Published ahead of print on July 18, 2003, doi:10.1165/rcmb.2003-0126OC
© 2004 American Thoracic Society DOI: 10.1165/rcmb.2003-0126OC Nucleocytoplasmic Shuttling of lgl2 Is Developmentally Regulated in Fetal LungMcGill University-Montreal Children's Hospital Research Institute, Department of Anatomy and Cell Biology, Department of Human Genetics, and Department of Pediatrics, McGill University, Montreal, Quebec, Canada; Lung Biology Research, Research Institute, Hospital for Sick Children, Toronto; and Departments of Pediatrics and Physiology, University of Toronto, Toronto, Ontario, Canada Address correspondence to: Feige Kaplan, McGill University-Montreal Children's Hospital Research Institute, 4060 St Catherine St West, Rm 236, Montreal, PQ, H3Z 2Z3 Canada. E-mail: feige.kaplan{at}mcgill.ca
To investigate molecular mechanisms of lung organogenesis, we searched for glucocorticoid-inducible genes in developing lung. We cloned LGL2, a developmentally and hormonally regulated gene in fetal lung (Zhang, C., N. B. Sweezey, S. Gagnon, B. Muskat, D. Koehler, M. Post, and F. Kaplan. 2000. A novel karyopherin-ß homolog is developmentally and hormonally regulated in fetal lung. Am. J. Respir. Cell Mol. Biol. 22:451459). A comparison of lgl2 protein to sequences in the genome database suggested that lgl2 is a nuclear transport receptor. We report on the functional characterization of lgl2 as an importin ß protein and on the developmental regulation of its nucleocytoplasmic shuttling in fetal lung. We investigated the subcellular localization and Ran-binding properties of lgl2 and its N- and C-terminal regions. We used fluorescence recovery after photobleaching and fluorescence loss in photobleaching to study nucleocytoplasmic shuttling of lgl2. We showed that N-terminal lgl2 supports shuttling at a reduced rate. We showed that the nucleocytoplasmic distribution of lgl2 favors the nucleus in fetal lung and that lgl2 enters the nucleus much more rapidly at fetal Day 18 than at Day 21. Total nuclear recovery of lgl2 was dramatically different at the two time points. Early in development, nuclear import of transcription factors in response to hormones and growth agonists regulates prominent signal transduction pathways that govern lung organogenesis. We speculate that lgl2 may be one important modulator of this process.
Abbreviations: enhanced yellow fluorescence protein, EYFP fluorescence loss in photobleaching, FLIP fluorescence recovery after photobleaching, FRAP nuclear pore complex, NPC polymerase chain reaction, PCR
Morphogenesis and differentiation of fetal organs is dependent upon precise signaling both within and between developing mesenchymal and epithelial cells. This signaling regulates cell proliferation, fate, migration, and differentiation (1). During development of the respiratory tract, embryonic cells organize along an axis (pattern formation) and differentiate such that the proximal structure (trachea) differs greatly from the more distal alveoli (2). As development proceeds, buds emerge laterally from the main bronchi, elongate, and branch. Temporal and spatial regulation of gene expression is essential to the polarization and outgrowth of distal buds in the rapidly branching lung epithelium. Although signal transduction in the developing lung is known to influence both branching and differentiation of the lung epithelium, the molecular mechanisms that regulate these events remain incompletely defined. Early in development, nuclear import of transcription factors that translocate from the cytoplasm to the nucleus in response to hormones and growth agonists is critical to prominent signal transduction pathways that govern the branching process. Macromolecular traffic between the cytoplasm and the nucleus is an essential activity in eukaryotic cells (35). Bidirectional nuclear-cytoplasmic transport through nuclear pore complexes (NPCs) is mediated by transport factors that target import substrates by interacting with cognate nuclear-localization sequences. The control of nuclear import of transcription factors represents a level of gene regulation integral to both the developmental processes of growth and differentiation (68). In the mammalian lung, glucocorticoid hastens the maturation of type II epithelial cells. Glucocorticoid effects on lung development are likely to be mediated through regulation of the expression of multiple gene products. To investigate molecular mechanisms of lung organogenesis, we searched for glucocorticoid-inducible genes in the developing lung in a fetal rat model. We cloned the 3.6-kb cDNA, LGL2 (isolated from late gestation lung), encoding a deduced polypeptide (lgl2) of 963 amino acids (9), which was developmentally and hormonally regulated in fetal lung.
An initial comparison of lgl2 (protein) to sequences in the genome database ( Despite recent advances in understanding of the basic mechanisms of nuclear transport, it is still not clear how the nuclear transport machinery functions during multicellular development (17). Recent studies have shown that perturbing nuclear transport impairs organ development in a number of systems (1720). We report here on the functional characterization of lgl2 as an importin ß protein and on the developmental regulation of its nucleocytoplasmic shuttling in primary lung cell culture. The developmental and hormonally modulated pattern of lgl2 expression in the pseudoglandular and canalicular stages of development is coordinate with that of a number of key transcription factors that modulate formation of distal air sacs of the lung during this critical period. We suggest a role for lgl2 in the developmental regulation of nuclear transport of transcription factors essential to normal lung embryogenesis.
Expression Constructs The plasmid pcDNA3.1-LGL2-HA was a gift from G. Lukacs (Hospital for Sick Children, Toronto, ON, Canada). To make the plasmid expressing the full-length lgl2 tagged with the enhanced yellow fluorescence protein (EYFP), we amplified LGL2 cDNA by polymerase chain reaction (PCR) from pGEX-4T-LGL2 plasmid: the 5' primer was GGAATTCAAATGGAGCGGCGGGAG containing an EcoRI site before the ATG starting codon; the 3' primer was CGGGATCCCTGTCAGCTGTGTAGTCTG, which removes the stop codon of LGL2 and contains a BamHI site. The PCR fragments amplified by Pfu Turbo DNA polymerase (#600250; Stratagene, La Jolla, CA) were inserted into the pEYFP-N1 vector (#60061; Clontech, Palo Alto, CA) at EcoRI and BamHI sites. This plasmid was named as pFLGL2-EYFP. For the C-terminus of lgl2 tagged with EYFP, we amplified the 3' end of LGL2 cDNA by PCR from the pGEX-4T-LGL2 plasmid: the 5' primer was GGAATTCATGGGGCTCATTGGCCTC, which contains a start codon ATG before the SmaI site (base 2071 in the LGL2 cDNA). An EcoRI site was added before the ATG; the 3' primer for this construct was the same as the 3' primer used for constructing the full-length lgl2 tagged with EYFP. The PCR fragments were inserted into the pEYFP-N1 vector at EcoRI and BamHI sites. This plasmid is referred to as pCLGL2-EYFP. The plasmid including the N-terminus of lgl2 tagged with EYFP was constructed by digesting the pFLGL2-EYFP plasmid with EcoRI and KpnI to release the EcoRI/KpnI fragment. This fragment was then inserted into the pEYFP-N1 plasmid to form the pNLGL2-EYFP plasmid expressing the N-terminus of lgl2 tagged with EYFP. All constructs were sequenced and no mistake was found.
HeLa Cell Culture and Transfection
Fetal Rat Lung Cell Culture and Transfection
Indirect Immunofluorescence
Preparation of HeLa Cell Lysates
Expression of GST-RanQ69L and GST-Ran in Escherichia coli
GST-Protein Pull-Down
Western Blotting Analysis
Confocal Image Acquisition and Photobleach Experiments Photobleach experiments were performed on the Zeiss 510 using standard Zeiss procedures, which allow bleaching of a user-defined region of interest of arbitrary shape or using user-written macro procedures on the Zeiss 410, which allows bleaching of a square region of interest (24, 25). The experimental procedures for fluorescent recovery after photobleaching (FRAP) were similar to those described previously (24, 25). Briefly, a single image was acquired before the bleach, and then the area to be bleached (usually the nucleus) was exposed to intense laser light for 510 s using the microscope software. The entire nuclear pool could be bleached efficiently in this length of time without dramatic loss of the signal from the cytoplasmic pool of protein. A series of images was then acquired (usually at 5- or 9-s intervals) to visualize recovery in the bleached compartment (nucleus or cytoplasm). Fluorescence recovery in the bleached compartment was quantitated using the image series quantitation functions in the LSM 410 software package and the Metamorph software (Universal Imaging Corp., Downington, PA). Background values from outside the cell were subtracted and low laser illumination intensities were used for time-lapse imaging to minimize photobleaching during time series acquisition. Half times for recovery were determined as described by Puertollano and coworkers (26). Fluorescence loss in photobleaching (FLIP) experiments were similar to FRAP experiments except that the bleach was repeated after acquiring each image (24). A minimum of five cells was analyzed for each determination.
CDART: Conserved Domain Architecture Retrieval Tool
lgl2 Localizes in Both the Nucleus and the Cytoplasm The subcellular localization of lgl2 was determined by immunofluorescence analysis after transient expression of HA-tagged lgl2 (pFLGL2-HA) in HeLa cells. After 24 h expression, cells were fixed in formaldehyde and labeled with either monoclonal or polyclonal anti-HA antibodies (Figure 1). lgl2 was detected diffusely in both the nucleus and the cytoplasm but not in the nucleolus. We also localized lgl2 by confocal fluorescence microscopy after expression of EYFP-tagged lgl2 (pFLGL2-EYFP) in living HeLa cells. Again, lgl2-EYFP was detected in both the nucleus and the cytoplasm but not in the nucleolus (see also Figure 7A below), confirming our observation by immunofluorescence.
The N-Terminal Region of lgl2 Contains the Nuclear Localization Signal To further delineate the nuclear localization signal of lgl2, we constructed EYFP-tagged plasmids containing either the full-length lgl2 (pFLGL2-EYFP), the N-terminus (pNLGL2-EYFP a.a. 1488, 75 kD), or the C-terminus of lgl2 (pCLGL2-EYFP, a.a. 489963, 75 kD) driven by the CMV promoter (Figure 2A). All three proteins were expressed at high levels following transfection into HeLa cells (Figure 2B). Under fluorescence microscopy, we observed the full-length and N-terminal lgl2-EYFP in both the nuclear and cytoplasmic compartments of the cell (Figures 3A and 3B). A minimum of five cells was analyzed for each determination. Despite the high efficiency of protein expression for both the full-length and N-terminal proteins (Figure 2), the distribution of lgl2 appeared to be different, with a greater concentration in the nuclear compartment when the full-length protein was expressed (Figure 3). By contrast, expression of the C-terminal lgl2-EYFP fragment appeared to be restricted to the cytoplasmic compartment (Figure 3C). These findings suggest that the N-terminal lgl2 fragment contains sufficient information to support entry of lgl2 into the nucleus but may not be efficient for maximal nuclear import.
lgl2 Contains a Functional RanGTP-Binding Domain A common feature of nuclear transport receptors belonging to the importin ß family is their ability to specifically interact with the GTP-bound form of the small GTPase Ran. Analysis of lgl2 in CDART (http://www.ncbi.nlm.nih.gov/Structure/lexington/html/overview.html), which analyzes domain structure of protein sequences, identified the N-terminal Ran-binding domain common to lgl2 and 137 importin ß and 15 importin (CAS) transport proteins in Eukaryota as well as in the Drosophila Ran BP11 gene product (Figure 4A).
We used protein pull-down experiments on immobilized Ran to investigate the interaction of lgl2 with RanGTP. We immobilized RanQ69L, which is a GTPase-deficient mutant of Ran that stays in its GTP-bound form even in the presence of the RanGAP present in the HeLa cell extract. Immobilized wild-type Ran in its GDP-bound form served as a negative control. Equal amounts of a 50% slurry of Sepharose 4B beads were saturated with recombinant wild-type Ran or RanQ69L tagged with GST. pFLGL2-HA, pNLGL2-EYFP, and pCLGL2-EYFP were individually expressed in HeLa cells. We incubated HeLa lysates with immobilized RanGTP and RanGDP. Western blot analysis showed that RanGTP interacted strongly with both full-length lgl2 and its N-terminal fragment (Figure 4B). By contrast, only a weak signal was observed for both of these peptides on a Western blot when lysates were incubated in the presence of immobilized RanGDP. No such interaction was observed when the C-terminal lgl2 fragment was incubated with immobilized RanGTP or RanGDP (Figure 4B).
lgl2 Is a Shuttling Protein and the N-Terminal Region Contains the Shuttling Signal
lgl2 Is Imported into the Nucleus More Rapidly than its N-Terminal Counterpart The plots in Figure 6A illustrate the quantitation of recovery of fluorescence into the nucleus after a series of FRAP experiments identical to those illustrated in Figure 5. Representative recovery curves for full-length and N-terminal lgl2 are shown. The curves were normalized for comparison. Note that the full-length protein enters the nucleus very rapidly, essentially reaching a plateau at 90 s after photobleaching. By contrast, the N-terminal fragment enters the nucleus slowly and the rate of nuclear import has not yet plateaued at 5 min after photobleaching.
The half times for recovery of fluorescence for full-length (20 ± 3 s) and N-terminal (85 ± 13 s) lgl2 were computed empirically (Figure 6B). The data represent an average of five sequences. The data show that N-terminal lgl2 is imported into the nucleus at a considerably slower rate than the full-length sequence. Moreover, unlike the case of the full-length protein, N-terminal lgl2 appeared to be partly localized at the nuclear periphery, suggesting that it may be sequestered with the nuclear envelope (Figure 7).
Subcellular Localization of lgl2 in Primary Fetal Lung Cell Culture
Nucleocytoplasmic Shuttling of lgl2 Is Developmentally Regulated in Fetal Lung We next applied the techniques of FRAP and FLIP to investigate the nucleocytoplasmic shuttling of lgl2 at fetal Days 18 and 21 in fetal lung cell culture. We selectively photobleached Day 18 and Day 21 primary lung fibroblast cell nuclei to visualize the trafficking of EYFP-tagged lgl2 into the nucleus. As shown in Figures 9A and 9B, recovery of the nuclear pool of lgl2 can be detected at both time points. However, a very clear distinction is observed in the rate of recovery of nuclear lgl2 when Day 18 cells are compared with Day 21 cells. Nuclear recovery of lgl2 fluorescence was rapid and clearly detectible at 0.5 min in Day 18 cells (Figure 9A). By contrast, analysis of 6/9 cells at time points up to 1.5 min did not reveal significant nuclear recovery of lgl2 at Day 21 (Figure 9B). Figure 10A illustrates representative curves for recovery of nuclear fluorescence after photobleaching at fetal Days 18 and 21, respectively. Nuclear recovery of lgl2 at Day 18 was very rapid with nuclear import reaching a plateau at 54 s. At Day 21, no apparent plateau was reached at 5 min after photobleaching, and recovery of nuclear fluorescence at each time point after 1 min was at least 30% less than that for the equivalent time point in Day 18 cells. The average half-time for recovery of fluorescence at fetal Day 18 was 19 s (n = 6), and the percentage of recovery (n = 6) at 6 min after photobleaching was 63 ± 8% (Figures 10A and 10B). The recovery of nuclear fluorescence (n = 6) for Day 21 cells averaged only 38 ± 10% at 6 min (Figure 10B). Moreover, in FRAP studies of fetal Day 21 cells (6/9), lgl2 appeared to accumulate at the nuclear periphery forming a ring adjacent to the nucleus (see arrows in Figure 9B). No such ring was observed during nuclear recovery of lgl2 after photobleaching in Day 18 cells.
We also performed FLIP studies showing the exchange between the entire intranuclear and cytoplasmic pools of lgl2 in fetal lung cells (Figures 9C and 9D) at Days 18 and 21. As illustrated in the figure, nuclear entry of lgl2 is much faster in Day 18 cells. The different nuclear import rates of lgl2 in Day 18 and Day 21 rat fetal lung cells are likely to reflect important regulatory functions of lgl2 in fetal lung development.
We sought to identify glucocorticoid-inducible genes in developing lung. We cloned a novel gene, LGL2, that is enriched in lung epithelium and expressed in fetal brain, heart, intestine, and kidney (9). LGL2 was developmentally regulated, induced by glucocorticoid, and conserved across species. In the present study, we initially explored the functional properties of lgl2 in HeLa cells. We investigated the subcellular localization of lgl2 in cells and confirmed that lgl2 contains a functional Ran-binding domain. We used FRAP and FLIP techniques to demonstrate nucleocytoplasmic shuttling of lgl2 in HeLa cells. We showed that the N-terminal (aa1488) but not the C-terminal (aa489963) region of lgl2 is sufficient to support nucleocytoplasmic shuttling. We showed that nuclear entry of N-terminal lgl2 occurs at a considerably reduced rate compared with that of full-length lgl2. Common motifs and significant protein homology constitute evidence suggesting functional similarities between proteins. Comparison with sequences in the genome database showed that lgl2 had significant homologies to nuclear transport receptor molecules in multiple species (9). Members of the importin ß family share limited amino acid sequence identity, considerable amino acid sequence similarity, and are most conserved at their amino termini, which contain the RanGTP-binding domain. They have similar molecular weights, isoelectric points, and contain multiple HEAT repeats (28). By all these criteria, lgl2 was identified as a candidate importin ß nuclear transport receptor. We applied a series of tests to confirm that the biochemical properties of lgl2 indeed supported this classification (12). The defining features of importin ßrelated nuclear transport receptors include the ability (i) to localize to cytoplasmic and nuclear compartments of the cell, (ii) to specifically interact with the small GTPase Ran, and (iii) to shuttle cargo between the cytoplasm and the nucleus. We explored all of these properties. We determined the intracellular localization of a HA-tagged lgl2 by indirect immunofluorescence and by confocal fluorescent microscopy of EYFP-tagged lgl2 in living cells. We showed that lgl2 is localized to both nuclear and cytoplasmic compartments of the cell. Next we wished to verify that lgl2 binds RanGTP. We used protein pull-down assays to demonstrate a specific interaction between lgl2 and RanGTP. Only a weak signal was observed on a Western blot when lgl2 was reacted with RanGDP. Finally, we needed to establish that lgl2 is indeed a nucleocytoplasmic "transport" carrier protein. For these studies we applied the novel approach of FRAP and FLIP to directly demonstrate nucleocytoplasmic shuttling of lgl2 in living cells. To our knowledge, we are the first to have applied this technology to evaluate shuttling of nuclear transport receptors. To determine if lgl2 enters the nucleus, we selectively photobleached a region of the nucleus of HeLa cells expressing an EYFP-tagged lgl2 and watched for recovery of fluorescence after photobleaching. The prebleach nucleus-to-cytoplasm fluorescence ratio 2.58 ± 0.65 (n = 3) rapidly recovered with a half-time of 20 ± 3 s. Next, to assess lgl2 exit from the nucleus, we repeatedly photobleached a region of the cytoplasm and showed that all cellular fluorescence was lost within a very few minutes. These findings confirmed continuous complete exchange of nuclear and cytoplasmic pools of lgl2. Having established that lgl2 indeed functions as a nuclear transport receptor, we then sought to investigate its potential regulatory role in fetal lung development. We used transfection into primary lung cell culture to demonstrate nuclear enrichment of lgl2 at fetal Days 18 and 21, and showed that nucleocytoplasmic shuttling of lgl2 is developmentally regulated. Dramatic differences were observed in the shuttling properties of lgl2 at Days 18 and 21. Nuclear recovery of lgl2 fluorescence at Day 18 was very rapid and 63 ± 8% (n = 6) recovery was observed at 5 min after photobleaching. In contrast, recovery of nuclear lgl2 fluorescence at Day 21 was very slow with maximal recovery at 6 min of 38 ± 10% (n = 6). These findings support the hypothesis that lgl2 may regulate developmental signaling pathways via modulation of nuclear import of essential transcription factors. Importin ß is a key component of nuclear import in eukaryotic cells. Yet the mechanism of facilitated translocation of importin ß proteins through the NPC remains poorly understood. Nuclear transport receptors of the importin ß superfamily are believed to drive translocation of cargo through the NPC by their ability to interact directly with a subset of NPC proteins (termed nucleoporins or "nups") that contain domains with repeating Phe-Gly (FG) sequence motifs. This is reflected by the localization of nuclear transport receptors in living cells, where they may be found associated with the nuclear envelope. Although the actual mechanism of translocation through NPCs remains controversial, binding of carrier molecules to nups is considered to be an essential step (29). FG-nups may function to concentrate carriercargo complexes at the NPC entrance, to facilitate a sequence of docking and undocking interactions as complexes transit through NPCs, or they may form a part of the central NPC channel permeable only to molecules which interact with FG-repeats (29). A more precise molecular dissection of the import reaction of lgl2 will require a better understanding of which regions of the importin ß molecule support facilitated transport into the nucleus. To this end, we investigated the nuclear localization, RanGTP binding, and nucleocytoplasmic shuttling of the EYFP-labeled N-terminal and C-terminal regions of lgl2. We showed that the N-terminal lgl2 fragment (aa 1488, including the IBN NT domain; Figure 4A), but not its C-terminal fragment (aa 489923), localized to both the nuclear and cytoplasmic compartments of the cell. These findings suggested that the first 488 amino acids of lgl2 contain a nuclear shuttling signal sufficient for nuclear import. It is of interest to note that the nucleocytoplasmic distribution of N-terminal lgl2 was quite different from that of the full-length protein (Figures 3A, 3B, and 7). To investigate entry of N-terminal lgl2 into the nucleus, we selectively photobleached a region of the nucleus of HeLa cells expressing an EYFP-tagged N-terminal lgl2 as above and watched for recovery of fluorescence after photobleaching. Whereas full-length lgl2 was heavily concentrated in the nucleus, the N-terminal fragment appeared to be more evenly distributed between the two cellular compartments. The prebleach nucleus-to-cytoplasm fluorescence ratio for the N-terminal fragment was 1.22 ± 0.29 (n = 3) compared with 2.58 ± 0.65 (n = 3) for the full-length protein. Moreover, unlike the case of the full-length protein, N-terminal lgl2 appeared to be partly localized at the nuclear periphery, suggesting that it may be sequestered with the nuclear envelope (Figure 7B). We also examined the shuttling capability of N-terminal lgl2 by FRAP and FLIP. N-terminal lgl2 enters into the nucleus. However, these experiments again revealed a more even nucleocytoplasmic distribution of the N-terminal peptide. In addition, we noted that nuclear entry of N-terminal peptide was considerably slower, with a half-life of 83 ± 13 s.
Kutay and colleagues (30) showed that residues 1364 of importin ß account for RanGTP binding, whereas residues 331876 interact with importin Rout and coworkers (31) proposed a Brownian affinity-gating model for nucleocytoplasmic transport in yeast. In this model, Brownian motion (diffusion) accounts for nuclear translocation, whereas vectoriality is considered to result from the combined contribution of the effects of asymmetric nups and the asymmetric distribution of soluble transport factors. Cargo macromolecules are bound, docked, and trapped at the NPC. Vectorial release is accomplished by RanGTP. In this context, our finding of developmentally regulated sequestration of lgl2 at the nuclear periphery at fetal Day 21 in lung fibroblasts is of interest and may reflect altered "asymmetric" concentrations of cellular factors that determine vectoriality during specific developmental windows. Analysis of mammalian importins such as lgl2 will contribute to elucidation of such added levels of regulation. In higher eukaryotes, other as yet unidentified mechanisms may also be essential to improve the efficiency and regulation of transport. Early models of branching morphogenesis of the lung focused exclusively on the assembly and degradation of the extracellular matrix as major determinants of branching patterns (32, 33). More recent evidence has emphasized the critical role of secreted signaling molecules in regulating mesenchymalepithelial interactions that underlie the branching process. Initiation of lung morphogenesis depends on coordinated transcriptional activation and repression involving a variety of signaling molecules including Sonic hedgehog (Shh), its receptor patched (Ptc), and the transcription factors: hepatocyte nuclear factor (HNF-3ß), GLI, GLI2, GLI3, and Nkx2.1 (34). Subsequent inductive events in the lung require epithelialmesenchymal interaction mediated by specific FGF signaling and are modulated by growth factors (EGF, PDGF, TGF-ß) and ECM components (3234). Our data suggest that lgl2 may have a role in stimulating lung proliferation and/or inhibiting lung differentiation at fetal Day 18 via regulation of nuclear import of positive/negative regulatory factors. Our previous studies showing maximal expression of fetal lung lgl2 in the pseudoglandular and canalicular stages of development (9) are consistent with a role for lgl2 in regulation of cell proliferation. At fetal Day 18, rapid nuclear import of growth stimulatory factors or differentiation inhibitory factors may stimulate fetal lung proliferation and/or suppress differentiation. At fetal Day 21, sequestration of lgl2 in the cytoplasm may result from alternative proteinprotein interactions at the nuclear periphery. Retention of lgl2 in the cytoplasm may suppress proliferative activity via downregulation of growth stimulatory factors. Alternatively, reduction of nuclear entry of lgl2 at Day 21 may act to disinhibit differentiation via downregulation of differentiation inhibitory factors. Identification of lgl2 cargo substrates, ongoing in our laboratory, will be an essential prerequisite to distinguishing between these potential regulatory mechanisms.
Despite recent advances in our understanding of the basic mechanisms of nuclear transport, it is still far from clear how the nuclear transport machinery functions in the context of multicellular organ development (17). Kumar and coworkers (17) recently showed that a dominant-negative mutation in human importin ß that disrupted nuclear protein import and mRNA export in eye imaginal discs led to developmental anomalies in or complete elimination of the Drosophila adult eye. Geles and colleagues (18, 19) showed that depletion of importin Mingot and colleagues (16) identified hUBC9 (a sentrin-conjugating enzyme), RBM8 (Ran-binding motif protein), and MGN (Drosophila mago nashi homolog) as potential import substrates of importin 13. It is of interest to note that MGN plays multiple roles in early Drosophila embryogenesis. The identification of additional lgl2 cargo substrates will be important to clarify its potential role in regulation of developmental signaling. Terminal branching of the fetal lung is an exquisitely modulated process that is likely to be dependent on multiple regulatory mechanisms. We speculate that lgl2 may be one important modulator of this process.
This work was supported by grants from the Canadian Institutes for Health Research to F.K., N.B.S., and J.P. T.T. is the recipient of a Montreal Children's Hospital Research Institute Postdoctoral fellowship. The authors thank Katia Nadeau for a careful review of the manuscript. Received in original form April 3, 2003 Received in final form July 10, 2003
This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||