Published ahead of print on March 23, 2004, doi:10.1165/rcmb.2003-0285OC
American Journal of Respiratory Cell and Molecular Biology. Vol. 31, pp. 220-226, 2004
© 2004 American Thoracic Society DOI: 10.1165/rcmb.2003-0285OC
Interleukin-22
A Potential Immunomodulatory Molecule in the Lung
Hayley A. Whittington,
Lynne Armstrong,
Kay M. Uppington and
Ann B. Millar
Lung Research Group, Department of Clinical Sciences North Bristol, University of Bristol, Southmead Hospital, Westbury-on-Trym, Bristol, United Kingdom
Address correspondence to: Dr. Ann Millar, Lung Research Group, Dept of Clinical Sciences North Bristol, University of Bristol, Southmead Hospital, Westbury-on-Trym, Bristol BS10 5NB, UK. E-mail: ann.millar{at}bris.ac.uk
 |
Abstract
|
|---|
Interleukin (IL)-22 is a member of the human type I interferon family, which includes IL-10. IL-22 has the potential to interact with IL-10 because it binds to the IL-10R2c chain with IL-22R1 in its receptor complex. Binding can be blocked by the soluble receptor, IL-22 binding protein (IL-22BP). We hypothesize that IL-22 and IL-22BP are involved in inflammatory regulation and its subsequent role in the pathogenesis of inflammatory lung disease. We have demonstrated IL-22 mRNA expression in alveolar macrophages (AM), monocytes, and alveolar epithelial (AE) cells. IL-22BP mRNA is expressed in AM, AE cells, and neutrophils. In contrast, IL-22R1 is expressed in AE only. Immunohistochemistry on normal and interstitial lung disease lung sections has confirmed IL-22 protein expression. Western blotting for IL-22 in bronchoalveolar lavage fluid demonstrated that lower levels of IL-22 were present in patients with acute respiratory distress syndrome and sarcoidosis relative to control subjects (P = 0.0152 and P = 0.0213). Levels of IL-22 in idiopathic pulmonary fibrosis were not different than those of the control subjects (P = 0.5838). IL-22 did not affect IL-10 inhibition of tumor necrosis factor- in monocytes, which do not express IL-22R1. By contrast, we demonstrated synergy between IL-10 and IL-22 in terms of IL-8 inhibition in IL-22R1-expressing A549 cells. These data suggest a role for IL-22 in the regulation of pulmonary inflammation.
Abbreviations: alveolar epithelial cells, AE alveolar macrophages, AM acute respiratory distress syndrome, ARDS bronchoalveolar lavage, BAL BAL fluid, BALF glyceraldehyde-3-phosphate dehydrogenase, GAPDH horseradish peroxidase, HRP immunoglobulin, Ig interleukin, IL IL-10 receptor, IL-10R IL-22 binding protein, IL-22BP IL-22 receptor, IL-22R interstitial lung disease, ILD IL-10related T cellderived inducible factor, IL-TIF idiopathic pulmonary fibrosis, IPF lipopolysaccharide, LPS reverse transcription polymerase chain reaction, RT-PCR signal transducer activator of transcription, STAT transforming growth factor-ß, TGF-ß tumor necrosis factor- , TNF- ventilated control, VC
 |
Introduction
|
|---|
Inflammation is a key component of the host defense mechanism, but uncontrolled inflammation results in tissue destruction and disease. Anti-inflammatory cytokines and soluble cytokine receptors block this process or suppress the intensity of the inflammatory cascade. Hence, a "balance" between the effects of proinflammatory and anti-inflammatory cytokines or soluble cytokine receptors is thought to influence the outcome of disease. One of the most widely studied of these networks is the inflammatory response to lipopolysaccharide (LPS), involving tumor necrosis factor (TNF)- , interleukin (IL)-8, and IL-10. Several forms of interstitial lung disease (ILD) share the characteristic of accumulating inflammatory cells in the alveoli, and in some cases fibrosis of the lung parenchyma, and have been associated with a persistence of the inflammatory response in the presence of IL-10, suggesting that a failure of normal homeostatic control occurs (13).
The recent identification of a number of IL-10 homologs suggests that alterations in their expression or function may influence the inflammatory response in ILD. One recently described IL-10 homolog is IL-22 or IL-10related T cellderived inducible factor (IL-TIF) (4). Murine IL-22 was originally identified as a gene induced by IL-9 in T cells and mast cells in vitro (4). Acute phase reactant induction activity was observed in mouse liver upon IL-22 injection and IL-22 expression was rapidly induced after LPS injection, suggesting that IL-22 contributes to the inflammatory response in vivo (5). IL-22 requires two receptor chains to assemble the functional IL-22R complex: the IL-22R1 chain, and the IL-10R2c chain, which also functions as the second chain of the IL-10R complex (68). As IL-10R2c appears to be constitutively and widely expressed in a number of organs and cell types, it is likely that the expression of IL-22R1 dictates the site of IL-22 action. IL-10 and IL-22 share some common signaling pathways in that they induce activation of JAK1 and Tyk2 tyrosine kinases leading to phosphorylation of three signal transducer activator of transcription (STAT) factors: STAT1, STAT3, and STAT5. In contrast, IL-22 also activates the three major MAPK pathways, whereas these pathways are inhibited by IL-10 (9). A soluble receptor, IL-22 binding protein (IL-22BP) (IL-22RA2), has been identified, which is a naturally occurring IL-22 antagonist. Interference with the binding of IL-22 to its receptors and hence inhibition of cytokine signaling has been demonstrated in vitro (1013). Three different isoforms of human IL-22BP have been identified (11). The longest isoform has a 32amino acid insert adjacent to the putative IL-22 binding site (10, 13). It has been suggested that this isoform fails to block IL-22 activity (10). Murine IL-22BP has been isolated, but no homologs to the long and short isoforms of human IL-22BP have been identified in murine tissues (14). As an antagonist of IL-22, the IL-22BP may be important in the regulation of inflammatory responses. Studies on expression of IL-22 by RT-PCR have found that IL-22 is present in many tissues including the lung after intraperitoneal stimulation with LPS (5). In further studies on murine tissues, IL-22 was induced in the lung at 4 h after intraperitoneal LPS injection and reduced by 8 h. IL-22R mRNA was weakly expressed constitutively and was not affected by stimulation with LPS. IL-10R2c is constitutively expressed (15). Human tissue distribution of IL-22BP mRNA has been studied using Northern blotting, RT-PCR, and in situ hybridization. IL-22BP found in lung sections by in situ hybridization in type II alveolar epithelial cells and macrophages. Human IL-22BP is induced in U937 cells and monocytes upon LPS treatment for 4 h and is still present after 6 h (12).
This background information, and our observations on the role of IL-10 in ILD, led us to hypothesize that IL-22, and its associated regulation by the IL-22BP, plays a role in the pathogenesis of these conditions. As an initial step, we have undertaken studies to determine expression of these molecules at both the mRNA and protein level in healthy and diseased lung tissue. We have demonstrated the presence of mRNA for IL-22, IL-22BP, and IL-22R1 by RT-PCR in a number of cell types isolated from bronchoalveolar lavage (BAL) fluid (BALF) and lung tissue. IL-22 protein expression has been confirmed by immunohistochemistry on paraffin-embedded normal lung sections. Western blotting to look at relative levels of IL-22 protein in BALF has shown that patients with pulmonary sarcoidosis and acute respiratory distress syndrome (ARDS) have lower levels of IL-22 than normal control groups. We hypothesize that this may be related to the Th1 bias of these conditions. The observation that IL-22 can bind to IL-10R2 alone (6) led us to investigate whether IL-22 may interfere with IL-10 responses in monocytes. Although monocytes do not express IL-22R1 they do express IL-10-R2, the second chain of the IL-22 receptor. We were unable to demonstrate any effect of IL-22 on IL-10mediated inhibition of TNF- production in monocytes; but by contrast, when we repeated the experiment in A549 cells, which do express IL-22R1, we found that IL-22 is able to synergize with IL-10 to downregulate IL-8 production by A549 cells. These data suggest that intrapulmonary IL-22 and IL-22BP may contribute to the modulation of the inflammatory response in ILD.
 |
Materials and Methods
|
|---|
Cell Lines and Reagents
LPS from Escherichia coli 0111:B4 was purchased from Sigma-Aldrich (St. Louis, MO). Recombinant human IL-10 was supplied by Peprotech EC Ltd (London, UK). Recombinant human IL-22 was obtained from R&D Systems (Minneapolis, MN). Antibodies used were as follows: Normal goat IgG (R&D Systems); antiIL-TIF (E-17); anti-Stat3 (H-190) and antip-Stat3 (B-7) (Santa Cruz Biotechnology, Santa Cruz, CA). THP-1 monocytic cell line (TIB-202) and A549 cells (CCl-185) were purchased from the American Type Culture Collection (Rockville, MD). This line was derived from lung carcinoma tissue and is alveolar type II epithelial in origin (16).
Patient Samples
Samples were isolated from patient groups defined by the following criteria. Patients with ARDS were studied on admission to the Intensive Therapy Unit (ITU), Southmead Hospital, Bristol. Lung injury was defined according to the American-European consensus (17). The ARDS group (n = 7) had a median age of 61 yr (range, 4778 yr). Patients ventilated postoperatively without lung injury were included as ventilated control (VC) subjects. The VC subjects (n = 7) had a median age of 73 yr (range, 3480 yr). All patients with idiopathic pulmonary fibrosis (IPF) were diagnosed according to American Thoracic Society (ATS)/European Respiratory Society (ERS) consensus classification (18). The IPF group (n = 19) had a median age of 73 yr (range, 4288 yr). The normal control population (n = 20), with no previous history of fibrosing lung disease, had a median age of 54 yr (range, 2387 yr). Patients with pulmonary sarcoidosis (n = 13) had disease confirmed by histology on lung biopsy and a median age of 43 yr (range, 2778 yr). Primary lung epithelial cells were isolated by the method of Witherden and Tetley (19) from macroscopically nontumoral lung tissue of patients undergoing lobectomy or pneumonectomy for lung cancer. The method has North Bristol NHS Trust Ethics Committee approval.
Bronchoscopy and BALF Cell Isolation
Bronchoscopy was performed according to standard protocol. After topical anesthesia with 2% lidocaine, BAL was performed with four 60-ml aliquots of buffered saline instilled into the middle lobe. The BALF was aspirated into a siliconized glass bottle and stored on ice until processing. Samples were processed within 15 min of collection. The chilled BALF was strained through a single layer of coarse gauze to remove clumps of mucus and then spun at 400 x g for 5 min to recover cells. BALF supernatant was collected and stored at 80°C until analysis. Cell types were isolated and assessed as follows. Alveolar macrophages (AM) were isolated from BALF of a normal subject by adherence and were assessed to be 100% AM by differential cytospin. Neutrophils were isolated from an ARDS patient BALF and were > 99% by differential cytospin.
RNA Extraction
Total RNA was extracted from cells using RNA Bee (AMS Biotechnology, Oxon, UK) according to the manufacturer's instructions. The aqueous phase was transferred to a fresh tube and equal volume isopropanol was added. After precipitation, samples were centrifuged at 12,000 x g for 15 min at 4°C. The RNA was washed once with 75% ethanol at 4°C followed by recentrifugation. The RNA pellet was air-dried, resuspended in nuclease-free water at 100 ng/µl concentration, and stored at 80°C.
RT-PCR Reaction
RNA samples were measured using a GeneQuant II (Pharmacia, Cambridge, UK) and the concentration adjusted to 100 ng/ml with nuclease-free water. Reverse transcription reactions were performed with a Reverse-iT First Strand Synthesis Kit (ABgene, Epsom, UK) using a One-Step Protocol according to the manufacturer's instructions. cDNA from 100 ng of total RNA was amplified by PCR using the following primers and conditions: IL-22BP sense AGGGTACAATTTCAGTCCCGA, antisense CGGCGTCATGCTCCATTCTGA (55°C, 40 cycles); IL-22R1 sense CTGACACAGAGTTCCTTGG, antisense CCTAAGTAGGTGATCTCGG (52°C, 35 cycles); IL-22 sense CACTGCAGGCTTGACAAG, antisense CTTAGCCTGTTGCTGAGC (57°C, 35 cycles) and GAPDH sense GCCAAAAGGGTCATCATCTC, antisense GTAGAGGCAGGGATGATGTT (60°C, 30 cycles). The post PCR products were analyzed in ethidium bromidestained 1.5% agarose gels.
DNA Sequence Analysis
PCR fragments were isolated from agarose gels using a QiaQuick Gel Isolation Kit (Qiagen Ltd, Crawley, UK). Fragments were cloned using the TA Cloning Kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions and sequenced on an ABI Prism automated sequencer.
Monocyte Isolation and Culture
Peripheral blood mononuclear cells (PBMCs) were isolated from heparinized whole blood by density centrifugation over Ficoll-Paque PLUS solution (Amersham Pharmacia, Uppsala, Sweden). A viable cell count and differential cytospin were performed to determine the percentage of monocytes in the PBMC population. The monocytes were resuspended at 1 x 106/ml of RPMI 1640 with 10% fetal calf serum. Aliquots of 105 monocytes were seeded in each well of a 96-well tissue culture microtitre plate (Gibco-Nunc, Paisley, UK) and incubated for 1 h at 37°C, 5% CO2 to adhere the monocytes. The nonadherent cell population was rinsed off by repeated washing with RPMI 1640 medium and a 200-µl volume of fresh medium added to each well. The monocytes were stimulated in triplicate with LPS (1 µg/ml), IL-10 (10 ng/ml) and IL-22 (10 and 100 ng/ml) either alone or in combination. The cell culture supernatant was removed after 24 h incubation at 37°C, 5%CO2.
Measurement of TNF- Bioactivity
The Wehi 164 clone 13 mouse fibrosarcoma cell line displays dose-dependent cytotoxicity only in response to TNF- (20). Confluent cells were detached from the culture flask using trypsin/EDTA solution. After centrifugation at 80 x g for 5 min, the cells were resuspended in RPMI 1640 medium containing 20% heat-inactivated fetal calf serum for use in the bioassay. A 50-µl aliquot of cell suspension was added to each well of a 96-well tissue culture microtiter plate (Gibco-Nunc) and the cells were left to adhere for 2 h in an incubator. After cell attachment, 10 µl of 10 µg/ml actinomycin D (Sigma) was added to each well to arrest cell division. A total of 40 µl of TNF- standards (range 10 ng/ml to 1 pg/ml) and samples were added in triplicate to bring the final volume in the well to 100 µl. Wehi cultures were then incubated for 20 h at 37°C, 5% CO2 in a humidified incubator. Cell viability was then measured using the CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay (Promega, Madison, WI) as follows. A 20-µl aliquot of MTS/PMS solution was added to each well and the plate was further incubated for 14 h at 37°C/5% CO2. MTS is bioreduced by cells into a formazan product that is soluble in tissue culture medium. The absorbance of the formazan product was measured at 490 nm on a plate reader. Sample values were extrapolated from the standard curve using the Biolinx software package (Dynatech, Billingshurst, UK).
Western Blotting
For Western blot analysis of STAT3 tyrosine phosphorylation in the alveolar type II epithelial cell line A549, 106 cells were stimulated with 10 ng/ml recombinant human IL-22 (R&D Systems) for up to 60 min. Cells were then lysed in a 1% NP-40 lysis buffer. Aliquots were boiled for 5 min with Laemmli buffer, resolved on an 8% SDS-PAGE gel and electrophoretically transferred to Immobilon-P membrane (Millipore). Membranes were blocked for 1 h in TBS (150 mM NaCl and 20 mM Tris, pH7.5) containing 5% nonfat dry milk and 0.1% Tween 20. Membranes were then incubated with either rabbit polyclonal anti-Stat3 (H-190; Santa Cruz) or monoclonal antip-Stat3 (B-7; Santa Cruz) for 1 h at room temperature. After incubation with horseradish peroxidase (HRP)-conjugated goat anti-rabbit or rabbit anti-mouse antibodies (DAKO, Ely, UK) the proteins were visualized with ECL (Amersham, Chalfont St. Giles, UK).
For analysis of IL-22 protein in BALF, 0.5 ml aliquots of BALF were concentrated in a microfuge at 4°C using MicroconYM-3 centrifugal filters (Millipore, Bedford, MA). In concentrated BALF from VC subjects and patients with ARDS, the IL-22 protein levels were adjusted for dilution effects by comparing BAL and plasma urea values (21). In concentrated BALF from patients with ILD (IPF and sarcoidosis) and normal control subjects, BALF dilution was corrected by measuring levels of BALF protein with a Coomassie Protein Assay Kit (Pierce, Rockford, IL) and loading 20 µg of BALF protein per lane. Recombinant human IL-22 (20 ng) was loaded as a control. Samples were resolved through a 15% SDS-PAGE gel and transferred as above. The membranes were blocked and probed as in the above protocol with an antiIL-TIF antibody (E-17; Santa Cruz) for 1 h at room temperature and subsequently with HRP-conjugated donkey anti-goat antibody. IL-22 protein was quantified by densitometry of the bands relative to recombinant human IL-22 using Quantity One software (BioRad, Hemel Hempstead, UK).
Immunohistochemistry
Expression of IL-22 was assessed in paraffin-embedded tissue sections. Tissue sections were deparaffinized in xylene, followed by 100% ethanol and gradual hydration, and antigen retrieval in a pressure cooker in 0.01 M citrate buffer pH 6.0. The specimens were treated with 0.3% hydrogen peroxide for 10 min to block endogenous peroxidase activity. Staining was performed using reagents from the R.T.U. VECTASTAIN Universal Quick Kit (Vector Laboratories, Burlingame, CA). Background absorption of antisera was blocked using normal horse serum (1.5%) for 10 min. Non-specific binding of Biotin/Avidin System reagents was blocked using the Avidin/Biotin Blocking Kit (Vector Laboratories). Goat polyclonal anti-IL-TIF antibody (E-17; Santa Cruz) was diluted to 0.51.0 µg/ml in PBS/0.1% saponin pH7.3. An equivalent concentration of normal goat IgG (R&D Systems) was used as a negative control. Primary antibodies were added to the sections for 2 h at room temperature. Sections were incubated with a biotinylated pan-specific secondary antibody for 10 min followed by streptavidin/peroxidase complex reagent for 5 min. The peroxidase substrate 3,3'-diaminobenzidine was added to the sections for 10 min. After washing in distilled water, sections were counterstained with hematoxylin and mounted.
IL-8 Enzyme-Linked Immunosorbent Assay
A549 cells were cultured for 24 h unstimulated, or with added LPS (100 µg/ml), highly purified IL-10 (10 ng/ml), and/or IL-22 (10 ng/ml). Supernatants were stored at 80°C until analysis. IL-8 levels were determined in diluted supernatants using the Pelikine IL-8 kit (sensitivity, 13 pg/ml; Mast Diagnostics, Bootle, UK), according to manufacturer's instructions.
Statistical Analysis
Significant differences within a group and between groups were determined by Mann-Whitney U analysis for nonparametric data, and a one-way ANOVA with Tukey's comparison for parametric data (IL-8 ELISA data only), using GraphPad Prism software. A P value < 0.05 was considered significant.
 |
Results
|
|---|
RT-PCR for IL-22, IL-22BP, and IL-22R1 in Cells Isolated from BALF and Lung Tissue
As all the components of the IL-22 inflammatory system appear to be expressed at the RNA level in whole murine lung and human lung tissue, we have studied the mRNA distribution of the individual components in cells isolated from BALF of patients with lung disease and from normal subjects by RT-PCR. The human monocytic cell line THP-1 and lung epithelial cell line A549 were used as controls. IL-22 mRNA is present in AM, monocytes, and primary lung alveolar epithelial (AE) cells. IL-22BP mRNA is present in AM, AE cells, monocytes, and neutrophils. IL-22R1 mRNA is expressed in AE only (Figure 1). The RT-PCR fragments were cloned and DNA sequence analysis was used to confirm the identity of IL-22 and IL-22BP in the different cell types (data not shown).

View larger version (63K):
[in this window]
[in a new window]
|
Figure 1. RT-PCR on cells isolated from BALF and lung tissue. RT-PCR was performed for IL-22, IL-22BP, IL-22R1, and GAPDH on total RNA isolated from cells derived from BALF or lung tissue. Cell lines A549 and THP-1 were used as controls. PCR products were analyzed in ethidium bromide1.5% agarose gels.
|
|
IL-22 Induces STAT3 Phosphorylation in the Lung Epithelial Line A549
Only lung epithelial cells were found to express the IL-22R1 subunit in the lung, and hence only this cell type is likely to be responsive to IL-22. IL-22 was able to induce STAT3 phosphorylation as shown by Western blotting of A549 alveolar epithelial type II cells stimulated with recombinant human IL-22. Cell extracts were probed with anti-Stat3 and antip-Stat3 antibodies (Figure 2). STAT3 phosphorylation can be detected with the antip-Stat3 antibody 5 min after IL-22 stimulation and peaks at 30 min. Hence, A549 cells are responsive to IL-22. This correlates with data from electromobility shift assays for IL-22 induced STAT phosphorylation (6).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 2. Western blot analysis of STAT3 tyrosine phosphorylation in A549 cells. The alveolar type II epithelial line A549 was stimulated with 10 ng/ml recombinant human IL-22 for up to 60 min. After cell lysis, total cell protein was electrophoresed through an 8% SDS-PAGE gel and electrophoretically transferred to Immobilon-P membrane. Membranes were incubated with either rabbit polyclonal anti-Stat3 or monoclonal antip-Stat3. After incubation with HRP-conjugated secondary antibodies the proteins were visualized with ECL.
|
|
Immunohistochemistry for IL-22 Expression on Human Lung Tissue Sections
Immunohistochemistry with the antiIL-TIF (human IL-22) goat polyclonal antibody was used to study protein expression in paraffin sections of normal human lung tissue. Normal goat IgG was used as a negative control. In normal lung tissue and lung sections from patients with IPF, the antiIL-TIF antibody bound to AM and AE cells (Figure 3). This confirms that these cell types express IL-22 in the lung.

View larger version (130K):
[in this window]
[in a new window]
|
Figure 3. IL-22 expression in paraffin-embedded sections of normal lung (a and b) and IPF lung (c and d). Sections were incubated with either normal goat IgG or a goat polyclonal antiIL-TIF (IL-22) antibody. Staining was performed using reagents from the R.T.U. VECTASTAIN Universal Quick KIT and Avidin/Biotin Blocking Kit according to the manufacturers' instructions. Antibody binding was visualized with 3,3'-diaminobenzidine and sections were counterstained with hematoxylin. AM and AE stained with IL-22 are highlighted with arrows.
|
|
Western Blotting for IL-22 in BALF of Patients with ILD and Normal Subjects
As IL-22 has been implicated as having a role in the proinflammatory process through induction of acute phase reactant proteins in the liver (5), we have tested BALF from patients with lung disease and normal subjects. Western blotting with an antiIL-TIF antibody was used to look for differences in the level of IL-22 in patients with ILD and acute lung injury. The antiIL-TIF antibody binds to recombinant IL-22 by Western blotting (Figure 4A). BALF from patients with ILD (IPF; pulmonary sarcoidosis; ARDS) and control subjects (normal subjects; VC subjects) was concentrated and analyzed for the presence of IL-22 by Western blotting (Figure 4B). Recombinant human IL-22 (20 ng) was loaded as a positive control. To control for differences in BALF dilution, BALF protein levels were measured in samples from patients with IPF, patients with sarcoidosis, and from the normal control subjects. BALF protein levels are not statistically different in these groups (data not shown). These results are expressed as IL-22 ng/µg BALF protein. However, patients with ARDS have higher levels of BALF protein than their VC subject group, and hence relative levels of urea in plasma and BALF was used to control for dilution of epithelial lining fluid in the BALF in these two groups. The level of IL-22 was determined by densitometry relative to the recombinant IL-22 band and normalized for dilution of the epithelial lining fluid in the BALF. For these groups the results are expressed as IL-22 ng/µl of epithelial lining fluid. The BALF of patients with ARDS (n = 7) had significantly lower levels of IL-22 than that present in the VC group (n = 7) (median 1.041 versus 8.383; P = 0.0152) (Figure 4C). The BALF of patients with pulmonary sarcoidosis (n = 13) had significantly lower levels of IL-22 than that of the normal control subjects (n = 20) (median 0.1700 versus 0.4355; P = 0.0213) and the patients with IPF (n = 19) (median 0.1700 versus 0.4200; P = 0.0113). There was no significant difference between the normal subjects and the patients with IPF (median 0.4355 versus 0.4200, P = 0.5838) (Figure 4D).

View larger version (28K):
[in this window]
[in a new window]
|
Figure 4. Western blotting of IL-22 protein in BALF from (A) subjects with ILD and (B) normal control subjects. Recombinant human IL-22 (20 ng) is used as a positive control. IL-22 protein was quantified by densitometry of the bands relative to the positive control using Quantity One software (BioRad). (C) Level of IL-22 protein measured by densitometry of bands obtained by Western blotting of BALF from patients with ARDS and from VC subjects using a goat antiIL-TIF (IL-22) antibody. Levels were measured relative to the positive control. Dilution of the epithelial lining fluid in the BALF was determined by measurement of urea levels in BALF and corresponding plasma. Results are expressed as IL-22 (ng)/µl epithelial lining fluid. Levels are statistically different (P = 0.0152) by Mann-Whitney analysis. (D) Level of IL-22 protein measured by densitometry of bands obtained by Western blotting of BALF from patients with ILD (sarcoidosis; IPF) and normal control subjects. Equal amounts of BALF protein were compared and results are expressed as IL-22 (ng)/µg BALF protein. There were statistically lower levels of IL-22 in sarcoidosis BALF relative to the normal control BALF (P = 0.0213) by Mann-Whitney analysis.
|
|
Interaction between IL-22 and IL-10
We have looked at potential interaction between IL-22 and IL-10 in terms of competition for IL-10R2c binding. In monocytes isolated from human blood, the addition of LPS induces production of TNF- , which can be suppressed by the presence of IL-10. We have looked at the effect of IL-22 in combination with IL-10 on levels of TNF- induction by LPS in monocytes. The monocytes were stimulated in triplicate with LPS (1 µg/ml), IL-10 (10 ng/ml) and IL-22 (10 and 100 ng/ml) either alone or in combination. After 24 h incubation, TNF- bioactivity in the cell culture supernatant was determined by measuring dose-dependent cytotoxicity of the Wehi 164 mouse fibrosarcoma cell line in response to TNF- . 10 ng/ml IL-22 had no effect on TNF- production in the presence or absence of LPS (Figure 5A), nor did the presence of a 10-fold excess of IL-22 over IL-10 (data not shown). This correlates with the observations of Xie and coworkers (7).
Because we have detected the presence of functional IL-22R1 on A549, but not on monocytes, we decided to explore the responses of these cells to IL-22. The predominant proinflammatory cytokine produced by A549 is IL-8, which can be inhibited by IL-10 (22). In this study, A549 cells produced high basal levels of IL-8, which were not significantly increased by incubation with LPS. Incubation with 10 ng/ml IL-10 had a minimal inhibitory effect on IL-8 expression compared with unstimulated control, which was not significant (mean 1.837 ± 0.06 versus 1.969 ± 0.05 ng/ml, respectively) (Figure 5B). By contrast, incubation with 10 ng/ml IL-22 did significantly inhibit IL-8 protein release (mean 1.639 ± 0.07 ng/ml, P < 0.01). Interestingly, when IL-22 and IL-10 were added together, the IL-8 level was significantly lower than IL-10 or IL-22 alone (mean 1.443 ± 0.05, P < 0.001 and P < 0.05, respectively), suggesting a synergistic effect. This was also observed for A549 cells treated with LPS (IL-10 + LPS 2.078 ± 0.03, IL-22 + LPS 1.851 ± 0.02, IL-10 + IL-22 + LPS 1.309 ± 0.08, P < 0.001).
 |
Discussion
|
|---|
Several studies have demonstrated a persistent pulmonary inflammatory response in patients with ILD, despite the presence of elevated levels of IL-10 (13). This led to the notion that other factors may be implicated in the regulation of inflammatory cytokines in patients with ILD. The recognition of homologs of IL-10 such as IL-22, and their potential to interact with IL-10, led to interest in their potential immunomodulatory role in the lung.
IL-22 was initially identified as an IL-9inducible protein from IL-9stimulated T lymphoma cells (4). IL-9 is produced by activated Th2 lymphocytes and acts on various cells from the hemopoetic and lymphoid systems. However, IL-9 receptors have been identified on AM and lung epithelial cells leading to a potential mechanism for induction of IL-22 expression in the lung (23). Although IL-22 is considered to be involved in the proinflammatory response due to induction of acute phase reactant proteins in the liver, the precise function of IL-22 is unknown apart from the observation that it may weakly suppress the production of IL-4 (5, 7). In animal studies of IL-22 expression a variable degree of upregulation of pulmonary murine IL-22 mRNA has been demonstrated in response to systemic LPS administration (4, 15), again suggesting an immunomodulatory role in the inflammatory response.
In this study, IL-22 expression has been demonstrated by RT-PCR in AM and primary lung AE cells, using cells isolated from BALF or lung tissue of patients with ILD and normal subjects. Immunohistochemistry on paraffin-embedded normal lung sections using an antiIL-TIF (antiIL-22) confirms that AM and AE cells produce IL-22. Sections of lung from patients with IPF exhibit the same distribution and extent of IL-22 expression. IL-10R2c is constitutively expressed in human lung tissue by RT-PCR. Distribution of IL-22R1, therefore, is the limiting factor in the action of IL-22 (15). RT-PCR in our current studies indicates that IL-22R1 expression in confined to the AE cells and Western blotting has demonstrated induction STAT3 phosphorylation by IL-22 in A549 cells. This correlates with previous observations of IL-22R1 expressed in A549 cells and that IL-22 can induce STAT activation in this cell line (6).
Previously, human tissue distribution of IL-22BP mRNA has been studied using Northern blotting, RT-PCR and in situ hybridization (10, 12, 13). IL-22BP was found in type II AE cells and macrophages in lung sections by in situ hybridization (12). RT-PCR for IL-22BP mRNA shows that it is expressed in AM, AE cells, monocytes, and neutrophils in human lung. As AE cells express IL-22, IL-22BP, and IL-22R1, they are likely to be the only lung cell type responsive to IL-22 via expression of the IL-22 receptor complex.
We have examined the level of IL-22 in BALF of patients with ILD (IPF, sarcoidosis, ARDS) and from control subjects (normal subjects, VC) by Western blotting. IL-22 in BALF was lower in patients with ARDS relative to VC subjects. IL-22 was also lower in BALF of patients with pulmonary sarcoidosis relative to normal subjects. There was no significant difference between IL-22 levels in patients with IPF relative to normal control subjects. Detailed analysis of the cytokine network has improved our understanding of sarcoidosis as an immune-mediated disease (24). An unknown "sarcoid" stimulus activates T cells and macrophages resulting in cytokine release. These cytokines induce recruitment, activation, and proliferation of mononuclear cells, generate an alveolitis, promote granuloma formation, and influence the clinical course of the disease (25). Sarcoidosis is associated with an increased number of alveolar T cells (26). These alveolar T cells spontaneously release Th1 cytokines, whereas Th2 cytokines are lacking (2729). This may account for the lower levels of IL-22 seen in the BALF of patients with pulmonary sarcoidosis. In contrast, patients with ARDS have an acute inflammatory response in the lung with infiltration of neutrophils and extensive alveolar epithelial cell damage. In these subjects, lower IL-22 levels may be due to reduced expression of IL-22 from the damaged alveolar epithelium or dilution of IL-22 in the epithelial lining fluid due to pulmonary edema. The observation that the levels of IL-22 protein are not increased in IPF, which produces Th2 cytokines, may not reflect alterations in IL-22 activity. It has already been demonstrated that the activity of IL-22 is blocked by the soluble IL-22BP, which is produced by many cell types in the lung, and hence it would be interesting in the future to examine the ratio of IL-22 to IL-22BP in ILD. Currently antibodies to the IL-22BP are not available.
Our interest in IL-22 stems from its potential to interact with IL-10 signaling via the IL-10R2c chain in its receptor complex (68). In contrast, the soluble receptor IL-22BP blocks binding of IL-22 to its receptor and hence IL-22 signaling, but does not appear to bind to IL-10 (10). Our studies on monocytes show that IL-22 does not affect the ability of IL-10 to downregulate TNF- production on LPS stimulation, even at a 10-fold excess over IL-10, confirming the observations of Xie and colleagues (7). This may be a reflection of our inability to detect IL-22R1 on these cells. By contrast, A549, which we have shown to express functional IL-22R1, showed a synergistic relationship with IL-10 in terms of IL-8 inhibition. We do not know whether this synergy arises from upregulation of IL-10R1 expression in response to IL-22, as has been observed in neutrophils stimulated with IL-4 (30), or whether this indicates a convergence of signaling pathways. Our observation that IL-22 induces STAT3 tyrosine phosphorylation in A549, which is the pathway used by IL-10 for inhibition of cytokine release (31), supports the latter explanation. Interestingly, this study does raise the possibility that the reduced levels of IL-22 that we observed in ARDS may account in part for the elevated levels of IL-8 that are a feature of this disease (32). Further studies will be required to determine the role undertaken by IL-22 in the pulmonary milieu.
 |
Acknowledgments
|
|---|
The authors thank the following people: Dr. Andrew Medford and Mrs. Sharon Standen (Lung Research Group, Southmead Hospital, Bristol, UK), Dr. Nassif Ibrahim (Frenchay Hospital, Bristol, UK), and the staff of the I.T.U., Southmead Hospital, Bristol, UK. This research is funded by the Severin Wunderman Fund and British Lung Foundation.
Received in original form July 30, 2003
Received in final form February 23, 2004
 |
References
|
|---|
- Martinez, J. A., T. E. King, Jr., K. Brown, C. A. Jennings, L. Borish, R. L. Mortenson, T. Z. Khan, T. W. Bost, and D. W. Riches. 1997. Increased expression of the interleukin-10 gene by alveolar macrophages in interstitial lung disease. Am. J. Physiol. 273:L676L683.
- Zhang, Y., T. C. Lee, B. Guillemin, M. C. Yu, and W. N. Rom. 1993. Enhanced IL-1 beta and tumor necrosis factor-alpha release and messenger RNA expression in macrophages from idiopathic pulmonary fibrosis or after asbestos exposure. J. Immunol. 150:41884196.[Abstract]
- Freeburn, R. W., L. Armstrong, and A. B. Millar. 1999. Molecular analysis of mRNA levels in cytokines and their receptors in patients with cryptogenic fibrosing alveolitis. Am. J. Respir. Crit. Care Med. 159:A659. (Abstr.)
- Dumoutier, L., J. Louahed, and J. C. Renauld. 2000. Cloning and characterization of IL-10-related T cell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL-10 and inducible by IL-9. J. Immunol. 164:18141819.[Abstract/Free Full Text]
- Dumoutier, L., E. Van Roost, D. Colau, and J. C. Renauld. 2000. Human interleukin-10-related T cell-derived inducible factor: molecular cloning and functional characterization as an hepatocyte-stimulating factor. Proc. Natl. Acad. Sci. USA 97:1014410149.[Abstract/Free Full Text]
- Kotenko, S. V., L. S. Izotova, O. V. Mirochnitchenko, E. Esterova, H. Dickensheets, R. P. Donnelly, and S. Pestka. 2001. Identification of the functional interleukin-22 (IL-22) receptor complex: the IL-10R2 chain (IL-10Rbeta) is a common chain of both the IL-10 and IL-22 (IL-10-related T cell-derived inducible factor, IL-TIF) receptor complexes. J. Biol. Chem. 276:27252732.[Abstract/Free Full Text]
- Xie, M. H., S. Aggarwal, W. H. Ho, J. Foster, Z. Zhang, J. Stinson, W. I. Wood, A. D. Goddard, and A. L. Gurney. 2000. Interleukin (IL)-22, a novel human cytokine that signals through the interferon receptor-related proteins CRF24 and IL-22R. J. Biol. Chem. 275:3133531339.[Abstract/Free Full Text]
- Kotenko, S. V., C. D. Krause, L. S. Izotova, B. P. Pollack, W. Wu, and S. Pestka. 1997. Identification and functional characterization of a second chain of the interleukin-10 receptor complex. EMBO J. 16:58945903.[CrossRef][Medline]
- Lejeune, D., L. Dumoutier, S. Constantinescu, W. Kruijer, J. J. Schuringa, and J. C. Renauld. 2002. Interleukin-22 (IL-22) activates the JAK/STAT, ERK, JNK, and p38 MAP kinase pathways in a rat hepatoma cell line. Pathways that are shared with and distinct from IL-10. J. Biol. Chem. 277:3367633682.[Abstract/Free Full Text]
- Dumoutier, L., D. Lejeune, D. Colau, and J. C. Renauld. 2001. Cloning and characterization of IL-22 binding protein, a natural antagonist of IL-10-related T cell-derived inducible factor/IL-22. J. Immunol. 166:70907095.[Abstract/Free Full Text]
- Kotenko, S. V., L. S. Izotova, O. V. Mirochnitchenko, E. Esterova, H. Dickensheets, R. P. Donnelly, and S. Pestka. 2001. Identification, cloning, and characterization of a novel soluble receptor that binds IL-22 and neutralizes its activity. J. Immunol. 166:70967103.[Abstract/Free Full Text]
- Xu, W., S. R. Presnell, J. Parrish-Novak, W. Kindsvogel, S. Jaspers, Z. Chen, S. R. Dillon, Z. Gao, T. Gilbert, K. Madden, S. Schlutsmeyer, L. Yao, T. E. Whitmore, Y. Chandrasekher, F. J. Grant, M. Maurer, L. Jelinek, H. Storey, T. Brender, A. Hammond, S. Topouzis, C. H. Clegg, and D. C. Foster. 2001. A soluble class II cytokine receptor, IL-22RA2, is a naturally occurring IL-22 antagonist. Proc. Natl. Acad. Sci. USA 98:95119516.[Abstract/Free Full Text]
- Gruenberg, B. H., A. Schoenemeyer, B. Weiss, L. Toschi, S. Kunz, K. Wolk, K. Asadullah, and R. Sabat. 2001. A novel, soluble homologue of the human IL-10 receptor with preferential expression in placenta. Genes Immun. 2:329334.[CrossRef][Medline]
- Wei, C. C., T. W. Ho, W. G. Liang, G. Y. Chen, and M. S. Chang. 2003. Cloning and characterization of mouse IL-22 binding protein. Genes Immun. 4:204211.[CrossRef][Medline]
- Tachiiri, A., R. Imamura, Y. Wang, M. Fukui, M. Umemura, and T. Suda. 2003. Genomic structure and inducible expression of the IL-22 receptor alpha chain in mice. Genes Immun. 4:153159.[CrossRef][Medline]
- Lieber, M., B. Smith, A. Szakal, W. Nelson-Rees, and G. Todaro. 1976. A continuous tumor-cell line from a human lung carcinoma with properties of type II alveolar epithelial cells. Int. J. Cancer 17:6270.[Medline]
- Bernard, G. R., A. Artigas, K. L. Brigham, J. Carlet, K. Falke, L. Hudson, M. Lamy, J. R. LeGall, A. Morris, and R. Spragg. 1994. American-European Consensus Conference on ARDS. Definitions, mechanisms, relevant outcomes, and clinical trial coordination. Am. J. Respir. Crit. Care Med. 149:818824.
- Demedts, M., and U. Costabel. 2002. ATS/ERS international multidisciplinary consensus classification of the idiopathic interstitial pneumonias. Eur. Respir. J. 19:794796.[Free Full Text]
- Witherden, I. R., and T. D. Tetley. 2001. Isolation and culture of human alveolar type II pneumocytes. In Human Airway Inflammation: Sampling Techniques and Analytical Protocols. D. F. Rogers and L. E. Donnelly, editors. Humana Press, Totawa, NJ. 137146.
- Hansen, M. B., S. E. Nielsen, and K. Berg. 1989. Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill. J. Immunol. Methods 119:203210.[CrossRef][Medline]
- Delclaux, C., M. P. D'Ortho, C. Delacourt, F. Lebargy, C. Brun-Buisson, L. Brochard, F. Lemaire, C. Lafuma, and A. Harf. 1997. Gelatinases in epithelial lining fluid of patients with adult respiratory distress syndrome. Am. J. Physiol. 272:L442L451.
- Gudmundsson, G., and G. W. Hunninghake. 1999. Respiratory epithelial cells release interleukin-8 in response to a thermophilic bacteria that causes hypersensitivity pneumonitis. Exp. Lung Res. 25:217228.[CrossRef][Medline]
- Pilette, C., Y. Ouadrhiri, J. Van Snick, J. C. Renauld, P. Staquet, J. P. Vaerman, and Y. Sibille. 2002. Oxidative burst in lipopolysaccharide-activated human alveolar macrophages is inhibited by interleukin-9. Eur. Respir. J. 20:11981205.[Abstract/Free Full Text]
- Muller-Quernheim, J. 1998. Sarcoidosis: immunopathogenetic concepts and their clinical application. Eur. Respir. J. 12:716738.[Abstract]
- Ziegenhagen, M. W., and J. Muller-Quernheim. 2003. The cytokine network in sarcoidosis and its clinical relevance. J. Intern. Med. 253:1830.[CrossRef][Medline]
- Ward, K., C. O'Connor, C. Odlum, and M. X. Fitzgerald. 1989. Prognostic value of bronchoalveolar lavage in sarcoidosis: the critical influence of disease presentation. Thorax 44:612.[Abstract]
- Pinkston, P., P. B. Bitterman, and R. G. Crystal. 1983. Spontaneous release of interleukin-2 by lung T lymphocytes in active pulmonary sarcoidosis. N. Engl. J. Med. 308:793800.[Abstract]
- Robinson, B. W., T. L. McLemore, and R. G. Crystal. 1985. Gamma interferon is spontaneously released by alveolar macrophages and lung T lymphocytes in patients with pulmonary sarcoidosis. J. Clin. Invest. 75:14881495.
- Walker, C., W. Bauer, R. K. Braun, G. Menz, P. Braun, F. Schwarz, T. T. Hansel, and B. Villiger. 1994. Activated T cells and cytokines in bronchoalveolar lavages from patients with various lung diseases associated with eosinophilia. Am. J. Respir. Crit. Care Med. 150:10381048.[Abstract]
- Crepaldi, L., L. Silveri, F. Calzetti, C. Pinardi, and M. A. Cassatella. 2002. Molecular basis of the synergistic production of IL-1 receptor antagonist by human neutrophils stimulated with IL-4 and IL-10. Int. Immunol. 14:11451153.[Abstract/Free Full Text]
- Donnelly, R. P., H. Dickensheets, and D. S. Finbloom. 1999. The interleukin-10 signal transduction pathway and regulation of gene expression in mononuclear phagocytes. J. Interferon Cytokine Res. 19:563573.[CrossRef][Medline]
- Donnelly, S. C., R. M. Strieter, S. L. Kunkel, A. Walz, C. R. Robertson, D. C. Carter, I. S. Grant, A. J. Pollok, and C. Haslett. 1993. Interleukin-8 and development of adult respiratory distress syndrome in at-risk patient groups. Lancet 341:643647.[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
E. Ziesche, M. Bachmann, H. Kleinert, J. Pfeilschifter, and H. Muhl
The Interleukin-22/STAT3 Pathway Potentiates Expression of Inducible Nitric-oxide Synthase in Human Colon Carcinoma Cells
J. Biol. Chem.,
June 1, 2007;
282(22):
16006 - 16015.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. F. Weber, S. Schlautkotter, S. Kaiser-Moore, F. Altmayr, B. Holzmann, and H. Weighardt
Inhibition of Interleukin-22 Attenuates Bacterial Load and Organ Failure during Acute Polymicrobial Sepsis
Infect. Immun.,
April 1, 2007;
75(4):
1690 - 1697.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Chang, H. Hanawa, H. Liu, T. Yoshida, M. Hayashi, R. Watanabe, S. Abe, K. Toba, K. Yoshida, R. Elnaggar, et al.
Hydrodynamic-Based Delivery of an Interleukin-22-Ig Fusion Gene Ameliorates Experimental Autoimmune Myocarditis in Rats
J. Immunol.,
September 15, 2006;
177(6):
3635 - 3643.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Brand, F. Beigel, T. Olszak, K. Zitzmann, S. T. Eichhorst, J.-M. Otte, H. Diepolder, A. Marquardt, W. Jagla, A. Popp, et al.
IL-22 is increased in active Crohn's disease and promotes proinflammatory gene expression and intestinal epithelial cell migration
Am J Physiol Gastrointest Liver Physiol,
April 1, 2006;
290(4):
G827 - G838.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2004 American Thoracic Society.
|