respir. Cell Mol. Biol. 1:127136.
- Spragg, R. G., and J. Li. 2000. Effect of phosphocholine cytidylyltransferase overexpression on phosphatidylcholine synthesis in alveolar type II cells and related cell lines. Am. J. Respir. Cell Mol. Biol. 22:116124.[Abstract/Free Full Text]
- Mallampalli, R. K., S. N. Mathur, L. J. Warnock, R. G. Salome, G. W. Hunninghake, and F. J. Field. 1996. Betamethasone modulation of sphingomyelin hydrolysis up-regulates CTP:cholinephosphate cytidylyltransferase activity in adult rat lung. Biochem. J. 318:333341.
- Mallampalli, R. K., M. E. Walter, M. W. Peterson, and G. W. Hunninghake. 1994. Betamethasone activation of CTP:cholinephosphate cytidylyltransferase in vivo is lipid dependent. Am. J. Respir. Cell Mol. Biol. 10:4857.[Abstract]
- Cui, Z., M. Houweling, M. H. Chen, M. Record, H. Chap, D. E. Vance, and F. Terce. 1996. A genetic defect in phosphatidylcholine biosynthesis triggers apoptosis in Chinese hamster ovary cells. J. Biol. Chem. 271:1466814671.[Abstract/Free Full Text]
- Mallampalli, R. K., A. J. Ryan, R. G. Salome, and S. Jackowski. 2000. Tumor necrosis factor-
inhibits expression of CTP:Phosphocholine cytidylyltransferase. J. Biol. Chem. 275:96999708.[Abstract/Free Full Text]
- Lykidis, A., K. G. Murti, and S. Jackowski. 1998. Cloning and characterization of a second human CTP:phosphocholine cytidylyltransferase. J. Biol. Chem. 273:1402214029. [Published erratum appears in J. Biol. Chem. 273(30):19357.][Abstract/Free Full Text]
- Weinhold, P. A., M. E. Rounsifer, and D. A. Feldman. 1986. The purification and characterization of CTP:phosphorylcholine cytidylyltransferase from rat liver. J. Biol. Chem. 261:51045110.[Abstract/Free Full Text]
- Kalmar, G. B., R. J. Kay, A. Lachance, R. Aebersold, and R. B. Cornell. 1990. Cloning and expression of rat liver CTP: phosphocholine cytidylyltransferase: an amphipathic protein that controls phosphatidylcholine synthesis. Proc. Natl. Acad. Sci. USA 87:60296033.[Abstract/Free Full Text]
- Kalmar, G. B., R. J. Kay, A. C. LaChance, and R. B. Cornell. 1994. Primary structure and expression of a human CTP:phosphocholine cytidylyltransferase. Biochim. Biophys. Acta 1219:328334.[Medline]
- Rutherford, M. S., C. O. Rock, N. A. Jenkins, D. J. Gilbert, T. G. Tessner, N. G. Copeland, and S. Jackowski. 1993. The gene for murine CTP:phosphocholine cytidylyltransferase (Ctpct) is located on mouse chromosome 16. Genomics 18:698701.[CrossRef][Medline]
- Tang, W., G. A. Keesler, and I. Tabas. 1997. The structure of the gene for murine CTP:phosphocholine cytidylyltransferase, Ctpct. Relationship of exon structure to functional domains and identification of transcriptional start sites and potential upstream regulatory elements. J. Biol. Chem. 272:1314613151.[Abstract/Free Full Text]
- Bakovic, M., K. Waite, W. Tang, I. Tabas, and D. E. Vance. 1999. Transcriptional activation of the murine CTP:phosphocholine cytidylyltransferase gene (Ctpct): combined action of upstream stimulatory and inhibitory cis-acting elements. Biochim. Biophys. Acta 1438:147165.[Medline]
- Bakovic, M., K. A. Waite, and D. E. Vance. 2000. Functional significance of Sp1, Sp2, and Sp3 transcription factors in regulation of the murine CTP: phosphocholine cytidylyltransferase alpha promoter. J. Lipid Res. 41:583594.[Abstract/Free Full Text]
- Mallampalli, R. K., A. J. Ryan, J. L. Carroll, T. F. Osborne, and C. P. Thomas. 2002. Lipid deprivation increases surfactant phosphatidylcholine synthesis via a sterol-sensitive regulatory element within the CTP:phosphocholine cytidylyltransferase promoter. Biochem. J. 362:8188.[CrossRef][Medline]
- Nagy, A., C. Moens, E. Ivanyi, J. Pawling, M. Gertsenstein, A. K. Hadjantonakis, M. Pirity, and J. Rossant. 1998. Dissecting the role of N-myc in development using a single targeting vector to generate a series of alleles. Curr. Biol. 8:661664.[CrossRef][Medline]
- Shu, W., H. Yang, L. Zhang, M. M. Lu, and E. E. Morrisey. 2001. Characterization of a new subfamily of winged-helix/forkhead (Fox) genes that are expressed in the lung and act as transcriptional repressors. J. Biol. Chem. 276:2748827497.[Abstract/Free Full Text]
- Carroll, J., D. M. McCoy, S. E. McGowan, R. G. Salome, and R. K. Mallampalli. 2002. Pulmonary specific expression of tumor necrosis factor-
alters surfactant lipid metabolism. Am. J. Physiol. 282:L735L742.
- Angulo, A., C. Suto, R. A. Heyman, and P. Ghazal. 1996. Characterization of the sequences of the human cytomegalovirus enhancer that mediate differential regulation by natural and synthetic retinoids. Mol. Endocrinol. 10:781793.[Abstract/Free Full Text]
- Fraslon, C., and J. R. Bourbon. 1992. Comparison of effects of epidermal and insulin-like growth factors, gastrin releasing peptide and retinoic acid on fetal lung cell growth and maturation in vitro. Biochim. Biophys. Acta 1123:6575.[Medline]
- Whitlon, D. S., K. E. Anderson, and G. C. Mueller. 1985. Analysis of the effects of fatty acids and related compounds on the synthesis of phosphatidylcholine in lymphocytes. Biochim. Biophys. Acta 835:369377.[Medline]
- Yew, N. S., D. M. Wysokenski, K. X. Wang, R. J. Ziegler, J. Marshall, D. McNeilly, M. Cherry, W. Osburn, and S. H. Cheng. 1997. Optimization of plasmid vectors for high-level expression in lung epithelial cells. Hum. Gene Ther. 8:575584.[Medline]
- Flotte, T. R., and B. L. Laube. 2001. Gene therapy in cystic fibrosis. Chest. 120:124S131S.[Abstract/Free Full Text]
- Boshart, M., F. Weber, G. Jahn, K. Dorsch-Hasler, B. Fleckenstein, and W. Schaffner. 1985. A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 41:521530.[CrossRef][Medline]
- Kim, D. W., T. Uetsuki, Y. Kaziro, N. Yamaguchi, and S. Sugano. 1990. Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system. Gene 91:217223.[CrossRef][Medline]
- Brinster, R. L., J. M. Allen, R. R. Behringer, R. E. Gelinas, and R. D. Palmiter. 1988. Introns increase transcriptional efficiency in transgenic mice. Proc. Natl. Acad. Sci. USA 85:836840.[Abstract/Free Full Text]
- Arcot, S. S., E. K. Flemington, and P. L. Deininger. 1989. The human thymidine kinase gene promoter. Deletion analysis and specific protein binding. J. Biol. Chem. 264:23432349.[Abstract/Free Full Text]
- Braun, H., and G. Suske. 1998. Combinatorial action of HNF3 and Sp family transcription factors in the activation of the rabbit uteroglobin/CC10 promoter. J. Biol. Chem. 273:98219828.[Abstract/Free Full Text]
- Ramezani, A., T. S. Hawley, and R. G. Hawley. 2000. Lentiviral vectors for enhanced gene expression in human hematopoietic cells. Mol. Ther. 2:458469.[CrossRef][Medline]
- Tong, X., D. G. Engehausen, C. T. Freund, I. Agoulnik, M. K. Oehler, T. E. Kim, A. Hasenburg, Z. Guo, C. F. Contant, S. L. Woo, and D. G. Kieback. 1999. Comparison of long-term survival of cytomegalovirus promotre versus Rous Sarcoma virus promoter-driven thymidine kinase gene therapy in nude mice bearing human ovarian cancer. Hybridoma 18:9397.[Medline]
- Freund, C. T., X. W. Tong, A. Block, C. F. Contant, D. G. Kieback, D. R. Rowley, and S. P. Lerner. 2000. Adenovirus-mediated suicide gene therapy for bladder cancer: comparison of the cytomegalovirus- and Rous sarcoma virus-promoter. Anticancer Res. 20:28112816.[Medline]
- Sugita, M., M. Geraci, B. Gao, R. L. Powell, F. R. Hirsch, G. Johnson, R. Lapadat, E. Gabrielson, R. Bremnes, P. A. Bunn, and W. A. Franklin. 2002. Combined use of oligonucleotide and tissue microarrays identifies cancer/testis antigens as biomarkers in lung carcinoma. Cancer Res. 62:39713979.[Abstract/Free Full Text]
- Casola, A., N. Burger, T. Liu, M. Jamaluddin, A. R. Brasier, and R. P. Garofalo. 2001. Oxidant tone regulates RANTES gene expression in airway epithelial cells infected with respiratory syncytial virus. Role in viral-induced interferon regulatory factor activation. J. Biol. Chem. 276:1971519722.[Abstract/Free Full Text]
- Konno, S., K. A. Grindle, W. M. Lee, M. K. Schroth, A. G. Mosser, R. A. Brockman-Schneider, W. W. Busse, and J. E. Gern. 2002. Interferon-
enhances rhinovirus-induced RANTES secretion by airway epithelial cells. Am. J. Respir. Cell Mol. Biol. 26:594601.[Abstract/Free Full Text]
- Fischer, B. M., and J. A. Voynow. 2002. Neutrophil elastase induces MUC5AC gene expression in airway epithelium via a pathway involving reactive oxygen species. Am. J. Respir. Cell Mol. Biol. 26:447452.[Abstract/Free Full Text]
- Rose, M. C., F. M. Piazza, Y. A. Chen, M. Z. Alimam, M. V. Bautista, N. Letwin, and B. Rajput. 2000. Model systems for investigating mucin gene expression in airway diseases. J. Aerosol Med. 13:245261.[Medline]
- Mason, R. J., and M. C. Williams. 1980. Phospholipid composition and ultrastructure of A549 cells and other cultured pulmonary epithelial cells of presumed type II cell origin. Biochim. Biophys. Acta 617:3650.[Medline]
- Kast, H. R., C. M. Nguyen, A. M. Anisfeld, J. Ericsson, and P. A. Edwards. 2001. CTP:phosphocholine cytidylyltransferase, a new sterol- and SREBP-responsive gene. J. Lipid Res. 42:12661272.[Abstract/Free Full Text]
- Adams, C. C., M. N. Alam, B. C. Starcher, and V. Boggaram. 2001. Cell-specific and developmental regulation of rabbit surfactant protein B promoter in transgenic mice. Am. J. Physiol. Lung Cell. Mol. Physiol. 280:L724L731.[Abstract/Free Full Text]
- Alcorn, J. L., R. E. Hammer, K. R. Graves, M. E. Smith, S. D. Maika, L. F. Michael, E. Gao, Y. Wang, and C. R. Mendelson. 1999. Analysis of genomic regions involved in regulation of the rabbit surfactant protein A gene in transgenic mice. Am. J. Physiol. 277:L349L361.
- Glasser, S. W., M. S. Burhans, S. K. Eszterhas, M. D. Bruno, and T. R. Korfhagen. 2000. Human SP-C gene sequences that confer lung epithelium-specific expression in transgenic mice. Am. J. Physiol. Lung Cell. Mol. Physiol. 278:L933L945.[Abstract/Free Full Text]
- Romano, G., K. Reiss, X. Tu, F. Peruzzi, B. Belletti, J. Y. Wang, T. Zanocco-Marani, and R. Baserga. 2001. Efficient in vitro and in vivo gene regulation of a retrovirally delivered pro-apoptotic factor under the control of the Drosophila HSP70 promoter. Gene Ther. 8:600607.[CrossRef][Medline]
- Park, S. M., M. Ohkuma, Y. Masuda, A. Ohta, and M. Takagi. 1997. Galactose-inducible expression systems in Candida maltosa using promoters of newly-isolated GAL1 and GAL10 genes. Yeast 13:2129.[CrossRef][Medline]
- Chailley-Heu, B., N. Chelly, M. Lelievre-Pegorier, A. M. Barlier-Mur, C. Merlet-Benichou, and J. R. Bourbon. 1999. Mild vitamin A deficiency delays fetal lung maturation in the rat. Am. J. Respir. Cell Mol. Biol. 21:8996.[Abstract/Free Full Text]
- Yanase, T., Y. M. Mu, Y. Nishi, K. Goto, M. Nomura, T. Okabe, R. Takayanagi, and H. Nawata. 2001. Regulation of aromatase by nuclear receptors. J. Steroid Biochem. Mol. Biol. 79:187192.[CrossRef][Medline]
- Li, A., X. Zhu, and C. M. Craft. 2002. Retinoic acid upregulates cone arrestin expression in retinoblastoma cells through a Cis element in the distal promoter region. Invest. Ophthalmol. Vis. Sci. 43:13751383.[Abstract/Free Full Text]
- Li, D., T. L. Zimmerman, S. Thevananther, H. Y. Lee, J. M. Kurie, and S. J. Karpen. 2002. Interleukin-1 beta-mediated suppression of RXR:RAR transactivation of the Ntcp promoter is JNK-dependent. J. Biol. Chem. 277:3141631422.[Abstract/Free Full Text]
- Pelicano, L., F. Li, C. Schindler, and M. K. Chelbi-Alix. 1997. Retinoic acid enhances the expression of interferon-induced proteins: evidence for multiple mechanisms of action. Oncogene 15:23492359.[CrossRef][Medline]
- Bauvois, B., M. Djavaheri-Mergny, D. Rouillard, J. Dumont, and J. Wietzerbin. 2000. Regulation of CD26/DPPIV gene expression by interferons and retinoic acid in tumor B cells. Oncogene 19:265272.[CrossRef][Medline]
- Sanchez, T. A., I. Habib, J. Leland Booth, S. M. Evetts, and J. P. Metcalf. 2000. Zinc finger and carboxyl regions of adenovirus E1A 13S CR3 are important for transactivation of the cytomegalovirus major immediate early promoter by adenovirus. Am. J. Respir. Cell Mol. Biol. 23:670677.[Abstract/Free Full Text]
- Grave, L., D. Dreyer, A. Dieterle, P. Leroy, A. I. Michou, C. Doderer, A. Pavirani, M. Lusky, and M. Mehtali. 2000. Differential influence of the E4 adenoviral genes on viral and cellular promoters. J. Gene Med. 2:433443.[CrossRef][Medline]
- Lusky, M., L. Grave, A. Dieterle, D. Dreyer, M. Christ, C. Ziller, P. Furstenberger, J. Kintz, D. A. Hadji, A. Pavirani, and M. Mehtali. 1999. Regulation of adenovirus-mediated transgene expression by the viral E4 gene products: requirement for E4 ORF3. J. Virol. 73:83088319.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
Y. Tian, R. Zhou, J. E. Rehg, and S. Jackowski
Role of Phosphocholine Cytidylyltransferase {alpha} in Lung Development
Mol. Cell. Biol.,
February 1, 2007;
27(3):
975 - 982.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. M. McCoy, K. Fisher, J. Robichaud, A. J. Ryan, and R. K. Mallampalli
Transcriptional Regulation of Lung Cytidylyltransferase in Developing Transgenic Mice
Am. J. Respir. Cell Mol. Biol.,
September 1, 2006;
35(3):
394 - 402.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Jackowski and P. Fagone
CTP:Phosphocholine Cytidylyltransferase: Paving the Way from Gene to Membrane
J. Biol. Chem.,
January 14, 2005;
280(2):
853 - 856.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zhou, Y. You, A. J. Ryan, and R. K. Mallampalli
Upregulation of surfactant synthesis triggers ABCA1-mediated basolateral phospholipid efflux
J. Lipid Res.,
September 1, 2004;
45(9):
1758 - 1767.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2004 American Thoracic Society.
|