help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published ahead of print on November 7, 2003, doi:10.1165/rcmb.2003-0325OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-0325OCv1
30/5/720    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hardiman, K. M.
Right arrow Articles by Matalon, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hardiman, K. M.
Right arrow Articles by Matalon, S.
American Journal of Respiratory Cell and Molecular Biology. Vol. 30, pp. 720-728, 2004
© 2004 American Thoracic Society
DOI: 10.1165/rcmb.2003-0325OC

Regulation of Amiloride-Sensitive Na+ Transport by Basal Nitric Oxide

Karin M. Hardiman, Carmel M. McNicholas-Bevensee, James Fortenberry, Carpantato T. Myles, Bela Malik, Douglas C. Eaton and Sadis Matalon

Departments of Physiology and Biophysics, and Department of Anesthesiology, Gregory Fleming James Cystic Fibrosis Research Center, and the Medical Scientists Training Program, University of Alabama at Birmingham, Birmingham, Alabama; and Department of Physiology and Center for Cell and Molecular Signaling, Emory University School of Medicine, Atlanta, Georgia

Address correspondence to: Sadis Matalon, Ph.D., Department of Anesthesiology, University of Alabama at Birmingham, 901 19th Street S, BMR2, Room 224, Birmingham, AL 35205–3703. E-mail: Sadis{at}uab.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We investigated the mechanisms of endogenous nitric oxide (NO) modulation of lung sodium (Na+) transport. C57BL/6 mice injected intraperitoneally with the specific inducible NO synthase (iNOS) inhibitor 1400W (10 mg/kg every 8 h for 72 h) exhibited decreased alveolar nitrite levels and Na+-dependent amiloride-sensitive alveolar fluid clearance as compared with mice injected with vehicle. Similarly, pretreatment of mouse tracheal epithelial cells with 1400W abolished the inhibitory effects of amiloride on their Na+ short circuit currents. On the other hand, mouse tracheal epithelial cells pretreated with 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one, a specific inhibitor of guanylate cyclase, had lower levels of cGMP, but normal values of amiloride-sensitive Na+ currents. Amiloride also inhibited whole-cell Na+ currents across A549 cells treated with vehicle (Ki = 249 nM), but had no effect in A549 cells treated with 1400W. Western blotting studies showed significantly lower levels of {alpha} and {gamma}ENaC in lung tissues and alveolar type II (ATII) cells from iNOS–/– as well as iNOS+/+ mice treated with 1400W, as compared with the corresponding values from vehicle-treated iNOS+/+ mice. Similar values for ratios of {alpha}, ß, and {gamma}enac to gapdh were obtained by real-time polymerase chain reaction for iNOS+/+ mice and iNOS–/– mice. We concluded that NO derived from iNOS under basal conditions is necessary for amiloride-sensitive Na+ transport across lung epithelial cells and modulates the amount of {alpha} and {gamma}ENaC via post-transcriptional, cGMP-independent mechanisms.

Abbreviations: alveolar fluid clearance, AFC • alveolar type II cells, ATII • bronchoalveolar lavage, BAL • bovine serum albumin, BSA • 2,3-diaminonaphthalene, DAN • Dulbecco's modified Eagle's medium, DMEM • dimethyl sulfoxide, DMSO • enhanced chemiluminescence, ECL • horseradish peroxidase, HRP • equivalent short circuit current, Ieq • short circuit current, Isc • inducible nitric oxide synthase, iNOS • mouse tracheal epithelial cells, MTE • sodium, Na+ • nitric oxide, NO • nasal potential difference, NPD • 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one, ODQ • polymerase chain reaction, PCR • prostaglandin E2, PGE2


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Various studies in humans and animals indicate that active sodium (Na+) reabsorption plays an essential role in diminishing alveolar fluid and improving oxygenation in patients with cardiogenic and noncardiogenic edema (1) as well as in animals with oxidant injury (2). Na+ ions enter alveolar type II (ATII) cells through both amiloride-sensitive cation and highly selective ENaC type channels, located in their apical membranes (35), and are extruded across the basolateral membranes by the ouabain-sensitive Na,K-ATPase (6). Active Na+ transport across the alveolar epithelium creates an osmotic gradient that drives fluid from the alveolar to the interstitial space. Inhibition of Na+ transport in vivo increases lung water following exposure to hyperoxia (7). Furthermore, {alpha}ENaC–/– mice are unable to clear fetal fluid and die shortly after birth from respiratory distress (8). These studies clearly demonstrate the importance of vectorial alveolar Na+ transport and the concomitant alveolar fluid clearance in limiting the amount of fluid in both the neonatal and injured adult lung.

Recently, several investigators (911) reported that large amounts of nitric oxide (NO), generated by NO donors, decreased amiloride-sensitive short circuit, whole-cell and single channel currents, across A549 and freshly isolated ATII cells, via both cGMP-dependent and independent mechanisms. Reactive oxygen-nitrogen intermediates, generated by inflammatory cells, also decreased the density of Ca+2-activated cation channels in fetal ATII cells (12). Finally, intratracheal instillation of DETANONOate in rabbits decreased amiloride-sensitive alveolar fluid clearance (AFC) (13). However, the effects of basal levels of NO on the modulation Na+ transport across the alveolar epithelium, as well as on the biophysical properties of amiloride-sensitive channels, have not been elucidated.

Most mammalian cells have the capacity to produce NO from the oxidative deamination of L-arginine by either the Ca+2-sensitive or the Ca+2-insensitive (inducible NO synthase [iNOS]) forms of NO synthases. Various inflammatory stimuli trigger transcription of iNOS leading to generation of high and sustained production of NO, which has been shown to alter transcription, translation, and degradation of various proteins (14). Constitutive iNOS expression has been found in cultured human bronchial epithelial cells as well as in transformed human bronchial cells (BEAS 2B cells) and A549 cells (15). Others have found constitutive iNOS mRNA expression in human epithelial cells in the lower and upper airways but not in macrophages, indicating that the lungs are not being stimulated by an inflammatory insult (14). However, it is unclear whether constitutively expressed iNOS releases NO and, if so, whether it impacts or regulates any physiologic functions.

We have previously reported that iNOS–/– mice have normal levels of Na+-dependent AFC but, in contrast to iNOS+/+ mice, AFC is insensitive to amiloride (16). Therefore, we investigated the effects of NO derived from iNOS under basal conditions on amiloride-sensitive AFC and nasal potential differences in mice in vivo and amiloride-sensitive Na+ transport across confluent tracheal epithelial cells in vitro. We performed these experiments using iNOS–/– mice and wild-type mice treated with 1400W, a specific iNOS inhibitor. Finally, we measured the extent of inhibition by amiloride of whole-cell currents across A549 cells, treated with either 1400W or vehicle. Our results indicate that NO derived from iNOS decreased levels of amiloride-sensitive transport and Na+ equivalent short-circuit currents (Isc) via cGMP-independent mechanisms. Western blotting studies showed significantly lower levels of {alpha} and {gamma}ENaC in lung tissues and ATII cells from iNOS–/–- and 1400W iNOS+/+-treated mice as compared with corresponding control values. However, similar levels of {alpha}, ß, and {gamma} mRNA values were detected by real-time polymerase chain reaction (PCR) in the lungs of iNOS+/+ and iNOS–/– mice. This is the first demonstration that NO derived from iNOS under basal conditions regulates an important physiologic process.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Pathogen-free C57BL/6NCr (iNOS+/+) mice were obtained from Frederick Cancer Research and Development Center (National Cancer Institute, Frederick, MD). Breeding pairs of C57BL/6J-NOS2tm1Lau mice (iNOS–/–) were obtained from the Jackson Laboratory (Bar Harbor, ME). Mice were bred and maintained in autoclaved Microisolator cages (Lab Products, Maywood, NJ) and provided with food (Teklad, Madison, WI) and water ad libitum. All mice used in these experiments were 8–14 wk old and weighed between 20 and 30 g. Routine health surveillance studies, performed as previously described (17), showed that these mice were negative for the most significant murine pathogens.

In Vivo Inhibition of iNOS Activity
iNOS+/+ mice were given intraperitoneal injections of either a specific inhibitor of iNOS (1400W, 10 mg/kg in saline; Alexis Biochemicals, San Diego, CA) or an equivalent volume of vehicle (normal saline) every 8 h for 72 h. Both sets of mice continued to eat, drink, and groom themselves normally and showed no signs of distress during the injection period. At the end of 72 h, both groups of mice were used for one of the studies listed below.

Levels of Nitrite in the Bronchoalveolar Lavage
iNOS+/+ mice treated with 1400W or saline as described above, as well as uninjected iNOS+/+ and iNOS–/– mice, were killed with intraperitoneal injections of ketamine (8.7 mg/100 g body wt; Phenix Scientific Inc., St. Joseph, MO) and xylazine (1.3 mg/100 g body wt; Vedco, Inc., St. Joseph, MO) and a trimmed, sterile 18-gauge intravenous catheter (Surflo; Terumo Medical Corporation, Elkton, MD) was inserted caudally into the lumen of the exposed trachea. One milliliter of sterile saline was then infused slowly into the alveolar space via a syringe and was withdrawn shortly after. This lavage procedure was repeated three times. The bronchoalveolar lavage (BAL) fluid was centrifuged at 10,000 x g, and the cell-free supernatant was collected and stored at –80°C. Concentrations of nitrite in the supernatant were measured by fluorescence using 2,3-diaminonaphthalene (DAN) (18) following conversion of nitrate to NO2 with Escherichia coli reductase. In each case, 100 µl of sample were incubated in duplicate with 25 µl of freshly prepared DAN (0.05 mg/ml in 0.62 M HCl) for 10 min. The reaction was stopped by the addition of 25 µl of 2.8 N NaOH and the signal was measured using a fluorescent plate reader with excitation at 360 nm, emission at 450 nm, and a gain setting of 100%. NO2 concentrations were calculated from a NaNO2 standard curve prepared from known samples.

Nasal Potential Difference and AFC
Nasal potential difference (NPD) and AFC were measured in iNOS+/+ mice 3 d before the first saline or 1400W injection (control measurements) and 72 h later, immediately following the last injection as previously described (16). AFC was also measured in iNOS+/+ and iNOS–/– mice after filling their lungs with 0.7 ml of 5% BSA in NaCl (which was isosmotic with mouse plasma) containing amiloride in concentrations ranging from 0.5–100 µM. The mice were killed with intraperitoneal injections of ketamine (8.7 mg/100 g body wt; Phenix Scientific Inc.) and xylazine (1.3 mg/100 g body wt; Vedco, Inc.) and a trimmed, sterile 18-gauge intravenous catheter (Surflo, Terumo Medical) was inserted caudally into the lumen of the exposed trachea, and the mouse was placed on a 37°C heating pad. The 5% BSA in NaCl was then slowly instilled into the lungs using a 1-ml syringe. The fluid was removed at the end of 15 min, and the protein concentration of the fluid was measured and compared with the concentration of the instillate as previously described (16).

A549 Cell Culture
A549 cells were purchased from American Type Culture Collection (Manassas, VA) in the 76th passage. They were suspended in Dulbecco's modified Eagle's medium (DMEM)/F-12 medium (Cellgro, Herndon, VA) supplemented with 1% penicillin-streptomycin and 10% fetal bovine serum, plated on plastic tissue culture flasks (Corning Glass Works, Corning, NY), and placed in an incubator in 21% O2, 5% CO2, balance N2 at 37°C and 100% humidity. All measurements were conducted in cells between the 80th and 97th passages.

A549 Whole-Cell Patch Clamp
Whole-cell currents were obtained from A549 cells plated on cover slips and mounted in a flow-through chamber on the stage of an inverted microscope (DMIRB; Leica, Heidelberg, Germany). Recording pipettes were constructed from borosilicate glass capillaries (Warner Instruments Inc., Hamden, CT) using a Narishige PC-10 microelectrode puller (Narishige Scientific Instrument Laboratory, Tokyo, Japan) and were fire polished with a Narishige MF-830 microforge. The pipettes were partially filled with internal standard pipette solution (see below) and had tip resistances of 3–5 M{Omega} for whole-cell recordings. Membrane capacitance was compensated before the onset of recordings. Currents were recorded using an Axopatch 200B patch clamp amplifier (Axon Instruments, Union City, CA), and low pass filtered at 1,000 Hz (LPF-8; Warner Instruments). All experiments were performed at room temperature (20–22°C).

Twenty-four to thirty-six hours before any electrophysiologic measurements, A549 cells were lifted from the tissue culture flasks by treatment with 2.5% trypsin-EDTA (Sigma, St. Louis, MO) for 3–6 min at 37°C and then seeded on 12-mm-diameter glass coverslips in DMEM/F-12 medium and treated with either 10 µM 1400W (an iNOS-specific inhibitor) or the appropriate amount of the vehicle (dimethyl sulfoxide [DMSO]). Just before the start of the experiment, each coverslip was rinsed with external solution with the following ionic composition (in mM): 145 NaCl, 2.7 KCl, 1.8 CaCl2, 2 MgCl2, 5.5 glucose, and 10 HEPES, pH 7.4. Pipettes were back-filled with internal solution with the following ionic composition (in mM): 135 aspartic acid (potassium salt), 10 KCl, 6 NaCl, 1 Mg2ATP, 2 Na2ATP, 5.5 glucose, 10 HEPES, and 0.5 EGTA.

Whole-cell currents were elicited by employing a step-pulse protocol from –110 to +120 mV in 10-mV increments for a duration of 450 µs from a holding potential of –40 mV. Current–voltage (I–V) relationships were constructed by averaging the current values between 50 and 450 ms from the start of recording with the Clampfit Program (Axon Instruments) and plotted using Origin Software (Microcal Software, Northampton, MA). These measurements were repeated following perfusion of these cells with whole-cell external solution containing amiloride in concentrations ranging from 10 nM to 10 µM. Amiloride-sensitive currents were calculated by subtracting the current remaining after exposure to amiloride (the amiloride-insensitive current) from the corresponding control (no amiloride) values. Ki values were calculated from curves fitted to whole cells currents elicited at –100 mV, normalized using the following equation:

where I0 is the current recorded from that cell prior to amiloride exposure, Ix is the current after exposure to a defined concentration of amiloride, and I is the normalized current expressed as a percentage.

ATII Cell Isolation and Western Blotting Studies
ATII cells were isolated using a modification of the protocol developed by Corti and coworkers (19). Mice were killed with a combination of ketamine and xylazine. The renal artery and vein were sectioned to remove most of the circulating blood volume. The chest was opened and the pulmonary vasculature was perfused with normal saline via a catheter inserted into the right ventricle and advanced into the pulmonary artery. The trachea was exposed and cannulated with a trimmed 18-gauge angiocath. A 3-ml syringe containing dispase at 37°C was then attached to the tracheal cannula, and the dispase was pulsed into the alveolar space. The syringe was then removed and, after ~ 7 drops of the dispase leaked from the cannula, 0.45 ml of 45°C low melting agarose were instilled into the alveolar space, and the mouse was packed in ice for 2 min. The lungs were then removed from the chest cavity and incubated in 1 ml of dispase for 45 min at room temperature. The lung tissue was teased away using curved forceps in a culture dish containing DMEM with 0.01% DNAase I, swirled in the dish for 5–10 min, and then filtered successively through 100-, 40-, and 25-µm autoclaved nylon mesh. The cells were then spun down and resuspended in 10% fetal bovine serum in DMEM and plated on cell culture dishes previously coated with biotin-labeled CD45 and CD16 antibodies. The plates were then incubated at 37°C for 2 h. The cells were poured off the plates, spun down, resuspended, and counted with a hemocytometer, and viability was assessed by trypan blue exclusion. The cells were then spun down again and resuspended in lysis buffer for Western blotting or RNA isolation.

Western Blotting
Freshly isolated ATII cells from iNOS+/+ and iNOS–/– mice, as well as A549 cells, were resuspended in lysis buffer (LB) containing 50 mM Tris, 1% Nonidet P-40, 76 mM NaCl, 10% glycerol, 2 mM EGTA, and 10 µg/ml each of PMSF, TPCK, TLCK, leupeptin, and antipain. The cells were then homogenized using a pestle tube in a 1-ml Eppendorf tube 30 times, incubated on ice for 30 min, and homogenized 30 more times. The material was then spun down at 15,000 x g for 10 min, sonicated for 30 s, spun down again, and the supernatant was stored at –80°C until it was used for Western blotting for {alpha}, ß, and {gamma} ENaC as previously described (20). Briefly, the membrane lysate was separated on 7.5% SDS-PAGE, transferred to polyvinylidene difluoride membranes, and immunostained with {alpha}, ß, and {gamma} ENaC polyclonal antibodies raised in rabbits against synthetic peptides derived from xENaC subunit sequences (20), followed by a secondary antibody (anti-rabbit horseradish peroxidase [HRP] conjugate), and visualized using chemiluminescence (ECL) reagents. Western blotting for iNOS was performed using an anti-mouse iNOS antibody (Upstate Biotech, Lake Placid, NY) according to the manufacturer's instructions, using proteins from ATII cells extracted as described above. Western blotting studies for ENaC and iNOS were also performed on proteins extracted from mouse azygous lobes. The lobes were removed and homogenized in lysis buffer for 30 s using a dounce homogenizer. The homogenate was spun at 13,000 rpm for 10 min and sonicated for 30 s, spun down again, and the supernatant was collected and stored at –80°C.

A549 cells were grown to confluence in 75 mm tissue culture flasks and then treated for 24 h with either DMSO or 10 µM 1400W. The cells were then washed with cold phosphate-buffered saline and incubated on ice with 10 mM Tris-HCl (pH 7.4) containing 250 mM sucrose and complete mini protease inhibitor tablets (Roche, Indianapolis, IN) and scraped using a cell scraper every 5 min for 20 min. The suspension was sonicated 30 s on ice and then rested 30 s in ice; this procedure was repeated five times. Sonicated cells were centrifuged at 200 x g at 4°C for 10 min to remove nuclei and unbroken cells, then the supernatant was centrifuged at 40,000 x g for 1 h and the pellet was resuspended in RIPA containing protease inhibitors. The samples were frozen until they were used for Western blotting, as described for mouse ATII cells above.

RNA Isolation
RNA was isolated from the azygous lobe of the lung of iNOS+/+ and iNOS–/– mice using the RNAeasy Mini Kit (Qiagen, Valencia, CA). In brief, the lungs were homogenized 30 s in a dounce homogenizer, then they were passed through an 18-gauge needle 25 times and finally they were spun through the QIAshredder. The kit instructions for animal tissue isolation were then followed.

Preparation of Plasmid Standards for Real-Time PCR
Total RNA was isolated from rat ATII cells and reverse transcribed. {alpha}, ß, and {gamma} enac, and gapdh gene segments were amplified by PCR using specific primers derived from published gene sequences: rat/murine {alpha} enac (156-bp product; forward primer: ATCGGCTTCCAACTGTGCA; reverse primer:CCAGGGCTTCTTCCTCTAGAGC); ß enac (180 bp; TCAGGAGCGGGACCAGAGC; reverse primer GCACAGCACCGAGCCCC); {gamma} enac (288 bp; GATACCTCTGACTGCGCCACC; reverse primer GCCCGTACTCACTGCCTCC); and gapdh (300 bp; TGGCCTTCCGTGTTCCTACC; reverse primer: TGTAGGCCATGAGGTCCACCAC). The PCR products were visualized by electrophoresis through a 1% agarose gel in Tris Borate EDTA (TBE) to confirm that a single product was obtained for each primer set. A melting curve program was also run on each primer pair and only one melting temperature was observed, suggesting one product for each PCR reaction. PCR products were then cloned into PGEMTeasy (Promega, Madison, WI). The sequence of each insert was verified by sequencing the plasmid. Each plasmid was then used to generate a standard curve for real-time PCR using serial ten-fold dilutions of plasmid DNA (100 pg/reaction–0.01 pg/reaction).

Real-Time PCR
Real-time PCR was performed using the SYBR Green PCR Core kit (Applied Biosystems, Foster City, CA) in accordance with manufacturer's instructions. Following a hot start (3 min at 95°C), 2.5 µl of each cDNA was subjected to 40 cycles of PCR (30 s each at Tm 95°C, Ta 55°C, Te 72°C, per cycle, except ßenac Ta 60°C, Te 68°C) in a 25-µl reaction volume on a Bio-Rad (Hercules, CA) iCycler with iQ real-time PCR detection, using AmpliTaq Gold DNA polymerase (Applied Biosystems) and 100 pmole of intron-spanning primers (described above). Incorporation of SYBR Green I, which binds dsDNA, into reactions allowed detection of PCR products. Reactions containing RNAase-free water in place of cDNA were also performed as negative controls for contamination with "junk" DNA. PCR products were also visualized by electrophoresis through a 1% agarose gel in TBE to verify size and absence of nonspecific product. Three separate PCR reactions were performed for each animal for each product. In each reaction, five replicates were subjected to PCR. Data were pooled and analyzed using iCycler software (Bio-Rad). Levels of enac subunit mRNA were expressed as a relative ratio to levels of gapdh mRNA.

Mouse Tracheal Epithelial Cell Studies
Mouse tracheal epithelial (MTE) cells were isolated, cultured, and seeded on permeable Transwell culture inserts (Type 3413, surface area: 0.33 cm2, pore size: 0.4 µm; Corning) at a density of 8 x 104 cells/cm2. Before seeding, the inserts were collagen-coated by incubating them with a solution containing 0.1 g/liter type VI collagen (C-7521; Sigma) and 2 ml/liter glacial acetic acid at 37°C for 24 h. The culture media on the basolateral side of the filters was replaced every 48 h. Starting 4 d after seeding, fluid was removed from the apical side every other day when the basolateral culture medium was changed, and cells were cultured for five to seven additional days at an air–liquid interface until they formed electrically tight confluent monolayers capable of preventing efflux of fluid from the basolateral to the apical compartment. At this time, monolayers were treated with either 1400W (1 µM) or 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ; Tocris Cookson, St. Louis, MO), a specific inhibitor of guanylate cyclase (5 µM) every 12 h for 24 h. Spontaneous potential difference (PD) and transepithelial resistance (Rt) across these cell monolayers were measured daily, before and after addition of 10 µM amiloride in the apical compartment, using an Epithelial Voltmeter equipped with chopstick-style electrodes (World Precision Instruments, Inc., Sarasota, FL). Equivalent short-circuit currents (Ieq) were calculated by Ohm's law (Ieq = PD/Rt).

cGMP Measurement
Confluent MTE cells on 0.33 cm2 filters cultured as above were lysed with 250 µl 0.1 M HCl, and cGMP was measured using the Direct cyclic GMP Correlate-EIA Kit (Assay Designs, Inc., Ann Arbor, MI) according to the protocol described by the manufacturer.

Statistical Analysis
Data were analyzed by ANOVA, using the Bonferroni method for multiple comparisons, Student's t test, or paired t test when appropriate. All values given are means ± 1 SEM; P values of < 0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
iNOS Western Blotting and Nitrite Levels
Western blotting studies using iNOS antibodies showed the presence of a 135-kD immunoreactive protein, which corresponds to the MW of iNOS, in both azygous lobes (Figure 1A) and ATII cells (Figure 1B) of iNOS+/+ but not in iNOS–/– mice. In addition, significantly higher levels of steady-state NO2 were detected in the BAL of iNOS+/+ as compared with iNOS–/– mice (4.40 ± 0.41 µM versus 0 ± 0.12; mean ± SEM; n = 14, Figure 1C). Finally, intraperitoneal injections of 10 mg/kg of 1400W (an iNOS specific inhibitor) into iNOS+/+ mice every 8 h for 72 h resulted in significantly lower levels of NO2 in their BAL as compared with vehicle (saline) controls (1.01 ± 0.44 µM versus 3.24 ± 0.48 µM; mean ± SEM; n = 9, Figure 1C). These data are consistent with the presence of functional iNOS protein in the lungs of iNOS+/+ mice under basal conditions.



View larger version (53K):
[in this window]
[in a new window]
 
Figure 1. iNOS is present and active under basal conditions in C57BL/6 mouse lungs. Representative western blots of (A) azygous lobes and (B) ATII cells isolated from iNOS+/+ and iNOS–/– mice. Equal amounts of proteins were separated on a 7.5% SDS-PAGE, transferred to polyvinyldidene difluoride membranes, followed by probing with anti-mouse iNOS antibody, and then anti-rabbit HRP conjugate as the secondary antibody, and finally developed by ECL reagents. These measurements were repeated with proteins derived from five different mice with identical results. (C) Nitrite levels in the BAL of iNOS+/+ and iNOS–/– mice. Some of the iNOS+/+ mice were injected with either saline or 1400W as described in the text. All mice were killed and their lungs were lavaged with sterile saline. NO3 was first converted to NO2 with Escherichia coli reductase, and concentrations of NO2 were measured using fluorescence using DAN. Values are means ± SEM. Solid bars, uninjected iNOS+/+ (n = 14); narrow diagonal stripes, iNOS+/+ injected with saline (n = 9); wide diagonal stripes, iNOS+/+ injected with 1400W (n = 9); hatched bars, uninjected iNOS–/– (n = 14). *P < 0.01 as compared with the uninjected iNOS+/+ value.

 
AFC in 1400W-Injected Mice
Similar values for AFC were noted across the lungs of 1400W and saline-injected iNOS+/+ mice (42.3 ± 1.88 versus 37.6 ± 2.02; % of instillate cleared per 30 min; mean ± SEM; n = 4). These values are in agreement with our previous measurements showing no difference in basal AFC among iNOS+/+ and iNOS–/– mice (16). Previous values of AFC in live, anesthetized, and ventilated mice varied from 30–37% of the instilled volume per 30 min (16, 21, 22). Addition of amiloride (1.5 mM) in the alveolar instillate decreased AFC by ~ 50% in saline injected mice (from 42.3 ± 1.88 to 20.4 ± 0.61; mean ± SEM; n = 4) but had no effect on the AFC of mice treated with 1400W (Table 1). To better assess the effects of amiloride on AFC, we killed mice and filled their lungs with 0.7 ml of 5% BSA in NaCl containing various concentrations of amiloride, which enhanced the uniform distribution of this agent in the alveolar space, thus allowing us to use much less amiloride and still inhibit fluid clearance. As shown in Table 2, under these conditions amiloride decreased AFC across the lungs of iNOS+/+ mice with an apparent Ki of < 1 µM. In contrast, amiloride in concentrations between 10 and 100 µM had no effect on the AFC of iNOS–/– mice. These data clearly demonstrate that Na+ entry in alveolar epithelial cells of iNOS+/+ mice occurs through ENaC-type channels.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Effects of 1400W or an equivalent volume of vehicle (saline) on amiloride sensitivity

 

View this table:
[in this window]
[in a new window]
 
TABLE 2. Effects of amiloride on AFC of iNOS+/+ and iNOS–/– mice

 
NPD Values in 1400W-Injected Mice
NPD were measured in iNOS+/+ mice before and after intraperitoneal injections with saline or 10 mg/kg 1400W every 8 h for 72 h. Typical records obtained during perfusion of the external nares of 1400W-injected mice with Ringers solution containing either 0 or 100 µM amiloride are shown in Figure 2A. For each mouse, the amiloride-sensitive portion of NPD was calculated as the difference just before and after perfusion with amiloride. Mean values for this variable are shown in Figure 2B and Table 1. Mice injected with 1400W had significantly lower values of amiloride-sensitive NPD as compared with their pre-injection (baseline) values (1.75 ± 0.33 mV versus 2.75 ± 0.37 mV; mean ± SEM; n = 8). Importantly, no change in the amiloride-sensitive portion of NPD was seen following injection with equivalent volumes of saline (2.70 ± 0.2 mV versus 2.5 ± 0.29 mV; mean ± SEM; n = 10). Baseline NPD was not different between the two treatment groups before or after injections (data not shown). Again, these data are consistent with previous findings showing that amiloride does not inhibit NPD in iNOS–/– mice (16).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. The amiloride-sensitive fraction of nasal potential difference of iNOS+/+ mice is decreased by 1400W. NPD values of iNOS+/+ mice were measured before and after injection with either 10 mg/kg 1400W or saline every 8 h for 72 h. (A) NPD tracings before (left panel) and after (right panel) 1400W injections. Arrows indicate the time at which amiloride (10 µM) was added into the perfusate. Notice a significantly smaller NPD drop in 1400W-injected mice following addition of amiloride (right panel) as compared with the corresponding value before injection (left panel). (B) Summary of amiloride-sensitive NPD values (calculated as the difference in steady-state values just before [solid bars] and after [striped bars] addition of amiloride) in 1400W- and saline-injected iNOS+/+ mice. Values are means ± SEM; n >= 8, *P < 0.05 between before versus after 1400 W injections (paired t test).

 
Na+ Transport across 1400W- and ODQ-Treated MTE Cells
As shown in Figure 3 similar values of Ieq were recorded across confluent monolayers of MTE cells isolated from iNOS+/+ or iNOS–/– mice. However, addition of amiloride (10 µM) into the fluid bathing the apical compartments decreased Ieq by ~ 50% in the former, but had no effect on the latter. In agreement with the previously mentioned in vivo studies, addition of the iNOS inhibitor 1400W in the culture medium of the MTE cells, isolated from iNOS+/+ mice, abrogated the inhibitory effects of amiloride (Figures 3A and 3B and Table 1). Pretreatment of MTE cells with ODQ (5 µM; a specific inhibitor of guanylate cyclase) inhibited their cGMP values but had no effect either on the baseline or the amiloride-sensitive portion of Ieq (Figures 3A–3C). Pretreatment of these cells with 10 µM ODQ further decreased cGMP levels (Figure 3C) but still did not decrease their amiloride-sensitive currents (data not shown). These data indicate that the effects of NO on amiloride-sensitive transport were not mediated by changes of cGMP levels.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. Inhibition of amiloride-sensitive currents in 1400W-treated MTE cells from iNOS+/+ mice occurs via cGMP-independent mechanisms. MTE cells were isolated from iNOS+/+ and iNOS–/– mice and cultured on Transwell filters until they formed confluent monolayers; they were then treated with either 1400W or ODQ (5 or 10 µM) as described in the text. (A) MTE Ieq (µA/cm2), calculated from Ohm's law from measurements of transepithelial resistance and potential differences across confluent MTE monolayers, in the absence and presence of amiloride (10 µM). Values are means ± SEM; n >= 3, *P < 0.05 as compared with the corresponding value in the absence of amiloride in the same group (paired t test). (B) Fraction of the amiloride-sensitive Ieq, calculated as the difference between Ieq before and after addition of amiloride divided by the total Ieq in individual monolayers. Values are means ± SEM; n >= 3, *P < 0.05 as compared with the immediately preceding value (ANOVA). (C) cGMP levels (fmol/ml) for MTE cells from iNOS+/+ and iNOS–/– mice. Values are means ± SEM. Numbers above each bar indicate number of measurements for the particular group; *, #P < 0.05 for as indicated in the graph (ANOVA).

 
Whole-Cell Current–Voltage Relationships in 1400W-Treated A549 Cells
A549 cells exhibited both inward (Na+) and outward (K+) currents in the presence of nonsymmetrical solutions (i.e., 145 mM Na+ in the bath and 145 mM K+ in the pipette). Typical records of whole-cell current-voltage relationships of cells treated with either DMSO (vehicle control) or 10 µM 1400W for 24–36 h are shown in Figure 4. Mean current–voltage relationships are shown in Table 3. Pretreatment with 1400W significantly reduced both inward (Na+) and outward (K+) currents. Perfusion of DMSO-treated cells with amiloride inhibited Na+ whole-cell currents with a Ki of ~ 249 nM at a holding potential of –100 mV (Figure 5). In contrast, whole-cell currents of 1400W-treated cells were insensitive to amiloride (Figures 5).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 4. 1400W-treated A549 cells have lower whole-cell currents. Representative whole-cell current relationships of A549 cells treated with (A) 10 µl DMSO (vehicle) for 24 h; (B) 10 µM 1400W for 24 h; (C) 10 µl DMSO for 24 h (same cell as in A) and perfused with amiloride (10 µM); and (D) 10 µM 1400W for 24 h (same cell as in B) and perfused with amiloride (10 µM). Whole-cell currents were elicited by employing a step-pulse protocol from –110 to +120 mV in 10-mV increments for a duration of 450 µs from a holding potential of –40 mV. 1400W-treated cells lack amiloride-sensitive current. Results of typical experiments which were repeated at least five times with similar results.

 

View this table:
[in this window]
[in a new window]
 
TABLE 3. Current [I (pA)]–voltage [V (mV)] relationships of vehicle or 1400W-treated A549 cells in the absence and presence of amiloride

 


View larger version (13K):
[in this window]
[in a new window]
 
Figure 5. Amiloride inhibits inward currents across vehicle- but not 1400W-treated cells. A549 cells were treated with either vehicle (DMSO; solid squares) or 1400W (open circles) as described in the text and the legend of Figure 7. Whole-cell currents were elicited by employing a step-pulse protocol from –110 to +120 mV in 10-mV increments for a duration of 450 µs from a holding potential of –40 mV in the absence and then in the presence of various concentrations of amiloride. Currents elicited at –100 mV in the presence of amiloride (0.01–10 µM) were normalized to total current in the absence of amiloride. For DMSO-treated cells, a Ki 249 nM was calculated from the following equation: I = (1 – (I0 – Ix)/I0) · 100 where I0 is the current recorded from that cell before amiloride exposure, Ix is the current after exposure to a defined concentration of amiloride, and I is the normalized current expressed as a percentage. Current in 1400W-treated cells was not decreased by the addition of amiloride. Numbers are means ± 1 SEM; numbers above each point represent number of measurements.

 


View larger version (43K):
[in this window]
[in a new window]
 
Figure 7. ENaC levels in A549 cells treated with either 1400W or vehicle. Western blotting studies in proteins extracted from A549 cells treated with either DMSO (lanes D) or 10 µM 1400W for 24 h (lanes W). Equal amounts of protein, extracted from A549 cells were separated using 7.5% SDS-PAGE, transferred to polyvinyldidene difluoride membranes, and immunostained with anti-{alpha}, ß, and {gamma} ENaC antibodies followed, in the absence and presence of the immunizing peptide (lanes Pep) by anti-rabbit HRP conjugate as the secondary antibody, and developed by ECL. Results of typical experiments that were repeated at least three different times. Numbers adjacent to the arrows indicate the molecular weights of the noted bands (kD).

 
Western Blotting Studies for {alpha}, ß, and {gamma} ENaC
Typical Western blots for {alpha}, ß, and {gamma} ENaC of proteins extracted from either azygous lobes or ATII cells from iNOS+/+ and iNOS–/– mice, are shown in Figure 6. The corresponding values for vehicle- or 1400W-treated A549 cells are shown in Figure 7. The {alpha}ENaC antibody recognized a 120-kD protein in azygous lobes and ATII cells and 78- and 85-kD proteins in A549 cells. Antibodies to ßENaC recognized two different bands with MW of 125 and 75 kD in ATII cells and the azygous lobes 90 kD in A549 cells; and finally antibodies to {gamma} ENaC recognized bands with MW of 150 kD in the ATII cells and 125 and 70 kD in the azygous lobes 89 kD in A549 cells. It is interesting to note that in a very recent study, Hughey and colleagues (23) reported the presence of a 75-kD {gamma}ENaC band, which was attributed to proteolytic cleavage of ENaC during maturation. In all cases, the bands were eliminated when proteins were coincubated with the antibodies in the presence of the antigenic peptides. Densitometry analysis of all bands immunocompeted by the peptides (see Table 4) showed that azygous lobes and ATII cells of iNOS–/– mice had significant lower amounts of {alpha} and {gamma} ENaC but equal amounts of ßENaC proteins. Similar results were seen in azygous lobes of iNOS+/+ mice injected with 1400W as compared with those injected with saline (decreased {alpha} and {gamma}, but similar ß) and A549 cells treated with 1400W in vitro (Table 4).



View larger version (67K):
[in this window]
[in a new window]
 
Figure 6. ENaC levels in azygous lobes and ATII cells from iNOS+/+ and iNOS–/– mice. Western blotting studies in proteins extracted from: (A) ATII cells from iNOS+/+ (lanes marked with +) and iNOS–/– (lanes marked with –) mice and (B) azygous lobes of iNOS+/+ (lanes marked with +) and iNOS–/– mice (lanes marked with –). Equal amounts of protein, extracted from ATII cells and azygous lobe, were separated using 7.5% SDS-PAGE, transferred to polyvinyldidene difluoride membranes, and immunostained with anti-{alpha}, ß, and {gamma} ENaC antibodies followed, in the absence and presence of the immunizing peptide (lanes Pep) by anti-rabbit HRP conjugate as the secondary antibody, and developed by ECL. Numbers adjacent to the arrows indicate the molecular weights of the noted bands (kD).

 

View this table:
[in this window]
[in a new window]
 
TABLE 4. Normalized densitometry

 
Real-Time PCR
cDNA made from azygous lobes from iNOS+/+ and iNOS–/– mice was used for real time PCR using primers for {alpha}, ß, and {gamma} enac and gapdh. All were compared with known amounts of each cDNA and the calculated amounts of cDNA are presented as ratios to gapdh to control for differences in amount of total starting material (Table 5). There was no significant difference between the ratios of {alpha}, ß, and {gamma}enac to gapdh between iNOS+/+ and iNOS–/– mice. These data indicate that although there were changes in the amount of ENaC subunit protein, there was no significant change in the steady-state message levels for enac subunit.


View this table:
[in this window]
[in a new window]
 
TABLE 5. enac mRNA values from azygous lobes of iNOS+/+ and iNOS–/– mice expressed as ratios to GAPDH

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Studies from our laboratories and others have shown that large amounts of NO, from iNOS or NO donors, cause decreased Na+ channel activity (10, 11). The effects of basal NO on the lung Na+ transport in vivo have not previously been explored. The presence and activity of iNOS in the lungs under noninflammatory conditions is somewhat controversial, with some researchers finding evidence for its activity (14) and others finding none (24). Our data clearly demonstrate the presence of iNOS protein and higher levels of NO2 in the lungs of iNOS+/+ mice compared with that found in lungs from iNOS–/– mice. We also found that lungs from mice treated with 1400W as well as lungs and ATII cells from iNOS–/– mice and A549 cells treated with 1400W had substantially decreased levels of {alpha} and {gamma}ENaC. These findings may explain the lack of amiloride response both of Na+-dependent AFC in vivo and of whole-cell currents across A549 cells. On the other hand, iNOS–/– mice have normal levels of AFC (16), indicating that NO does not play a role in the regulation of basal Na+ transport across the alveolar epithelium.

The molecular weights recognized by the ENaC antibodies in mice ATII cells and whole lung of our mice are somewhat different from those reported in Xenopus oocytes (20), rats (5, 25), and humans (26). These discrepancies may be attributed not only to differences among cell types (probably because of variable post-translational modifications) but also in the culture conditions employed. Indeed, other investigators have also described higher molecular weight forms in native epithelial cells that apparently correspond to mature, fully processed proteins (27).

NO derived from iNOS has been shown to alter the transcription of several proteins (28, 29). However, our data show that there is no change in the amount of mRNA for the ENaC subunits in the lungs of iNOS+/+ versus iNOS–/– mice. This does not eliminate the possibility that NO from iNOS may be altering the transcription of a gene for a protein that in turn regulates ENaC protein expression in the lung; however, our findings clearly indicate that NO does not directly alter ENaC transcription.

We used ODQ, which inhibits cGMP production by guanylyl cyclase in response to NO, to determine if the lack of amiloride-sensitive Ieq in the MTE cells from the iNOS–/– mice was due to decreased cGMP production. We found that amiloride-sensitive currents did not change in the presence of ODQ in MTE cells from wild-type mice.

Other possible mechanisms include alterations in ENaC degradation or post-transcriptional changes in the ENaC proteins as well as alterations in nitration, nitrosation, or oxidation of ENaC or alterations in other proteins that in turn alter the properties of the Na+ channels. Nitrosation of cys118 in p21ras has been shown to increase its activity (30). Munc-18 is a positive regulator of vesicle trafficking and may be important in the trafficking of the lung Na+ channel (31). Di Stasi and coworkers found that munc-18 was nitrated on specific tyrosine residues when synaptosomes were exposed to peroxynitrite, and these synaptosomes had increased exocytosis of vesicles when they were exposed to peroxynitrite (32). There are numerous proteins involved in ENaC assembly, trafficking, and degradation that would be candidates for chemical alteration by NO.

In a previous study, Marnett and colleagues (33) showed significantly lower levels of prostaglandin E2 (PGE2) and F2-isoprostanes in the urine of iNOS–/– as compared with iNOS+/+ mice. These authors argued that endogenous levels of NO regulate prostaglandin biosynthesis. PGE2 is known to play an essential role in transepithelial transport across A6 monolayers (34). However, levels of PGE2 in alveolar epithelial lining fluid as well as their possible effects on the amiloride sensitivity of lung ion channels have not been quantified.

We have previously shown that alveolar fluid clearance in both iNOS+/+ and iNOS–/– mice is sodium–dependent (16). Because the instillate does not contain glucose or amino acids, the contribution of Na+-cotransporters in the entry of Na+ ions across alveolar epithelial cells can be ruled out. A number of studies have demonstrated the presence of a variety of Na+ channels (including 25 pS cation channels with limited selectivity of Na+ versus K+ and 4–6 pS ENaC-type channels) in both ATII and type I cells (5, 35, 36). Our data clearly establish the presence of all three ENaC subunits in lung homogenates and ATII cells from both iNOS+/+ and iNOS–/– mice, albeit at different relative proportions. It has been shown that combinations of these three subunits comprising the channel ({alpha}, ß, and {gamma}) could produce channels with varying biophysical properties (37) and various sensitivities to amiloride (38). In ATII cells Jain and coworkers (5, 39) have shown that ENaC type channels are composed of {alpha}, ß, and {gamma} subunits, whereas cation channels (which require higher concentrations of amiloride to become fully inhibited) appear to be composed of combinations of {alpha} with ß or {gamma}. Although we have not evaluated the single channel properties of alveolar cells from iNOS+/+ and iNOS–/– mice, it is reasonable to expect that channels with alternative subunits could account, at least to some extent, for the noted large differences in amiloride sensitivity of Na+ transport among iNOS+/+ and iNOS–/–. Studies in mice in which either the ß or {gamma} subunits were inactivated by gene targeting have shown that remaining {alpha}{gamma} or {alpha}ß channels were sufficient to clear fetal lung fluid shortly after birth and maintain the adult lungs free from fluid although not enough to prevent salt wasting due to decreased reabsorption across kidney cells (40, 41).

In summary, results of both in vivo and in vitro studies presented herein indicate the physiologic levels of NO, or reactive intermediates produced by the interaction of NO with reactive oxygen species, regulate fundamental properties of Na+ transport across alveolar epithelial cells. This is the first demonstration that NO derived from iNOS regulates an important function of the alveolar epithelium.


    Acknowledgments
 
The authors thank Drs. Judy Hickman-Davis and Ian Davis for many helpful discussions, Dr. Lan Chen for her help in isolating and culturing MTE cells, and Ms. Tanta Myles for her technical support. These studies were supported by NIH grants HL31197, HL51173, and NIDDK P30 DK54781 (S.M.) and 1RO1HL071621 (D.C.E.). K.M.H. was supported by HL07918–04.

Received in original form September 2, 2003

Received in final form October 19, 2003


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Matthay, M. A., H. G. Folkesson, and C. Clerici. 2002. Lung epithelial fluid transport and the resolution of pulmonary edema. Physiol. Rev. 82:569–600.[Abstract/Free Full Text]
  2. Matalon, S., and H. O'Brodovich. 1999. Sodium channels in alveolar epithelial cells: molecular characterization, biophysical properties, and physiological significance. Annu. Rev. Physiol. 61:627–661.[CrossRef][Medline]
  3. Yue, G., W. J. Russell, D. J. Benos, R. M. Jackson, M. A. Olman, and S. Matalon. 1995. Increased expression and activity of sodium channels in alveolar type II cells of hyperoxic rats. Proc. Natl. Acad. Sci. USA 92:8418–8422.[Abstract/Free Full Text]
  4. Yue, G., P. Hu, Y. Oh, T. Jilling, R. L. Shoemaker, D. J. Benos, E. J. Cragoe, Jr., and S. Matalon. 1993. Culture-induced alterations in alveolar type II cell Na+ conductance. Am. J. Physiol. 265:C630–C640.
  5. Jain, L., X. J. Chen, S. Ramosevac, L. A. Brown, and D. C. Eaton. 2001. Expression of highly selective sodium channels in alveolar type II cells is determined by culture conditions. Am. J. Physiol. Lung Cell. Mol. Physiol. 280:L646–L658.[Abstract/Free Full Text]
  6. Factor, P., C. Senne, V. Dumasius, K. Ridge, H. A. Jaffe, B. Uhal, Z. Gao, and J. I. Sznajder. 1998. Overexpression of the Na+,K+-ATPase alpha1 subunit increases Na+,K+- ATPase function in A549 cells. Am. J. Respir. Cell Mol. Biol. 18:741–749.[Abstract/Free Full Text]
  7. Yue, G., and S. Matalon. 1997. Mechanisms and sequelae of increased alveolar fluid clearance in hyperoxic rats. Am. J. Physiol. 272:L407–L412.
  8. Hummler, E., P. Barker, J. Gatzy, F. Beermann, C. Verdumo, A. Schmidt, R. Boucher, and B. C. Rossier. 1996. Early death due to defective neonatal lung liquid clearance in {alpha}ENaC-deficient mice. Nat. Genet. 12:325–328.[CrossRef][Medline]
  9. Guo, Y., M. D. Duvall, J. P. Crow, and S. Matalon. 1998. Nitric oxide inhibits Na+ absorption across cultured alveolar type II monolayers. Am. J. Physiol. 274:L369–L377.
  10. Lazrak, A., A. Samanta, and S. Matalon. 2000. Biophysical properties and molecular characterization of amiloride-sensitive sodium channels in A549 cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 278:L848–L857.[Abstract/Free Full Text]
  11. Jain, L., X. J. Chen, L. A. Brown, and D. C. Eaton. 1998. Nitric oxide inhibits lung sodium transport through a cGMP-mediated inhibition of epithelial cation channels. Am. J. Physiol. 274:L475–L484.
  12. Compeau, C. G., O. D. Rotstein, H. Tohda, Y. Marunaka, B. Rafii, A. S. Slutsky, and H. O'Brodovich. 1994. Endotoxin-stimulated alveolar macrophages impair lung epithelial Na+ transport by an L-Arg-dependent mechanism. Am. J. Physiol. 266:C1330–C1341.
  13. Nielsen, V. G., M. S. Baird, L. Chen, and S. Matalon. 2000. DETANONOate, a nitric oxide donor, decreases amiloride-sensitive alveolar fluid clearance in rabbits. Am. J. Respir. Crit. Care Med. 161:1154–1160.[Abstract/Free Full Text]
  14. Guo, F. H., H. R. De Raeve, T. W. Rice, D. J. Stuehr, F. B. Thunnissen, and S. C. Erzurum. 1995. Continuous nitric oxide synthesis by inducible nitric oxide synthase in normal human airway epithelium in vivo. Proc. Natl. Acad. Sci. USA 92:7809–7813.[Abstract/Free Full Text]
  15. Asano, K., C. B. Chee, B. Gaston, C. M. Lilly, C. Gerard, J. M. Drazen, and J. S. Stamler. 1994. Constitutive and inducible nitric oxide synthase gene expression, regulation, and activity in human lung epithelial cells. Proc. Natl. Acad. Sci. USA 91:10089–10093.[Abstract/Free Full Text]
  16. Hardiman, K. M., J. R. Lindsey, and S. Matalon. 2001. Lack of amiloride-sensitive transport across alveolar and respiratory epithelium of iNOS(–/–) mice in vivo. Am. J. Physiol. Lung Cell. Mol. Physiol. 281:L722–L731.[Abstract/Free Full Text]
  17. Hickman-Davis, J., J. Gibbs-Erwin, J. R. Lindsey, and S. Matalon. 1999. Surfactant protein A mediates mycoplasmacidal activity of alveolar macrophages by production of peroxynitrite. Proc. Natl. Acad. Sci. USA 96:4953–4958.[Abstract/Free Full Text]
  18. Misko, T. P., R. J. Schilling, D. Salvemini, W. M. Moore, and M. G. Currie. 1993. A fluorometric assay for the measurement of nitrite in biological samples. Anal. Biochem. 214:11–16.[CrossRef][Medline]
  19. Corti, M., A. R. Brody, and J. H. Harrison. 1996. Isolation and primary culture of murine alveolar type II cells. Am. J. Respir. Cell Mol. Biol. 14:309–315.[Abstract]
  20. Malik, B., L. Schlanger, O. Al Khalili, H. F. Bao, G. Yue, S. R. Price, W. E. Mitch, and D. C. Eaton. 2001. Enac degradation in A6 cells by the ubiquitin-proteosome proteolytic pathway. J. Biol. Chem. 276:12903–12910.[Abstract/Free Full Text]
  21. Fukuda, N., H. G. Folkesson, and M. A. Matthay. 2000. Relationship of interstitial fluid volume to alveolar fluid clearance in mice: ventilated vs. in situ studies. J. Appl. Physiol. 89:672–679.[Abstract/Free Full Text]
  22. Davis, I. C., W. M. Sullender, J. M. Hickman-Davis, J. R. Lindsey, and S. Matalon. 2004. Nucleotide-mediated inhibition of alveolar fluid clearance in BALB/c mice following respiratory syncytial virus infection. Am. J. Physiol. Lung Cell. Mol. Physiol. 286:L112–L120.[Abstract/Free Full Text]
  23. Hughey, R. P., G. M. Mueller, J. B. Bruns, C. L. Kinlough, P. A. Poland, K. L. Harkleroad, M. D. Carattino, and T. R. Kleyman. 2003. Maturation of the epithelial Na+ channel involves proteolytic processing of the alpha and gamma subunits. J. Biol. Chem. 278:37073–37082.[Abstract/Free Full Text]
  24. Pechkovsky, D. V., G. Zissel, T. Goldmann, M. Einhaus, C. Taube, H. Magnussen, M. Schlaak, and J. Muller-Quernheim. 2002. Pattern of NOS2 and NOS3 mRNA expression in human A549 cells and primary cultured AEC II. Am. J. Physiol. Lung Cell. Mol. Physiol. 282:L684–L692.[Abstract/Free Full Text]
  25. Thome, U. H., I. C. Davis, S. V. Nguyen, B. J. Shelton, and S. Matalon. 2003. Modulation of sodium transport in fetal alveolar epithelial cells by oxygen and corticosterone. Am. J. Physiol. Lung Cell. Mol. Physiol. 284:L376–L385.[Abstract/Free Full Text]
  26. Wodopia, R., H. S. Ko, J. Billian, R. Wiesner, P. Bartsch, and H. Mairbaurl. 2000. Hypoxia decreases proteins involved in epithelial electrolyte transport in A549 cells and rat lung. Am. J. Physiol. Lung Cell. Mol. Physiol. 279:L1110–L1119.[Abstract/Free Full Text]
  27. Kleyman, T. R., J. B. Zuckerman, P. Middleton, K. A. McNulty, B. Hu, X. Su, B. An, D. C. Eaton, and P. R. Smith. 2001. Cell surface expression and turnover of the alpha-subunit of the epithelial sodium channel. Am. J. Physiol. Renal Physiol. 281:F213–F221.[Abstract/Free Full Text]
  28. Bogdan, C. 2001. Nitric oxide and the immune response. Nat. Immunol. 2:907–916.[CrossRef][Medline]
  29. Kroncke, K. D., H. Haase, D. Beyersmann, V. Kolb-Bachofen, and M. K. Hayer-Hartl. 2001. Nitric oxide inhibits the cochaperone activity of the RING finger-like protein DnaJ. Nitric Oxide 5:289–295.[CrossRef][Medline]
  30. Lander, H. M., D. P. Hajjar, B. L. Hempstead, U. A. Mirza, B. T. Chait, S. Campbell, and L. A. Quilliam. 1997. A molecular redox switch on p21(ras). Structural basis for the nitric oxide-p21(ras) interaction. J. Biol. Chem. 272:4323–4326.[Abstract/Free Full Text]
  31. Voets, T., R. F. Toonen, E. C. Brian, H. de Wit, T. Moser, J. Rettig, T. C. Sudhof, E. Neher, and M. Verhage. 2001. Munc18–1 promotes large dense-core vesicle docking. Neuron 31:581–591.[CrossRef][Medline]
  32. Di Stasi, A. M., C. Mallozzi, G. Macchia, G. Maura, T. C. Petrucci, and M. Minetti. 2002. Peroxynitrite affects exocytosis and SNARE complex formation and induces tyrosine nitration of synaptic proteins. J. Neurochem. 82:420–429.[CrossRef][Medline]
  33. Marnett, L. J., T. L. Wright, B. C. Crews, S. R. Tannenbaum, and J. D. Morrow. 2000. Regulation of prostaglandin biosynthesis by nitric oxide is revealed by targeted deletion of inducible nitric-oxide synthase. J. Biol. Chem. 275:13427–13430.[Abstract/Free Full Text]
  34. Worrell, R. T., H. F. Bao, D. D. Denson, and D. C. Eaton. 2001. Contrasting effects of cPLA2 on epithelial Na+ transport. Am. J. Physiol. Cell Physiol. 281:C147–C156.[Abstract/Free Full Text]
  35. Yue, G., R. L. Shoemaker, and S. Matalon. 1994. Regulation of low-amiloride-affinity sodium channels in alveolar type II cells. Am. J. Physiol. 267:L94–100.
  36. Matalon, S., A. Lazrak, L. Jain, and D. C. Eaton. 2002. Invited review: biophysical properties of sodium channels in lung alveolar epithelial cells. J. Appl. Physiol. 93:1852–1859.[Abstract/Free Full Text]
  37. Snyder, P. M., C. Cheng, L. S. Prince, J. C. Rogers, and M. J. Welsh. 1998. Electrophysiological and biochemical evidence that DEG/ENaC cation channels are composed of nine subunits. J. Biol. Chem. 273:681–684.[Abstract/Free Full Text]
  38. McNicholas, C. M., and C. M. Canessa. 1997. Diversity of channels generated by different combinations of epithelial sodium channel subunits. J. Gen. Physiol. 109:681–692.[Abstract/Free Full Text]
  39. Jain, L., X. J. Chen, B. Malik, O. Al Khalili, and D. C. Eaton. 1999. Antisense oligonucleotides against the alpha-subunit of ENaC decrease lung epithelial cation-channel activity. Am. J. Physiol. 276:L1046–L1051.
  40. Barker, P. M., M. S. Nguyen, J. T. Gatzy, B. Grubb, H. Norman, E. Hummler, B. Rossier, R. C. Boucher, and B. Koller. 1998. Role of gammaENaC subunit in lung liquid clearance and electrolyte balance in newborn mice. Insights into perinatal adaptation and pseudohypoaldosteronism. J. Clin. Invest. 102:1634–1640.[Medline]
  41. McDonald, F. J., B. Yang, R. F. Hrstka, H. A. Drummond, D. E. Tarr, P. B. McCray, Jr., J. B. Stokes, M. J. Welsh, and R. A. Williamson. 1999. Disruption of the beta subunit of the epithelial Na+ channel in mice: hyperkalemia and neonatal death associated with a pseudohypoaldosteronism phenotype. Proc. Natl. Acad. Sci. USA 96:1727–1731.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
E. N. Z. Yu, Z. P. Traylor, and I. C. Davis
Effect of ventilation pressure on alveolar fluid clearance and {beta}-agonist responses in mice
Am J Physiol Lung Cell Mol Physiol, October 1, 2009; 297(4): L785 - L793.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
K. B. Adler and S. Matalon
Highlights of the July Issue
Am. J. Respir. Cell Mol. Biol., July 1, 2009; 41(1): 1 - 2.
[Full Text] [PDF]


Home page
J. Physiol.Home page
H.-G. Nie, L. Chen, D.-Y. Han, J. Li, W.-F. Song, S.-P. Wei, X.-H. Fang, X. Gu, S. Matalon, and H.-L. Ji
Regulation of epithelial sodium channels by cGMP/PKGII
J. Physiol., June 1, 2009; 587(11): 2663 - 2676.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
A. P. Comellas, A. Briva, L. A. Dada, M. L. Butti, H. E. Trejo, C. Yshii, Z. S. Azzam, J. Litvan, J. Chen, E. Lecuona, et al.
Endothelin-1 Impairs Alveolar Epithelial Function via Endothelial ETB Receptor
Am. J. Respir. Crit. Care Med., January 15, 2009; 179(2): 113 - 122.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
L. Chen, C. A. Bosworth, T. Pico, J. F. Collawn, K. Varga, Z. Gao, J. P. Clancy, J. A. Fortenberry, J. R. Lancaster Jr., and S. Matalon
DETANO and Nitrated Lipids Increase Chloride Secretion across Lung Airway Cells
Am. J. Respir. Cell Mol. Biol., August 1, 2008; 39(2): 150 - 162.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. F. Bove, M. Hristova, U. V. Wesley, N. Olson, K. M. Lounsbury, and A. van der Vliet
Inflammatory Levels of Nitric Oxide Inhibit Airway Epithelial Cell Migration by Inhibition of the Kinase ERK1/2 and Activation of Hypoxia-inducible Factor-1{alpha}
J. Biol. Chem., June 27, 2008; 283(26): 17919 - 17928.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
H. O'Brodovich, P. Yang, S. Gandhi, and G. Otulakowski
Amiloride-insensitive Na+ and fluid absorption in the mammalian distal lung
Am J Physiol Lung Cell Mol Physiol, March 1, 2008; 294(3): L401 - L408.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
L. Yu, H.-F. Bao, J. L. Self, D. C. Eaton, and M. N. Helms
Aldosterone-induced increases in superoxide production counters nitric oxide inhibition of epithelial Na channel activity in A6 distal nephron cells
Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1666 - F1677.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. M. Kaestle, C. A. Reich, N. Yin, H. Habazettl, J. Weimann, and W. M. Kuebler
Nitric oxide-dependent inhibition of alveolar fluid clearance in hydrostatic lung edema
Am J Physiol Lung Cell Mol Physiol, October 1, 2007; 293(4): L859 - L869.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
W. Song and S. Matalon
Modulation of alveolar fluid clearance by reactive oxygen-nitrogen intermediates
Am J Physiol Lung Cell Mol Physiol, October 1, 2007; 293(4): L855 - L858.
[Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
I. C. Davis, A. Xu, Z. Gao, J. M. Hickman-Davis, P. Factor, W. M. Sullender, and S. Matalon
Respiratory syncytial virus induces insensitivity to beta-adrenergic agonists in mouse lung epithelium in vivo
Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L281 - L289.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. Lindert, C. E. Perlman, K. Parthasarathi, and J. Bhattacharya
Chloride-Dependent Secretion of Alveolar Wall Liquid Determined by Optical-Sectioning Microscopy
Am. J. Respir. Cell Mol. Biol., June 1, 2007; 36(6): 688 - 696.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
P. F. Bove, U. V. Wesley, A.-K. Greul, M. Hristova, W. R. Dostmann, and A. van der Vliet
Nitric Oxide Promotes Airway Epithelial Wound Repair through Enhanced Activation of MMP-9
Am. J. Respir. Cell Mol. Biol., February 1, 2007; 36(2): 138 - 146.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Su, Q. Li, K. Shrestha, E. Cormet-Boyaka, L. Chen, P. R. Smith, E. J. Sorscher, D. J. Benos, S. Matalon, and H.-L. Ji
Interregulation of Proton-gated Na+ Channel 3 and Cystic Fibrosis Transmembrane Conductance Regulator
J. Biol. Chem., December 1, 2006; 281(48): 36960 - 36968.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
G. M. Mutlu, C. Snyder, A. Bellmeyer, H. Wang, K. Hawkins, S. Soberanes, L. C. Welch, A. J. Ghio, N. S. Chandel, D. Kamp, et al.
Airborne Particulate Matter Inhibits Alveolar Fluid Reabsorption in Mice via Oxidant Generation
Am. J. Respir. Cell Mol. Biol., June 1, 2006; 34(6): 670 - 676.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. N. Helms, X.-J. Chen, S. Ramosevac, D. C. Eaton, and L. Jain
Dopamine regulation of amiloride-sensitive sodium channels in lung cells
Am J Physiol Lung Cell Mol Physiol, April 1, 2006; 290(4): L710 - L722.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. D. Johnson, H.-F. Bao, M. N. Helms, X.-J. Chen, Z. Tigue, L. Jain, L. G. Dobbs, and D. C. Eaton
Functional ion channels in pulmonary alveolar type I cells support a role for type I cells in lung ion transport
PNAS, March 28, 2006; 103(13): 4964 - 4969.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-L. Ji, X.-F. Su, S. Kedar, J. Li, P. Barbry, P. R. Smith, S. Matalon, and D. J. Benos
{delta}-Subunit Confers Novel Biophysical Features to {alpha}beta{gamma}-Human Epithelial Sodium Channel (ENaC) via a Physical Interaction
J. Biol. Chem., March 24, 2006; 281(12): 8233 - 8241.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
I. C. Davis, E. R. Lazarowski, J. M. Hickman-Davis, J. A. Fortenberry, F.-P. Chen, X. Zhao, E. Sorscher, L. M. Graves, W. M. Sullender, and S. Matalon
Leflunomide Prevents Alveolar Fluid Clearance Inhibition by Respiratory Syncytial Virus
Am. J. Respir. Crit. Care Med., March 15, 2006; 173(6): 673 - 682.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
J. M. Hickman-Davis, C. McNicholas-Bevensee, I. C. Davis, H.-P. Ma, G. C. Davis, C. A. Bosworth, and S. Matalon
Reactive Species Mediate Inhibition of Alveolar Type II Sodium Transport during Mycoplasma Infection
Am. J. Respir. Crit. Care Med., February 1, 2006; 173(3): 334 - 344.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
C. M. St. Croix, K. Leelavaninchkul, S. C. Watkins, V. E. Kagan, and B. R. Pitt
Nitric Oxide and Zinc Homeostasis in Acute Lung Injury
Proceedings of the ATS, October 1, 2005; 2(3): 236 - 242.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. N. Helms, L. Yu, B. Malik, D. J. Kleinhenz, C. M. Hart, and D. C. Eaton
Role of SGK1 in nitric oxide inhibition of ENaC in Na+-transporting epithelia
Am J Physiol Cell Physiol, September 1, 2005; 289(3): C717 - C726.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
V. Swystun, L. Chen, P. Factor, B. Siroky, P. D. Bell, and S. Matalon
Apical trypsin increases ion transport and resistance by a phospholipase C-dependent rise of Ca2+
Am J Physiol Lung Cell Mol Physiol, May 1, 2005; 288(5): L820 - L830.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-0325OCv1
30/5/720    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hardiman, K. M.
Right arrow Articles by Matalon, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hardiman, K. M.
Right arrow Articles by Matalon, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2004 American Thoracic Society.