Published ahead of print on January 23, 2004, doi:10.1165/rcmb.2003-0406OC
American Journal of Respiratory Cell and Molecular Biology. Vol. 30, pp. 901-907, 2004
© 2004 American Thoracic Society DOI: 10.1165/rcmb.2003-0406OC
Keratinocyte Growth Factor Stimulates Alveolar Type II Cell Proliferation through the Extracellular SignalRegulated Kinase and Phosphatidylinositol 3-OH Kinase Pathways
Joshua Portnoy,
Douglas Curran-Everett and
Robert J. Mason
Department of Medicine and Division of Biostatistics, National Jewish Medical and Research Center, Denver; Pulmonary Division, Department of Medicine, and Department of Preventive Medicine and Biometrics and of Physiology and Biophysics, University of Colorado Health Sciences Center; Denver, Colorado
Address correspondence to: Joshua Portnoy, National Jewish Hospital, 1400 Jackson St., Denver, CO 80206. E-mail: portnoyj{at}njc.org
 |
Abstract
|
|---|
Keratinocyte growth factor (KGF or FGF-7) stimulates alveolar type II cell proliferation, but little is known about the signaling pathways involved. We investigated the role of the ERK (p42/44 mitogen activated protein [MAP] kinase) and phosphatidylinositol 3-OH kinase (PI3 kinase) pathways on alveolar type II cell proliferation and differentiation. Rat type II cells were cultured on tissue culture plastic and Matrigel in the presence or absence of KGF and specific chemical inhibitors PD98059, LY294002, and rapamycin at various concentrations. Proliferation was measured by thymidine incorporation and DNA quantitation, and differentiation was measured by expression of surfactant protein A and alkaline phosphatase. We demonstrate that KGF activates distal effectors of the PI3 kinase pathway, PKB/Akt, and p70S6 kinase, as well as p42/44 MAP kinase proteins. Inhibition of these pathways with PD98059, LY294002, or rapamycin inhibited type II cell proliferation but had no significant effect on differentiation. KGF did not activate the c-Jun kinase or p38 MAP kinase pathways. We conclude that the p42/44 MAP kinase and PI3 kinase pathways are important in regulating alveolar type II cell proliferation in response to KGF.
Abbreviations: alkaline phosphatase, ALP alveolar type II, ATII 1% charcoal-stripped FBS, D1CSFBS Dulbecco's modified Eagle's medium, DMEM dimethyl sulfoxide, DMSO fetal bovine serum, FBS c-Jun kinase, JNK keratinocyte growth factor, KGF mitogen-activated protein kinase or ERK, P42/44 MAP kinase p70S6 kinase, p70S6K phosphate-buffered saline, PBS polymerase chain reaction, PCR phosphatidylinositol 3-OH kinase, PI3 kinase protein kinase B/Akt, PKB/Akt surfactant protein A, SP-A
 |
Introduction
|
|---|
Alveolar type II (ATII) cell hyperplasia is a prominent feature associated with virtually all kinds of lung injury and is an essential element of lung repair (1). ATII cells are responsible for proliferation and repopulation of the alveolar surface after injury. Following injury, hyperplastic type II cells exhibit enhanced expression and secretion of proteases, cytokines, and growth factors. These interact with surrounding cells and regulate extracellular matrix remodeling (2). Hyperplastic type II cells maintain a differentiated phenotype distinguished by expression of surfactant proteins, distinct cell surface markers, and the presence of lamellar bodies, the storage granules for pulmonary surfactant (3, 4). The type II cell phenotype is an important determinant regulating repair activity (5). Secreted products of alveolar epithelial cells inhibit fibroblast proliferation and collagen synthesis (6). These effects are enhanced by keratinocyte growth factor (KGF) in epithelial-fibroblast cocultures (7). Animal studies have demonstrated that delayed or incomplete epithelial cell regeneration of a damaged alveolocapillary barrier results in more extensive alveolar fibrosis (8). The severity of epithelial cell damage was strongly correlated with collagen deposition independent of the extent of inflammation (1). Identifying the pathways involved in regulating proliferation of differentiated type II cells would improve our understanding of lung repair and provide targets of interest for optimizing recovery after lung injury.
KGF (FGF-7) is a member of the fibroblast growth factor (FGF) family. It is distinguished by a unique ability to induce proliferation in vitro and in vivo and differentiation of type II cells in vitro (9, 10). Furthermore, when KGF is administered prophylactically, it protects the lung against a variety of injuries including hyperoxia, bleomycin, radiation, acid instillation, and marrow transplantation (1114). KGF signaling has been most extensively studied in skin and corneal models of wound repair. In corneal epithelial cells and in skin wounds, KGF has been shown to activate the Ras-MAPK/ERK (p42/44 mitogen-activated protein [MAP] kinase) pathway but not the protein kinase C or JAK-STAT pathways (15). KGF also activates phosphatidylinositol 3-OH kinase (PI3) kinase and its downstream target p70S6 kinase in corneal epithelial cells and inhibition of these pathways inhibited corneal epithelial cell wound repair (16). It has recently been demonstrated that KGF activates Akt in A549 and primary small airway epithelial cells (17). Inhibition of KGF-induced Akt activation blocked the protective effect of KGF on hyperoxic lung injury (17). Lu and colleagues have also demonstrated that the distal effector PAK-4 is one pathway through which KGF protects against epithelial cell apoptosis (18).
To our knowledge, previous studies of KGF signaling in the lung have been performed on cell lines and airway epithelial cells, but signaling pathways in primary ATII cells has not been reported. For this reason, we attempted to identify the KGF signaling pathways involved in ATII cell proliferation and differentiation. Rat ATII cells were selected for these experiments to maintain consistency with our initial studies on KGF-induced proliferation and differentiation in vitro and in vivo (9, 10). The goals of this study were to (i) define pathways activated by KGF in primary rat ATII cells, and (ii) to determine whether these pathways were involved in ATII cell proliferation and differentiation. We hypothesized that KGF induces type II cell proliferation and differentiation through the p42/44 (ERK) and PI3K signaling pathways.
We specifically focused on the PI3 kinase pathway and its distal effectors for these studies. Adenovirus transfer of constitutively active Akt (a downstream target of PI3K) has been shown to mediate an in vivo protective effect in mice against oxidant-induced lung injury (19). Furthermore, the protective effect of KGF on inhibiting apoptosis has been shown to be mediated via PKB/Akt. We aimed to prove that similar pathways are involved in the proliferation of primary differentiated ATII cells.
 |
Materials and Methods
|
|---|
Type II Cell Isolation and Culture
ATII cells were isolated from the lungs of adult male Sprague-Dawley rats weighing 175280 g (Harlan Sprague Dawley, Indianapolis, IN) by dissociation with porcine pancreatic elastase (Worthington Biochemicals, Freehold, NJ). This was followed by centrifugation over a discontinuous metrizamide gradient as previously described (20). The day of plating was considered Day 0 of culture. Type II cells were resuspended in Dulbecco's modified Eagle's medium (DMEM; GIBCO-BRL, Gaithersburg, MD) containing 10% fetal bovine serum (D10FBS; Irvine Scientific, Santa Ana, CA). The D10FBS was initially supplemented with vancomycin 100 µg/ml, gentamicin 40 µg/ml, and amphotericin B 2.5 µg/ml on the day of plating. On Day 1 of culture, the medium was changed to DMEM supplemented with 2 mM glutamine, 100 U/ml penicillin G, 100 µg/ml streptomycin, 10 µg/ml gentamicin, and 2.5 µg/ml amphotericin B (Sigma Chemical, St. Louis, MO). Serum concentration varied depending on the assay as described below. KGF was used at a concentration of 30 ng/ml, based on initial Western blot dose response studies defining the greatest response in ERK and Akt activation.
Antibodies and Inhibitors
For Western blotting, commercially available polyclonal antibodies to both the phosphospecific and total forms of p42/44 MAP kinase, PKB/Akt, and P70S6K proteins were obtained from Cell Signaling Technology (Beverly, MA) and used at the recommended dilutions. LY294002 and rapamycin, chemical inhibitors of PI3 kinase and p70S6K, respectively, were purchased from Cell Signaling Technology, whereas PD98059, a chemical inhibitor of p42/44 MAP kinase kinase (MEK), was purchased from Calbiochem (San Diego, CA). All inhibitors were dissolved in DMSO and diluted to a final DMSO concentration of 0.1% in the culture media.
Western Blotting/Akt Activity Assay
To study early signaling events, ATII cells were plated in 2 ml of DMEM containing 10% fetal bovine serum (FBS) onto 35-mm dishes at a density of 5 x 106 cells per 9.6 cm2 (Costar Corp., Cambridge, MA). The cells were allowed to attach for 24 h and then gently rinsed with serum-free DMEM to remove nonadherent cells. The D10FBS medium was replaced with DMEM containing 0.5% FBS (D0.5FBS) to minimize basal activity of signaling pathways. Following a 48-h incubation in D0.5FBS, KGF (30 ng/ml) was added to each well and incubated for preset intervals. At these time points, cells were removed from the 37°C incubator, placed immediately on ice, washed twice in cold phosphate-buffered saline (PBS), and lysed in 300 µl of 1% NP-40 lysis buffer per 35-mm dish. The NP-40 lysis buffer contained 1% NP-40 detergent, 10 mM TRIS base, and 150 mM NaCl adjusted to a pH of 7.5. Protease (BD PharMingen, San Diego, CA) and phosphatase inhibitor cocktails (Sigma) were added to the lysis buffer to a 1x final concentration. The protease inhibitor (50x) cocktail contained 800 µg/ml benzamindine HCl, 500 µg/ml phenanthroline, 500 µg/ml aprotinin, 500 µg/ml leupeptin, 500 µg/ml pepstatin A, and 50 mM PMSF. The 100x phosphatase inhibitor cocktail 2 (Sigma) contained sodium orthovanadate, sodium molybdate, sodium tartrate, and imidazole. Protein quantitation (BCA assay) was performed on an aliquot of the supernatant. The remaining supernatant was diluted in 4x Laemmli buffer and used for Western blotting with phosphospecific antibodies.
Equal loading of protein was ascertained by normalizing quantities to nonphosphorylated P42/44 and Akt, respectively. Phosphospecific and total antibodies to p42/44 MAP kinase, Akt, and p70S6 kinase proteins were used for Western blotting (Cell Signaling Technology) using the provided protocols. RIPA detergent was used in place of NP-40 detergent for preparation of P38 and JNK lysates allowing study of translocated nuclear proteins as well as cytoplasmic proteins (21). The RIPA buffer contained 10 mM TRIS-HCl, 50 mM NaCl, 0.5% Na deoxycholate, 0.2% SDS, and 1% NP-40. Protease (BD PharMingen) and phosphatase inhibitor (Sigma) cocktails were added to the lysis buffer as described above.
Immunoprecipitation of total Akt was performed on 50 µg of the NP-40 lysates and Akt activity quantified by phosphorylation of GSK-3 /ß fusion protein, a substrate of activated Akt. These experiments were performed using an activity assay kit purchased from Cell Signaling Technology as described in the manufacturer's protocols.
[H3]Thymidine Incorporation Assays
Type II cells were seeded at a density of 1 x 105 cells/well in 0.5 ml DMEM containing 10% FBS onto uncoated 48-well tissue culture plates (Costar Corp.). The cells were maintained at 37°C in a humidified incubator containing 10% CO290% air. The cells were allowed to attach for 24 h and then gently rinsed with serum-free DMEM to remove nonadherent cells. The cells were cultured in D10FBS and for conditions containing inhibitor were preincubated for 1 h with either PD98059 (150 ng/ml), or LY294002 (110 ng/ml). KGF (30 ng/ml), and 1 µCi/ml of tritiated thymidine were then added to individual wells. Wells containing no KGF or inhibitor served as negative controls. DMSO was maintained constant in all wells at a concentration of 0.16% for PD98059 conditions and 0.1% for LY294002 conditions. After a 48-h period of thymidine incorporation, cells were washed with cold PBS, precipitated with 10% trichloroacetic acid (TCA), and counted by liquid scintillation as described previously (22).
DNA Assays
Type II cells were seeded at a concentration of 5 x 106 cells/well in 2 ml D10FBS onto 6-well tissue culture plates (Costar Corp.) that contained 1 ml of Matrigel (23) (BD Biosciences). The day of plating was considered Day 0 of culture. On Day 1 of culture, the wells were washed three times at 30 min intervals and then the medium was changed to DMEM supplemented with 1% charcoal-stripped FBS (D1CSFBS; Irvine Scientific, Santa Ana, CA). The cells were then cultured in the presence of either PD98059 (150 ng/ml), LY294002 (110 ng/ml), or rapamycin (0.001100 nM). Following a 1-h preincubation with one of the above inhibitors, 30 ng/ml KGF was added. Wells containing no KGF or inhibitor served as negative controls, whereas wells containing KGF alone served as a positive control. DMSO was maintained constant in all wells with the exception of a vehicle control that contained no DMSO. Cells were cultured for an additional 4 d with the media changed every 48 h. On Day 5 of culture, the cells were washed twice in cold PBS and harvested with Matrisperse (Becton Dickinson Labware, Bedford, MA) Cells were pelleted by centrifugation (1,000 RPM x 10 min), resuspended in an assay buffer (containing 10 mM NaH2PO4, 40 mM Na2HPO4, 2M NaCl, 2 mM EDTA), sonicated, and quantitated by fluorimetry as previously described (24).
Isolation of RNA and Reverse TranscriptasePolymerase Chain Reaction
To evaluate mRNA levels of surfactant protein A and alkaline phosphatase, type II cells were plated at a density of 5 x 106 cells on 1 ml Matrigel per well on 6-well plates (Costar Corp.) in 2 ml D10FBS. The day of plating was considered Day 0 of culture. On Day 1 of culture, the cells were washed gently three times with DMEM at 30-min intervals to remove as much serum from the gel as possible. After the final wash, the media was changed to DMEM supplemented with D1CSFBS. The cells were then incubated for 72 h. On Day 4 of culture, PD98059 (150 ng/ml) or LY294002 (110 ng/ml) was added. Following a 1-h incubation in the presence of inhibitor, KGF (30 ng/ml) was added to each well. Wells containing no KGF or inhibitor served as negative controls, whereas wells containing KGF alone served as a positive control. DMSO was maintained constant in all wells with the exception of a single well containing no DMSO that served as a negative control. Following a 24-h incubation, type II cells on the gel were lysed directly into 4 M guanidium isothiocyanate, 0.5% N-laurylsarcosine, and 0.1 M 2-mercaptoethanol in 25 mM sodium citrate buffer. Total cellular RNA was isolated by ultracentrifugation for 18 h at 150,000 x g through a 5.7-M CsCl cushion as previously described (4). Isolated RNA samples were treated with 4 U of RNase-free DNase I (Promega, Madison, WI) for 30 min at 37°C to remove any genomic DNA contamination.
Real-Time Polymerase Chain Reaction
Total RNA (2 µg) was used to synthesize cDNA with TaqMan Reverse transcription reagents kit (Applied Biosystems, Branchburg, NJ) in a final volume of 100 µl, according to the manufacturer's instructions. Random hexamers were used as primers in the reverse transcription reaction. Preparations were incubated at 25°C for 10 min, at 48°C for 30 min, and then at 95°C for 5 min, and then stored at 20°C until ready for use. The cDNA was diluted 1:100 with water, and 20 µl of the diluted cDNA was amplified in 50 µl of polymerase chain reaction (PCR) mix (PE Biosystems).
Primers and probes for real-time PCR for rat surfactant protein A (SP-A) and rat alkaline phosphatase were designed using Primers express 1.5a software (Applied Biosystems). Accession nos. A1682716 (rat SP-A) and X16038 (rat alkaline phosphatase) were selected from Genbank (NHLBI) and used as cDNA templates for primer and probe design. For rat SP-A, CACCAATGGGCAGTCAGTCA sequence and CCTCGGGACAGCAATGTTG were selected for the forward and reverse primers respectively. The intervening sequence CTCCTGTGGTACACATCTCTTTAATGGTATCAA was used for probe design. Rat alkaline phosphatase sequences CGAGCAGGAACAGAACTTTGC and GCCAAAAGGCAGTGAATAGAGAA were used for designing forward and reverse primers, respectively. The intervening sequence AGCCAGGAATCCGACCCACGGAG was used in constructing the alkaline phosphatase probe. FAM fluorescent dye was used as a reporter for SP-A and alkaline phosphatase gene expression, whereas VIC was used as a reporter for the GAPDH reference.
Samples were run in triplicate. Each 50-µl PCR reaction contained 20 µl of the relevant cDNA, 100 nM of each primer, 200 nM of probe, 200 µM of each dATP, dCTP, and dGTP, 400 µM of dUTP, 0.5 U of AmpErase UNG, 0.25 U of AmpliTaq Polymerase, 5.5 mM MgCl2, and 1x TaqMan Buffer A. The thermal cycling program consisted of 50°C for 2 min (UNG digestion), 95°C for 10 min (AmpliTaq polymerase activation), and then 40 cycles of denaturation (95°C for 15 s), and finally 60°C for 1 min (anneal/extending). The reactions were quantitated by selecting the amplification cycle when the PCR product of interest was first detected (the threshold cycle [25]). Data were analyzed with the comparative CT method by using arithmetic formulas to achieve the results for relative quantitation. The relative amount of target, normalized to an endogenous reference (rodent GAPDH rRNA) and compared with the unstimulated state as a calibrator, is expressed by: 2 Ct ( CT = CT,q CT,cb), where CT,q is the sample of interest and CT,cb is the unstimulated sample (calibrator) normalized to the endogenous GAPDH reference.
Statistical Analyses
We evaluated inhibitor-related changes in thymidine incorporation, cellular proliferation (DNA/well), SP-A, and alkaline phosphatase by one-way ANOVA after a log transformation to stabilize the variances (26). We compared responses among specific combinations of inhibitor and concentration using contrasts and two-sample t tests (26). We controlled for multiple comparisons using the false discovery rate procedure (27). In each analysis, we considered achieved significance levels (P) < 0.05 to be statistically significant. Where appropriate, additional analyses are referenced in RESULTS.
 |
Results
|
|---|
KGF Activates ERK and Akt
When cultured on tissue culture plastic, KGF stimulated P42/44 MAP kinase activation as demonstrated by protein phosphorylation. Peak activation occurred within 515 min of exposure (Figure 1). We also studied phosphorylation of the PKB/Akt protein, a distal effector of the PI3 kinase signaling pathway. Phosphorylation of PKB/Akt occurred later between 15 and 45 min of exposure (Figures 2A and 2B). This time course is in keeping with previously reported P42/44 activation in response to KGF (15) and was consistently replicated (n = 4). Activation of PKB/Akt by hepatocyte growth factor (HGF), human and mouse insulin-like growth factor (h-IGF and m-IGF), insulin, and platelet-derived growth factor yielded similar PKB/Akt phosphorylation within 30 min. Akt phosphorylation correlated with activity as demonstrated by phosphorylation of substrate GSK-3 /ß by immunoprecipitated Akt at 4560 min after exposure to KGF (Figure 2C). In addition, KGF stimulation resulted in the phosphorylation of p70S6 kinase, another distal effector of the PI3 kinase signaling pathway (Figure 3).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 1. KGF activates p42/44 MAP kinase protein. Western blot analysis of p42/44 MAP kinase protein in rat ATII cells cultured on tissue culture plastic in D0.5% serum for 48 h and exposed to KGF (30 ng/ml) for different time intervals. Phosphorylated p42/44 MAP kinase protein is depicted in A and total p42/44 MAP kinase protein is depicted in B. Lane 1 represents 5 µg of fully phosphorylated ERK2 (p42) control protein (New England Biolabs, Beverly, MA). Lane 2 represents unstimulated cells harvested at 5 min after manipulation, and lane 3 represents unstimulated cells harvested at 30 min. Lane 4 represents ATII cells exposed to shortwave ultraviolet light (254 nm) for 30 min, and lane 5 represents cells exposed to hypertonic saline (900 mOsm) for 30 min. Lanes 611 represent a time course of ATII cells exposed to KGF (30 ng/ml). Cells were harvested 5 min (lane 6), 15 min (lane 7), 30 min (lane 8), 45 min (lane 9), 60 min (lane 10), and 90 min (lane 11) after KGF exposure. This is representative of four independent experiments.
|
|

View larger version (58K):
[in this window]
[in a new window]
|
Figure 2. KGF activates PKB/Akt protein. Western blot analysis of PKB/Akt (60 kD) protein in rat ATII cells cultured on tissue culture plastic in D0.5% serum for 48 h and exposed to KGF (30 ng/ml) for different time intervals. Phosphorylated PKB/Akt protein is depicted in the upper panel and total PKB/Akt protein is depicted in the lower panel. (A) Lane 1 represents unstimulated cells harvested at 5 min, lane 2 represents cells exposed to hepatocyte growth factor (HGF; 10 ng/ml) for 30 min. Lane 3 represents cells exposed to human insulin-like growth factor (h-IGF; 200ng/ml) for 30 min. Lane 4 represents cells exposed to murine insulin-like growth factor (m-IGF; 200 ng/ml) for 30 min. Lane 5 represents cells exposed to insulin (100 ng/ml) for 30 min. Lane 6 represents cells exposed to platelet derived growth factor (PDGF AB; 100 ng/ml) for 15 min. Lanes 79 represent cells exposed to KGF (30 ng/ml) and harvested at various time intervals (30 s, 5 min, and 15 min), respectively. (B) Western blot analysis of PKB/Akt (60 kD) protein in rat ATII cells cultured on tissue culture plastic in D0.5% serum for 48 h. Cells were exposed to KGF (30 ng/ml) and harvested at different time intervals. Lane 10 represents unstimulated cells harvested 5 min after manipulation. Lanes 1116 represent cells exposed to KGF 30 ng/ml and harvested at 5, 15, 30, 45, 60, and 90 min, respectively. (C) Akt activity measured by phosphorylation of GSK-3 /ß substrate by immunoprecipitated total Akt. Lane 1, unstimulated 15 min; lane 2, unstimulated 30 min; lane 3, KGF 30 ng/ml at 15 min; lane 4, KGF 30 ng/ml at 30 min; lane 5, KGF 30 ng/ml at 45 min; lane 6, KGF 30 ng/ml at 60 min; lane 7, KGF 30 ng/ml at 90 min. This is representative of four independent experiments.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Figure 3. KGF activates p70S6K. Western blot analysis of p70S6K (70 kD) protein in rat ATII cells cultured on tissue culture plastic in D0.5% serum for 48 h and exposed to KGF (30 ng/ml) for different time intervals. Phosphorylated p70S6K protein is depicted in the upper panel and total p70S6K protein in the lower panel. Lane 1, unstimulated negative control (5 min incubation); lane 2, unstimulated negative control (30 min incubation); lane 3, anisomycin 25 µg/ml (30 min); lane 4, KGF 5 min; lane 5, KGF 15 min; lane 6, KGF 30 min; lane 7, KGF 45 min; lane 8, KGF 60 min; lane 9, KGF 90 min. This is representative of four independent experiments.
|
|
Inhibition of PI3 Kinase or ERK Inhibits ATII Cell Proliferation
Proliferation of ATII cells was measured by thymidine incorporation and quantitation of DNA (28, 29). Concordant with previous observations, KGF stimulation resulted in a 2-fold increase in thymidine incorporation compared with the unstimulated state (30) (Figure 4). These effects were inhibited by the MEK (MAP kinase kinase) inhibitor PD98059 in a doseresponse fashion (P < 0.0001) (Figure 4). When compared with the control condition (no PD98059), PD98059 (50 µM) resulted in a 61% reduction in thymidine incorporation in cells not exposed to KGF. Similarly, thymidine incorporation was diminished up to 70% by PD98059 (50 µM) in cells exposed to KGF. These effects were observed in a doseresponse fashion (Figure 4) (P < 0.0001). Similarly, LY294002, a specific PI3 kinase inhibitor, reduced thymidine incorporation up to 78% in the unstimulated condition and by 86% in the KGF-stimulated group (Figure 5).

View larger version (32K):
[in this window]
[in a new window]
|
Figure 4. PD98059 inhibits KGF-induced ATII cell thymidine incorporation. Type II cells were cultured for 48 h in 10% FBS on tissue culture plastic in the presence or absence of PD98059 at various concentrations and then thymidine incorporation was measured. The above figure represents the results of six independent experiments. DMSO was held constant in all conditions with the exception of the unstimulated state that contained no vehicle control (DMSO). KGF induced a 2- to 2.5-fold increase in thymidine incorporation compared with the unstimulated state. A dose-dependent inhibition of thymidine incorporation was seen in both the KGF and unstimulated conditions when exposed to PD98059 (P < 0.0001). PD98059 30 and 50 µM significantly reduced thymidine incorporation in ATII cells cultured in the absence of KGF (**P < 0.0001; lightly shaded bars). In the presence of KGF (darkly shaded bars), PD98059 at concentrations of 350 µM significantly inhibited thymidine incorporation in ATII cells compared with the control (*P < 0.0004). These comparisons were significant after controlling for multiple comparisons using false discovery rate.
|
|

View larger version (26K):
[in this window]
[in a new window]
|
Figure 5. LY294002 inhibits KGF-induced ATII cell thymidine incorporation. Type II cells were cultured for 48 h in 10% FBS on tissue culture plastic in the presence or absence of LY294002 at various concentrations and then thymidine incorporation was measured. The above figure represents the results of six independent experiments. DMSO was held constant in all conditions and compared with vehicle control wells (with and without KGF) that contained no DMSO. KGF induced a 2-fold increase in proliferation compared with the unstimulated state. A dose-dependent inhibition of thymidine incorporation was seen in both the KGF (darkly shaded bars) and unstimulated (lightly shaded bars) conditions when exposed to LY294002 (3 and 10 µM) compared with that of the control (with [*] or without [**] KGF, P < 0.0001). These comparisons were significant after controlling for multiple comparisons using false discovery rate.
|
|
To complement studies on thymidine incorporation, we also measured the effect of these inhibitors on proliferation as measured by DNA per well (24). Quantifying DNA allows a direct measure of proliferation without the inherent limitations of thymidine incorporation assays. In addition, we were interested in evaluating the effect of MEK, PI3 kinase, and p70S6K inhibitors on the proliferation of more differentiated ATII cells. For this reason, ATII cells were cultured on Matrigel (BD Biosciences) in the presence of KGF.
Under these conditions studied (96 h of KGF exposure and cultured on Matrigel), there was a 5-fold increase in DNA per well compared with the unstimulated state (Figure 6). This effect was associated with a 60% decrease in proliferation (DNA/well) at higher doses of PD98059 (30 and 50 µM) (P = 0.0006) and LY294002 at of 3 and 10 µM (P < 0.0001). These doses were selected by selecting the dose on doseresponse curve testing whereby proliferation was inhibited significantly. Doses of PD98059 < 30 µM or LY294002 < 3 uM showed no significant inhibition (not shown). Combining chemical inhibitors (PD98059 30 µM and LY294002 at 10 µM) was associated with significant cell toxicity and was not pursued further (data not shown). Rapamycin at doses > 1 nM inhibited KGF induced proliferation (DNA/well) by 26% (P = 0.03; nonparametric test for simple order of means [31])(Figure 6B).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 6. (A) PD98059 and LY294002 inhibit ATII cell proliferation as measured by DNA/well. ATII cells were cultured for 5 d on Matrigel in D10FBS in the presence or absence of KGF and/or PD98059 or LY294002 inhibitors at various concentrations. On Day 5 of culture, cells were harvested with Matrisperse, and DNA quantified by DNA assay. In this culture system, KGF induced a 5-fold increase in DNA/well. Compared with the control (lane 3: ATII cells cultured in D10FBS in the presence of KGF [30 ng/ml] and DMSO 0.1%), DNA (µg/well) was reduced by both PD98059 (P = 0.0006) and LY294002 (P < 0.0001) (30 µM and 3 µM, respectively). These comparisons were significant after controlling for multiple comparisons using false discovery rate. (B) Rapamycin inhibits ATII cell proliferation as measured by DNA/well ATII cells were cultured for 5 d on Matrigel in D5RS in the presence or absence of KGF and/or rapamycin at various concentrations. On Day 5 of culture, cells were harvested with Matrisperse, and DNA quantified by DNA assay. In this culture system, rapamycin inhibited proliferation by up to 26% in a doseresponse fashion. P = 0.03 as demonstrated by nonparametric test for simple order of means.
|
|
Inhibition of PI3 Kinase or ERK Has No Significant Effect on ATII Cell Differentiation
When compared with the unstimulated state, a significant (10-fold) increase in gene expression of SP-A and alkaline phosphatase (ALP) was seen when ATII cells were stimulated by KGF (30 ng/ml) on Matrigel in the presence of D1CSFBS (P < 0.0001). Gene expression of the differentiation markers, SP-A and ALP, were normalized to GAPDH expression to assure equal loading of cDNA between samples. Although inhibitors of the PI3 kinase or ERK pathways with specific chemical inhibitors LY294002 and PD98059 inhibited ATII cell proliferation, no effect of these inhibitors was observed on SP-A (0.29 P 0.72) or alkaline phosphatase (0.31 P 0.82) mRNA levels (Figures 7 and 8).

View larger version (27K):
[in this window]
[in a new window]
|
Figure 7. PD98059 and LY294002 inhibition does not significantly alter SP-A mRNA expression. Cells were plated in 10% FBS and then cultured in D1CSFBS for 72 h. On Day 4 of culture, cells were pretreated with PD98059 or LY294002 inhibitor at various concentrations prior to the addition of KGF (30 ng/ml). Real-time PCR was used on purified RNA to quantify rat SP-A gene expression. The figure demonstrates the combined results of eight separate experiments. Compared with the unstimulated state, KGF induced a significant fold increase in SP-A gene expression when normalized to GAPDH (P < 0.0001). No significant inhibition was seen at the highest doses of LY294002 or PD98059. P = 0.74.
|
|

View larger version (30K):
[in this window]
[in a new window]
|
Figure 8. PD98059 and LY294002 inhibition does not significantly alter alkaline phosphatase mRNA expression. Cells were plated in 10% FBS and then cultured in D1CSFBS for 72 h. On Day 4 of culture, cells were pretreated with PD98059 or LY294002 inhibitor at various concentrations before the addition of KGF (30 ng/ml). Real-time PCR was used on purified RNA to quantify rat alkaline phosphatase gene expression. The figure demonstrates the results of five separate experiments. Compared with the unstimulated state, KGF induced a significant fold increase in ALP gene expression when normalized to GAPDH (P < 0.0001). No significant inhibition was seen at the highest doses of LY294002 or PD98059. P = 0.74.
|
|
 |
Discussion
|
|---|
Hyperplasia of differentiated alveolar type II cells is a prominent feature of virtually all forms of lung injury (32). The hyperplastic type II cells serve as progenitor cells that regenerate and restore the alveolar epithelium following injury (2, 33). It is clear that restoration of the denuded alveolar surface area is critical for healthy lung repair. However, the signaling pathways governing this process are poorly understood. Understanding the signaling pathways that regulate alveolar epithelial cell proliferation and differentiation would provide a great deal of insight into lung repair and would identify potential therapeutic targets in the treatment of fibrotic lung disease.
Traditionally, growth and differentiation have been considered mutually exclusive processes in developing tissues. It is not clear, however, whether these processes are mutually exclusive in healing lung epithelium. This study focused on the role of KGF in lung repair. KGF is unique in its ability to prevent various forms of lung injury, when it is administered prophylactically (1113). Furthermore, KGF is not only a potent mitogen, but in contrast to other growth factors, is a potent inducer of alveolar type II cell differentiation (9, 10, 34). Although the mechanism of KGF's protective effect is unknown, it has been speculated that this dual potential in regulating both proliferation and differentiation is important in modulating alveolar epithelial repair. Our study indicates that signaling pathways of KGF-stimulated proliferation are distinct from those of differentiation in ATII cells.
The MAP kinase and PI3 kinase pathways are critical pathways involved in the proliferation and differentiation of many cell types (3538). ERK activation has been demonstrated in proliferating ATII cells (38). In addition, ERK signaling pathways have been shown to be involved in FGF-10 protection against alveolar epithelial cell mechanical stretch injury and FGF-2mediated inhibition of epithelial cell apoptosis (39, 40). ERK signaling has also been shown to regulate fetal type II cell differentiation. The PI3 kinase pathway is of particular interest, as its distal effector, PKB/Akt, has been implicated in both lipogenesis pathways (41, 42) (required for surfactant synthesis) and protecting against lung injury (17, 19). Furthermore, p70S6 kinase, a distal effector of PI3 kinase is hyperphosphorylated in lymphangioleiomyomatosis and is believed to one mechanism for the abnormal cell growth seen in that disease (43). Given our interest in defining proliferation and differentiation pathways of ATII cells, these signaling proteins were targeted in our studies.
Our results indicate that both the MAP kinase and PI3 kinase pathways (through distal effectors Akt and p70S6K) are involved in ATII cell proliferation. Inhibition of these pathways inhibited ATII cell proliferation in cells cultured in vitro on both plastic and Matrigel. These pathways, however, do not appear to be critical in the differentiation pathways of ATII cells. Inhibition of PI3 kinase with LY294002 and of P42/44 MAP kinase with PD98059 resulted in no effect on the increase in SP-A and alkaline phosphatase mRNA levels in ATII cells exposed to KGF. Although no specific inhibitor is available to block the more distal PKB/Akt signaling protein, the fact that more proximal inhibition of PI3 kinase did not block the effects of KGF on ATII cell differentiation markers would make more distal effectors improbable targets.
Use of chemical inhibitors has the inherent limitations of specificity and toxicity. This is less of a problem with the differentiation studies where gene expression is normalized to constitutive genes (GAPDH) and relative levels in RNA expression are quantified. We concluded that the inhibitory effect on proliferation resulted from true inhibition rather than cell toxicity for several reasons. Inhibitor doses used in the above studies were comparable to those previously reported for studies in vitro (44, 45). In addition, no morphologic toxicity was apparent in cells exposed to these chemical inhibitors. Lastly, although the chemical inhibitors blocked basal thymidine incorporation, the incorporation in cells exposed to KGF remained significantly higher than the unstimulated state even at higher doses of ERK and PI3K chemical inhibition. This suggested that the cells maintained the capability to respond to mitogenic stimuli.
It is possible that redundant pathways exist in the process of ATII cell differentiation and that the PI3 kinase and P42/44 MAP kinase pathways, although not the dominant pathways, may still be involved in a lesser fashion in the process of differentiation. In these studies, attempting to inhibit multiple pathways simultaneously resulted in significant toxicity. Alternative approaches employing concurrent infection with adenoviruses expressing dominant-negative mutants of Akt and ERK or alternatively using interference RNA technology would be options for future studies. Further study into the ERK and AKT pathways are required to elucidate the pathways involved in alveolar epithelial cell regeneration in the process of wound repair and to identify potential targets in the treatment of lung injury.
 |
Acknowledgments
|
|---|
The authors thank Dr. John Cambier, Ph.D., Sara Johnson, Larry Nielsen, Ph.D., and Karen Edeen for their expertise and assistance in these experiments. This work was supported in part by grants from the National Institutes of Health (HL-67671 and HL-071424-02).
Received in original form November 11, 2003
Received in final form December 29, 2003
 |
References
|
|---|
- Witschi, H. 1976. Proliferation of type II alveolar cells: a review of common responses in toxic lung injury. Toxicology 5:267277.[CrossRef][Medline]
- Kasper, M., and G. Haroske. 1996. Alterations in the alveolar epithelium after injury leading to pulmonary fibrosis. Histol. Histopathol. 11:463483.[Medline]
- Borok, Z., R. L. Lubman, S. I. Danto, X. L. Zhang, S. M. Zabski, L. S. King, D. M. Lee, P. Agre, and E. D. Crandall. 1998. Keratinocyte growth factor modulates alveolar epithelial cell phenotype in vitro: expression of aquaporin 5. Am. J. Respir. Cell Mol. Biol. 18:554561.[Abstract/Free Full Text]
- Shannon, J. M., P. A. Emrie, J. H. Fisher, Y. Kuroki, S. D. Jennings, and R. J. Mason. 1990. Effect of a reconstituted basement membrane on expression of surfactant apoproteins in cultured adult rat alveolar type II cells. Am. J. Respir. Cell Mol. Biol. 2:183192.
- Adamson, I. Y., and D. H. Bowden. 1974. The type 2 cell as progenitor of alveolar epithelial regeneration: a cytodynamic study in mice after exposure to oxygen. Lab. Invest. 30:3542.[Medline]
- Young, L., and I. Y. Adamson. 1993. Epithelial-fibroblast interactions in bleomycin-induced lung injury and repair. Environ. Health Perspect. 101:5661.[Medline]
- Pan, T., R. J. Mason, J. Y. Westcott, and J. M. Shannon. 2001. Rat alveolar type II cells inhibit lung fibroblast proliferation in vitro. Am. J. Respir. Cell Mol. Biol. 25:353361.[Abstract/Free Full Text]
- Haschek, W. M., and H. Witschi. 1979. Pulmonary fibrosis: a possible mechanism. Toxicol. Appl. Pharmacol. 51:475487.[CrossRef][Medline]
- Sugahara, K., J. S. Rubin, R. J. Mason, E. L. Aronsen, and J. M. Shannon. 1995. Keratinocyte growth factor increases mRNAs for SP-A and SP-B in adult rat alveolar type II cells in culture. Am. J. Physiol. 269:L344L350.
- Yano, T., R. J. Mason, T. Pan, R. R. Deterding, L. D. Nielsen, and J. M. Shannon. 2000. KGF regulates pulmonary epithelial proliferation and surfactant protein gene expression in the adult rat lung. Am. J. Physiol. Lung Cell. Mol. Physiol. 279:L1146L1158.[Abstract/Free Full Text]
- Deterding, R. R., A. M. Havill, T. Yano, S. C. Middleton, C. R. Jacoby, J. M. Shannon, W. S. Simonet, and R. J. Mason. 1997. Prevention of bleomycin-induced lung injury in rats by keratinocyte growth factor. Proc. Assoc. Am. Physicians 109:254268.[Medline]
- Yi, E. S., S. T. Williams, H. Lee, D. M. Malicki, E. M. Chin, S. Yin, J. Tarpley, and T. R. Ulich. 1996. Keratinocyte growth factor ameliorates radiation- and bleomycin-induced lung injury and mortality. Am. J. Pathol. 149:19631970.[Abstract]
- Yano, T., R. R. Deterding, W. S. Simonet, J. M. Shannon, and R. J. Mason. 1996. Keratinocyte growth factor reduces lung damage due to acid instillation in rats. Am. J. Respir. Cell Mol. Biol. 15:433442.[Abstract]
- Min, D., P. A. Taylor, A. Panoskaltsis-Mortari, B. Chung, D. M. Danilenko, C. Farrell, D. L. Lacey, B. R. Blazar, and K. I. Weinberg. 2002. Protection from thymic epithelial cell injury by keratinocyte growth factor: a new approach to improve thymic and peripheral T-cell reconstitution after bone marrow transplantation. Blood 99:45924600.[Abstract/Free Full Text]
- Liang, Q., R. R. Mohan, L. Chen, and S. E. Wilson. 1998. Signaling by HGF and KGF in corneal epithelial cells: Ras/MAP kinase and Jak-STAT pathways. Invest. Ophthalmol. Vis. Sci. 39:13291338.[Abstract/Free Full Text]
- Chandrasekher, G., A. H. Kakazu, and H. E. Bazan. 2001. HGF- and KGF-induced activation of PI-3K/p70 s6 kinase pathway in corneal epithelial cells: its relevance in wound healing. Exp. Eye Res. 73:191202.[CrossRef][Medline]
- Ray, P., Y. Devaux, D. B. Stolz, M. Yarlagadda, S. C. Watkins, Y. Lu, L. Chen, X. F. Yang, and A. Ray. 2003. Inducible expression of keratinocyte growth factor (KGF) in mice inhibits lung epithelial cell death induced by hyperoxia. Proc. Natl. Acad. Sci. USA 100:60986103.[Abstract/Free Full Text]
- Lu, Y., Z. Z. Pan, Y. Devaux, and P. Ray. 2003. p21-activated protein kinase 4 (PAK4) interacts with the keratinocyte growth factor receptor and participates in keratinocyte growth factor-mediated inhibition of oxidant-induced cell death. J. Biol. Chem. 278:1037410380.[Abstract/Free Full Text]
- Lu, Y., L. Parkyn, L. E. Otterbein, Y. Kureishi, K. Walsh, A. Ray, and P. Ray. 2001. Activated Akt protects the lung from oxidant-induced injury and delays death of mice. J. Exp. Med. 193:545549.[Abstract/Free Full Text]
- Dobbs, L. G. 1990. Isolation and culture of alveolar type II cells. Am. J. Physiol. 258:L134L147.
- Pfundt, R., I. van Vlijmen-Willems, M. Bergers, M. Wingens, W. Cloin, and J. Schalkwijk. 2001. In situ demonstration of phosphorylated c-jun and p38 MAP kinase in epidermal keratinocytes following ultraviolet B irradiation of human skin. J. Pathol. 193:248255.[CrossRef][Medline]
- Leslie, C. C., K. McCormick-Shannon, R. J. Mason, and J. M. Shannon. 1993. Proliferation of rat alveolar epithelial cells in low density primary culture. Am. J. Respir. Cell Mol. Biol. 9:6472.
- Shannon, J. M., R. J. Mason, and S. D. Jennings. 1987. Functional differentiation of alveolar type II epithelial cells in vitro: effects of cell shape, cell-matrix interactions and cell-cell interactions. Biochim. Biophys. Acta 931:143156.[Medline]
- Labarca, C., and K. Paigen. 1980. A simple, rapid, and sensitive DNA assay procedure. Anal. Biochem. 102:344352.[CrossRef][Medline]
- Aaronson, S. A., D. P. Bottaro, T. Miki, D. Ron, P. W. Finch, T. P. Fleming, J. Ahn, W. G. Taylor, and J. S. Rubin. 1991. Keratinocyte growth factor: a fibroblast growth factor family member with unusual target cell specificity. Ann. NY Acad. Sci. 638:6277.[Medline]
- Snedecor, G. W., and W. G. Cochran. 1980. Statistical Methods, 7th ed. Iowa State University Press, Ames, IA.
- Curran-Everett, D. 2000. Multiple comparisons: philosophies and illustrations. Am. J. Physiol. Regul. Integr. Comp. Physiol. 279:R1R8.
- Deterding, R. R., and J. M. Shannon. 1995. Proliferation and differentiation of fetal rat pulmonary epithelium in the absence of mesenchyme. J. Clin. Invest. 95:29632972.
- Sugahara, K., R. J. Mason, and J. M. Shannon. 1998. Effects of soluble factors and extracellular matrix on DNA synthesis and surfactant gene expression in primary cultures of rat alveolar type II cells. Cell Tissue Res. 291:295303.[CrossRef][Medline]
- Panos, R. J., J. S. Rubin, K. G. Csaky, S. A. Aaronson, and R. J. Mason. 1993. Keratinocyte growth factor and hepatocyte growth factor/scatter factor are heparin-binding growth factors for alveolar type II cells in fibroblast-conditioned medium. J. Clin. Invest. 92:969977.
- Strand, M. 2000. A generalized nonparametric test for lattice-ordered means. Biometrics 56:12221226.[CrossRef][Medline]
- Rennard, S. I., P. B. Bitterman, and R. G. Crystal. 1983. Response of the lower respiratory tract to injury: mechanisms of repair of the parenchymal cells of the alveolar wall. Chest 84:735739.[Abstract/Free Full Text]
- Kapanci, Y., E. R. Weibel, H. P. Kaplan, and F. R. Robinson. 1969. Pathogenesis and reversibility of the pulmonary lesions of oxygen toxicity in monkeys: II. Ultrastructural and morphometric studies. Lab. Invest. 20:101118.[Medline]
- Xu, X., K. McCormick-Shannon, D. R. Voelker, and R. J. Mason. 1998. KGF increases SP-A and SP-D mRNA levels and secretion in cultured rat alveolar type II cells. Am. J. Respir. Cell Mol. Biol. 18:168178.[Abstract/Free Full Text]
- Kuemmerle, J. F. 2003. IGF-I elicits growth of human intestinal smooth muscle cells by activation of PI3K, PDK-1, and p70S6 kinase. Am. J. Physiol. Gastrointest. Liver Physiol. 284:G411G422.[Abstract/Free Full Text]
- Chiu, T., C. Santiskulvong, and E. Rozengurt. 2003. Angiotensin II stimulates PKC-dependent ERK activation, DNA synthesis and cell division in intestinal epithelial cells. Am. J. Physiol. Gastrointest. Liver Physiol. 285:G1G11.[Abstract/Free Full Text]
- Hecquet, C., G. Lefevre, M. Valtink, K. Engelmann, and F. Mascarelli. 2002. Activation and role of MAP kinase-dependent pathways in retinal pigment epithelial cells: ERK and RPE cell proliferation. Invest. Ophthalmol. Vis. Sci. 43:30913098.[Abstract/Free Full Text]
- Thrane, E. V., P. E. Schwarze, G. H. Thoresen, M. Lag, and M. Refsnes. 2001. Persistent versus transient map kinase (ERK) activation in the proliferation of lung epithelial type 2 cells. Exp. Lung Res. 27:387400.[Medline]
- Upadhyay, D., E. Correa-Meyer, J. I. Sznajder, and D. W. Kamp. 2003. FGF-10 prevents mechanical stretch-induced alveolar epithelial cell DNA damage via MAPK activation. Am. J. Physiol. Lung Cell. Mol. Physiol. 284:L350L359.[Abstract/Free Full Text]
- Pardo, O. E., A. Arcaro, G. Salerno, S. Raguz, J. Downward, and M. J. Seckl. 2002. Fibroblast growth factor-2 induces translational regulation of Bcl-XL and Bcl-2 via a MEK-dependent pathway: correlation with resistance to etoposide-induced apoptosis. J. Biol. Chem. 277:1204012046.[Abstract/Free Full Text]
- Chen, D., R. V. Fucini, A. L. Olson, B. A. Hemmings, and J. E. Pessin. 1999. Osmotic shock inhibits insulin signaling by maintaining Akt/protein kinase B in an inactive dephosphorylated state. Mol. Cell. Biol. 19:46844694.[Abstract/Free Full Text]
- Wang, D., and H. S. Sul. 1998. Insulin stimulation of the fatty acid synthase promoter is mediated by the phosphatidylinositol 3-kinase pathway: involvement of protein kinase B/Akt. J. Biol. Chem. 273:2542025426.[Abstract/Free Full Text]
- Goncharova, E. A., D. A. Goncharov, A. Eszterhas, D. S. Hunter, M. K. Glassberg, R. S. Yeung, C. L. Walker, D. Noonan, D. J. Kwiatkowski, M. M. Chou, R. A. Panettieri, Jr., and V. P. Krymskaya. 2002. Tuberin regulates p70 S6 kinase activation and ribosomal protein S6 phosphorylation: a role for the TSC2 tumor suppressor gene in pulmonary lymphangioleiomyomatosis (LAM). J. Biol. Chem. 277:3095830967.[Abstract/Free Full Text]
- Okano, J., G. Shiota, K. Matsumoto, S. Yasui, A. Kurimasa, I. Hisatome, P. Steinberg, and Y. Murawaki. 2003. Hepatocyte growth factor exerts a proliferative effect on oval cells through the PI3K/AKT signaling pathway. Biochem. Biophys. Res. Commun. 309:298304.[CrossRef][Medline]
- Akhtar, M., J. L. Watson, A. Nazli, and D. M. McKay. 2003. Bacterial DNA evokes epithelial IL-8 production by a MAPK-dependent, NF-kappaB-independent pathway. FASEB J. 17:13191321.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
M. Wagner, S. Koschnick, S. Beilke, M. Frey, G. Adler, and R. M. Schmid
Selective expansion of the {beta}-cell compartment in the pancreas of keratinocyte growth factor transgenic mice
Am J Physiol Gastrointest Liver Physiol,
May 1, 2008;
294(5):
G1139 - G1147.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Qiao, W. Yan, C. Clavijo, R. Mehrian-Shai, Q. Zhong, K.-J. Kim, D. Ann, E. D. Crandall, and Z. Borok
Effects of KGF on Alveolar Epithelial Cell Transdifferentiation Are Mediated by JNK Signaling
Am. J. Respir. Cell Mol. Biol.,
February 1, 2008;
38(2):
239 - 246.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Faress, D. E. Nethery, E. F. O. Kern, R. Eisenberg, F. J. Jacono, C. L. Allen, and J. A. Kern
Bleomycin-induced pulmonary fibrosis is attenuated by a monoclonal antibody targeting HER2
J Appl Physiol,
December 1, 2007;
103(6):
2077 - 2083.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. N. Gomperts, J. A. Belperio, M. C. Fishbein, M. P. Keane, M. D. Burdick, and R. M. Strieter
Keratinocyte Growth Factor Improves Repair in the Injured Tracheal Epithelium
Am. J. Respir. Cell Mol. Biol.,
July 1, 2007;
37(1):
48 - 56.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. W. Rossi, L. T. Jeker, T. Ueno, S. Kuse, M. P. Keller, S. Zuklys, A. V. Gudkov, Y. Takahama, W. Krenger, B. R. Blazar, et al.
Keratinocyte growth factor (KGF) enhances postnatal T-cell development via enhancements in proliferation and function of thymic epithelial cells
Blood,
May 1, 2007;
109(9):
3803 - 3811.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Braun, M. Krampert, E. Bodo, A. Kumin, C. Born-Berclaz, R. Paus, and S. Werner
Keratinocyte growth factor protects epidermis and hair follicles from cell death induced by UV irradiation, chemotherapeutic or cytotoxic agents
J. Cell Sci.,
December 1, 2006;
119(23):
4841 - 4849.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Chang, K. Edeen, X. Lu, M. De Leon, and R. J. Mason
Keratinocyte Growth Factor Induces Lipogenesis in Alveolar Type II Cells through a Sterol Regulatory Element Binding Protein-1c-Dependent Pathway
Am. J. Respir. Cell Mol. Biol.,
August 1, 2006;
35(2):
268 - 274.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. C. Martis, J. A. Whitsett, Y. Xu, A.-K. T. Perl, H. Wan, and M. Ikegami
C/EBP{alpha} is required for lung maturation at birth
Development,
March 15, 2006;
133(6):
1155 - 1164.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Chang, J. Wang, X. Lu, D. P. Thewke, and R. J. Mason
KGF induces lipogenic genes through a PI3K and JNK/SREBP-1 pathway in H292 cells
J. Lipid Res.,
December 1, 2005;
46(12):
2624 - 2635.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Nishina, F. Zhang, L. D. Nielsen, K. Edeen, J. Wang, and R. J. Mason
Expression of CINC-2{beta} Is Related to the State of Differentiation of Alveolar Epithelial Cells
Am. J. Respir. Cell Mol. Biol.,
November 1, 2005;
33(5):
505 - 512.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Sithanandam, G. T. Smith, J. R. Fields, L. W. Fornwald, and L. M. Anderson
Alternate Paths from Epidermal Growth Factor Receptor to Akt in Malignant Versus Nontransformed Lung Epithelial Cells: ErbB3 Versus Gab1
Am. J. Respir. Cell Mol. Biol.,
November 1, 2005;
33(5):
490 - 499.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Ray
Protection of Epithelial Cells by Keratincoyte Growth Factor Signaling
Proceedings of the ATS,
October 1, 2005;
2(3):
221 - 225.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L.-Y. C. Wing, H.-M. Chen, P.-C. Chuang, M.-H. Wu, and S.-J. Tsai
The Mammalian Target of Rapamycin-p70 Ribosomal S6 Kinase but Not Phosphatidylinositol 3-Kinase-Akt Signaling Is Responsible for Fibroblast Growth Factor-9-induced Cell Proliferation
J. Biol. Chem.,
May 20, 2005;
280(20):
19937 - 19947.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Bao, Y. Wang, P. Sweeney, A. Chaudhuri, A. I. Doseff, C. B. Marsh, and D. L. Knoell
Keratinocyte growth factor induces Akt kinase activity and inhibits Fas-mediated apoptosis in A549 lung epithelial cells
Am J Physiol Lung Cell Mol Physiol,
January 1, 2005;
288(1):
L36 - L42.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|