Published ahead of print on March 23, 2004, doi:10.1165/rcmb.2004-0038OC
American Journal of Respiratory Cell and Molecular Biology. Vol. 31, pp. 227-233, 2004
© 2004 American Thoracic Society DOI: 10.1165/rcmb.2004-0038OC
Oxysterols Trigger ABCA1-Mediated Basolateral Surfactant Efflux
Marianna Agassandian,
Satya N. Mathur,
Jiming Zhou,
F. Jeffrey Field and
Rama K. Mallampalli
Departments of Internal Medicine and Biochemistry, and the Department of Veterans Affairs Medical Center, Roy J. and Lucille A. Carver College of Medicine, University of Iowa, Iowa City, Iowa
Address correspondence to: Rama K. Mallampalli, M.D., Department of Internal Medicine, Pulmonary & Critical Care Division, C-33K, GH, University of Iowa College of Medicine, Iowa City, IA 52242. E-mail: rama-mallampalli{at}uiowa.edu
 |
Abstract
|
|---|
Surfactant is an apically-secreted surface-active material containing primarily disaturated phosphatidylcholine (DSPtdCho) that is released from alveolar epithelia into the alveolus. Surfactant deficiency is an important aspect of inflammatory lung disease and may result from extravasation of serum lipoproteins into the alveolus. We investigated whether one bioactive component of modified lipoproteins, oxysterols, might reduce surfactant PtdCho availability by altering its trafficking. The oxysterol, 22-hydroxycholesterol (22HC), in combination with its obligate partner, 9 cis-retinoic acid (RA), decreased surfactant PtdCho levels, in part, by stimulating basolateral phospholipid export in murine lung epithelia. 22HC/RA stimulated basolateral PtdCho efflux in cells via transcriptional activation of the ATP-binding cassette transporter 1 (ABCA1) gene. This effect was mediated by a DR-4 locus within the ABCA1 promoter. ABCA1 knockdown studies using ABCA1 siRNA or the ABCA1 inhibitor, glyburide, selectively attenuated 22HC/RA-driven basolateral PtdCho efflux. 22HC/RA significantly increased export of PtdCho molecular species containing saturated (16:0) fatty-acyl species typical of DSPtdCho. Overexpression of ABCA1 mimicked 22HC/RA effects by increasing cellular PtdCho efflux, whereas mutagenesis of ABCA1 at Trp590 attenuated PtdCho release. The results indicate the existence of an oxysterol-activated basolateral exit pathway for surfactant that might impact the availability of phospholipid destined for apical secretion.
Abbreviations: 22-hydroxycholesterol, 22HC ATP-binding cassette transporter 1, ABCA1 apolipoprotein AI, Apo AI disaturated phosphatidylcholine, DSPtdCho fetal bovine serum, FBS high-density lipoprotein, HDL low-density lipoprotein, LDL liver X receptor, LXR murine lung epithelia, MLE-12 phosphatidylcholine, PtdCho retinoic acid, RA RA receptor, RXR thin layer chromatography, TLC
 |
Introduction
|
|---|
Pulmonary surfactant is an essential mixture containing primarily disaturated phosphatidylcholine (DSPtdCho) and key hydrophobic proteins that provide stability to alveoli by lowering surface tension. Surfactant is synthesized within polarized alveolar type II epithelia and packaged within lamellar bodies, an intracellular storage form of surfactant, before secretion into the alveolar lumen via a well recognized apical secretory route. Deficiency of surfactant DSPtdCho contributes to the pathogenesis of the acute respiratory distress syndrome, a disorder characterized by leakage of serum proteins into the alveolus resulting in severe respiratory compromise (1, 2). Recent studies by us and others suggest that cholesterol-enriched low-density lipoproteins are important components of serum that accumulate in the alveolus, become oxidized, and have the ability to modify surfactant biophysical activity or impair DSPtdCho synthesis within alveolar type II epithelia (3, 4).
Oxysterols are oxygenated derivatives of cholesterol that are important constituents of oxidized low-density lipoproteins (LDL). Oxysterols are present in human lung and possess potent biological properties regulating diverse processes (5). Oxysterols control expression of several lipogenic genes via binding to liver X receptors (LXR), members of the nuclear receptor superfamily (6). As a prerequisite for nuclear transduction of oxysterol signaling, LXR receptors form heterodimers with the obligate partner 9-cis retinoic acid receptor (RXR) that binds to LXR/RXR response elements within target genes (6).
One recognized target of LXR/RXR ligands is the ATP-binding cassette transporter (ABC transporter) family of transmembrane proteins. The ATP-binding cassette transporter 1 (ABCA1) gene is oxysterol-regulated and involved in the efflux of cellular phospholipid and cholesterol from the plasma membrane (79). Transactivation of the ABCA1 promoter by LXR/RXR ligands results in expression of the transporter within the membrane triggering efflux of lipids to suitable acceptor proteins such as apoA1 and high-density lipoproteins (HDL) (1012). Presumably LXR/RXR induction of ABCA1 functions as an exquisite control mechanism to eliminate excess cellular lipids in reverse cholesterol transport.
Mutations within ABCA1 have been etiologically linked to a severe HDL deficiency syndrome, Tangier's Disease, a disorder characterized by premature atherosclerosis, organomegaly, ocular disease, and extensive cellular deposition of cholesterol. Although coexisting pulmonary disease has not been reported thus far, ABCA1 knockout mice have prominent pulmonary pathology. These mice die from respiratory failure secondary to pulmonary edema and widespread alveolar atelectasis. Alveolar type II epithelial cells in ABCA1-deficient mice exhibit scant, aberrant lamellar bodies with marked accumulation of lipid within type II cells (13). Recently, another member of the ABC family, ABCA3, was identified within lamellar bodies of alveolar epithelia (14, 15). This suggests that ABCA3 might be involved in the packaging of surfactant DSPtdCho that is destined for apical export into the alveolar lumen. However, the precise role of ABC transporters within these organelles, and perhaps more importantly, the purported role of "reverse" or basolateral lipid surfactant efflux in alveolar cells, is largely unknown. The identification of ABC transporters in alveolar epithelia coupled with phenotypic defects in murine models lacking ABCA1 led us to hypothesize that this transporter might be involved in surfactant PC trafficking.
In this study we investigated a surfactant phospholipid efflux pathway in response to LXR/RXR ligands in alveolar epithelia. We observed that LXR/RXR agonists diminish cellular PtdCho levels, in part, by triggering ABCA1-mediated basolateral phospholipid efflux. Cellular ABCA1 overexpression increased PtdCho export, and LXR/RXR agonists led to the elimination of PtdCho molecular species typical of surfactant. The data suggest that ABCA1 might serve as a regulatable lipid sensor involved in modulating overall surfactant lipid pool size in lung epithelia.
 |
Materials and Methods
|
|---|
Materials
22-(R) hydroxycholesterol (22HC) was purchased from Steraloids (Newport, RI). HDL were from Intracell (Frederick, MD). 9-cis-retinoic acid (9-cis RA) was obtained from Sigma Chemicals (St. Louis, MO). The murine lung epithelial (MLE-12) cell line was obtained from American Type Culture Collection (Manassas, VA). Hite's medium was from the University of Iowa Tissue Culture and Hybridoma Facility (Iowa City, IA). Transwell plates (24 mm, 0.4 µM) were obtained from Corning Inc. (Corning, NY). The ECL Western blotting detection system was from Pierce Biotechnology (Rockford, IL). The rabbit polyclonal antibody reactive to murine ABCA1 was from Novus Biologicals, (Littleton, CO). The silencer siRNA cocktail kit (RNase III) was from Ambion (Austin, TX). The Taqman reverse transcription reagents and SYBR Green PCR master mix were from Applied Biosystems (Foster City, CA). The Advantage cDNA polymerase and the SMART cDNA library construction kit was from Clontech, (Palo Alto, CA). The Geneclean2 Kit was obtained from Bio101 (Carlsbad, CA). The pCR-TOPO4 plasmids, superscript III RNase H- reverse transcriptase, scrambled siRNA, and Escherichia coli Top10 competent cells were obtained from Invitrogen (Carlsbad, CA), and FuGENE6 transfection reagent was purchased from Roche Diagnostics (Indianapolis, IN). All DNA sequencing was performed by the University of Iowa. The pGL3 basic and pSV-ß-galactosidase plasmids were from Promega (Madison, WI).
Cell Culture
MLE cells were maintained in Hite's medium with 2% fetal bovine serum (FBS) at 37°C in atmosphere containing 5% CO2. After reaching 70% confluence, the cells were harvested using 0.25% trypsin with 0.1% EDTA and plated onto either 12-well or 60-mm tissue culture dishes. After incubation overnight, the medium was removed and the cells rinsed three times with PBS, then incubated with Hite's medium alone (control medium) or in combination with various amounts of 22HC (25 µM) with or without 9-cis RA (1 µM) containing 20 µg/ml HDL or ApoA1 (the PtdCho acceptor) for up to 24 h. In some studies, cells were exposed to the ABCA1 inhibitor glyburide (250 µM) for 1 h before addition of 22HC and 9-cis RA. Cells lysates were prepared by brief sonication in Buffer A (150 mM NaCl, 50 mM Tris, 1.0 mM EDTA, 2 mM DTT, 0.025% sodium azide, 1 mM PMSF, pH 7.4) at 4°C.
PtdCho and DSPtdCho Analysis
Cells were cultured in Hite's medium (control medium), or medium containing agonists for up to 24 h. Total cellular lipids were extracted, PtdCho resolved using thin layer chromatography (TLC), and PtdCho mass was assayed by measuring lipid phosphorus content (16). For PtdCho efflux, cells were cultured either in 60-mm dishes or plated at a density of 90,000 cells within the upper chamber of 24-mm transwell dishes for 3 d in Hite's medium containing 2% FBS to generate confluent monolayers. Cells were rinsed twice with serum-free Hite's medium before pulsing cells with 1 µCi [methyl 3H]-choline chloride for 18 h in the presence or absence of 22HC (25 µM) with 9-cis RA (1 µM) and 20 µg/ml of HDL for 24 h. Lipids were extracted from medium in the apical or basolateral compartment and processed for PtdCho analysis using TLC and scintillation counting (3).
Synthesis of siRNA
RNA from mouse liver and kidney were isolated using Tri-Reagent and transcribed into cDNA with superscript III RNase H- reverse transcriptase. RT from the two tissues was pooled and used for PCR. Primers containing T7 promoter and mouse ABCA1 (Accession no. X75926.1, shown as underlined text) sequences were used to synthesize a 467 bp PCR product (sense primer 5'-taa tac gac tca cta tag gga gag aat ggg caa ttc gca aac t-3', antisense primer 5'-taa tac gac tca cta tag gga gat tcc cgg aaa cgc aag tc-3'). A quantity of 100 nM of each primer was used in the PCR mixture. PCR conditions were 95°C for 10 min followed by 40 cycles of 94°C for 30 s, 65°C for 1 min, 75°C for 2 min and a final extension step at 75°C for 10 min. This product was then used to synthesize dsRNA followed by siRNA using the silencer siRNA cocktail kit.
Immunoblot Analysis
Immunoblotting was performed as described (3). The dilution factor for anti-ABCA1 and ß-actin antibodies were 1:1,000.
Detection of Murine ABCA1 Transcripts Using Real-Time PCR Analysis
Total cellular RNA from MLE cells was obtained using Tri-Reagent. Taqman reverse transcription reagents (Applied Biosystems) were used to generate cDNA from cellular RNA. Real-time PCR was then performed on cDNA using the Applied Biosystems 7,700 real-time PCR instrument and the SYBR Green PCR master mix. ABCA1 transcript detection primers were: 5'-act agt gcc aag ttg ctc ag-3', and 5'-ctg ggt tag aga gat gca ca-3'. Taqman rodent 18S was used as the internal control using the following primers: 5'-taa gtc cct gcc ctt tgt aca ca-3', and 3' primer 5'-gat ccg agg gcc tca cta aac-3'.
Cloning of the Human ABCA1 Promoter
A 948-bp fragment of the proximal 5' flanking sequence of human ABCA1 (AF275948, 707/+241 [12]) was generated using PCR using the sense primer: 5'-gac tcg agc agt aag atg ttc ctc tcg-3' and antisense primer: 5'-aga tct gtc act gga gag cct ctt acc-3'. The cloned fragment included the proximal 5' flanking region, transcription start sites and up to 241 nt of the first exon, containing the TATA box and the DR-4 element (12). This fragment was purified and directionally cloned into pCR4-TOPO, and plasmids mini-preps verified by DNA sequencing; the fragment was then directionally cloned into pGL3 basic using BglII/KpnI sites, generating pGL3-ABCA1948. A 644-bp human ABCA1 core promoter fragment (AF258623, 618/+26 [17]) was also generated using the same PCR procedure using the sense primer 5'-gac tcg agc agt aag atg ttc ctc tcg-3' and antisense primer 5'-aga tct tac tat cgg tca aag cct g-3'. This fragment was then directionally cloned into pGL3-basic generating pGL3-ABCA1644. It included the proximal 5' flanking region, the transcription start site, and up to 26 nt of the first exon corresponding to the 5' untranslated region of the human ABCA1 transcript but lacked the DR-4 element (17).
Cloning of Murine ABCA1
The cDNA encoding the open reading frame (ORF) for mouse ABCA1 gene (NCBI accession no. NM013454) was generated using mouse liver cDNA as a template, using three sets of primers: for cloning of fragment 1, sense primer: 5-ggtaccgccatgccgtctgcaggaac-3 and antisense primer: 5-ggatccacccacgaaggccaag-3; for fragment 2, sense primer: 5-gggatgcagagaaagctgtctg-3 and antisense primer: 5-g acacgaggacgtcgacagagg-3; for fragment 3, sense primer: 5-cctctgtcgacgtcctcgtgtc-3 and antisense primer: 5-tctagacctttcattcaccctgtgtg-3 in a two-step PCR amplification using Advantage 2 cDNA polymerase under the following reaction conditions: 94°C 2 min; 94°C 30 s, 68°C 3 min, 25 cycles. Amplification resulted in generation of three PCR fragments, 3 kb, 1.8 kb, and 2 kb in size. These fragments were purified using the Geneclean2 kit, cloned into pCR4-TOPO, and plasmids minipreps prepared. After verification by DNA sequencing, a clone of fragment 1 was digested by Kpn1/BamH1; fragment 2 by BamH1/Aat2; and fragment 3 by Aat2/Xba1; digestion products were purified and ligated into a pcDNA3.1-V5-His-B expression vector previously digested with Kpn1/Xba1, generating pcDNA-ABCA1 containing full-length ABCA1. The construct was verified by partial DNA sequencing.
Construction of a Murine ABCA1 Mutant
A single aminoterminal ABCA1 mutant (ABCA1W590S, where Trp590 was mutated to Ser590 [18]) was generated using the QuikChange2 XL Site-Directed Mutagenesis kit. The oligonucleotides used were: gaagatatgcgctatgtctcgggcggcttcgcctacttgc (sense) and gcaagtaggcgaagccgcccgagacatag gcatatcttc (antisense), and pcDNA-ABCA1 plasmid DNA as a template. PCR conditions were as follows: 95°C for 1 min, 18 cycles at 95°C for 50 s, 60°C for 50 s, and 68°C for 13 min, then extended for 7 min at 68°C. The construct was verified by partial DNA sequencing.
Transfectional Analysis
Cells were transfected with full-length or mutant ABCA1 plasmids, ABCA1 siRNA, or pGL3ABCA1 plasmids. For ABCA1 siRNA transfection, MLE cells grown on 6-well transwells or 60-mm dishes were labeled with 3H-choline for 24 h with or without 25 µM 22HC and 1 µM RA. After removal of medium at 24 h and washing of the apical and basal chambers, the cells were transfected by adding 0.5 ml of Hite's medium containing 100 nM siRNA and 0.65 µl Fugene6 reagent. After 4 h, the apical medium was diluted with 1 ml of Hite's medium. All media contained 20 µg/ml HDL. Apical and basal medium was collected 24 h later and analyzed for efflux of PtdCho.
For expression of full-length or mutant ABCA1, cells were transfected with 24 µg of full-length ABCA1 plasmid and pulsed with 3H-choline the last 24 h of incubation before harvest. For analysis of ABCA1 promoter activity, cells were plated into 12-well tissue culture dishes and allowed to reach 70% confluence before transient transfection. Transfections were performed for 2 h in serum-free medium using Fugene 6 and 0.75 µg/well of pGL3-ABCA1 plasmid. Cells were co-transfected 0.25 µg/well of pSV-ß-galactosidase to control for transfection efficiency. Cell lysates were harvested in reporter lysis buffer for analysis of luciferase and ß-galactosidase activities.
Fatty Acid Analysis
Lipids were extracted from cell lysates (1 mg protein) according to the method of Bligh and Dyer (19). Lipids were resolved using TLC and samples that co-migrated with PtdCho standard were scraped from the gel, and lipids eluted before generation of fatty acid methyl esters as prepared by transmethylation in the presence of 10% boron trifluoride (20). The fatty acid methyl ester derivatives were separated by gas liquid chromatography (GLC) and detected using flame ionization. The GC column packing was 10% SP-2330 on 100/120 Chromosorb W AW (Supelco, Inc., Bellefonte, PA). The initial column temperature was held at 165°C for 8 min, then increased at a rate of 3°C/min to a final temperature of 210°C, which was maintained for 12 min. Individual fatty acids were identified by comparing the retention times with that of known standards.
Statistical Analysis
Statistical analysis was performed using the one-way ANOVA or a Student's t test (21). Data are presented as means ± SEM.
 |
Results
|
|---|
LXR/RXR Agonists Decrease PtdCho
Incubation of MLE cells with 22HC and 9-cis RA significantly decreased the mass of PtdCho by 31% within MLE cells (n = 12, P < 0.05, Figure 1A). We next investigated if these effects were associated with increased PtdCho efflux (Figure 1B). Murine lung epithelia constitutively secreted PtdCho into the medium, a process that was stimulated 4-fold by 22HC and 9-cis RA when cultured on plastic dishes (Figure 1B).

View larger version (17K):
[in this window]
[in a new window]
|
Figure 1. LXR/RXR agonists decrease PtdCho. (A) MLE cells were incubated in serum-free medium supplemented with or without 22HC (25 µM) and 9-cis RA (1 µM) for 24 h. Levels of total cellular PtdCho mass were determined using a phosphorus assay. (B) Effects of 22HC/9-cis RA on PtdCho efflux on cells cultured on plastic dishes was assayed by pulsing cells with 1 µCi [3H]-choline for 18 h in the presence or absence of 22HC (25 µM) with 9-cis RA (1 µM) for 24 h. Release of radiolabeled PtdCho in the medium was then measured. *P < 0.05 for 22HC and 9 cis-RA versus control. Values are mean ± SEM from three independent experiments.
|
|
LXR/RXR Agonists Transcriptionally Activate ABCA1 in Lung Epithelia
We investigated if 22HC and 9-cis RA increased PtdCho efflux by increasing ABCA1 levels. 22HC and 9-cis RA uniformly produced a robust increase in cellular levels of ABCA1 protein between 3 and 48 h of analysis (Figures 2A and 2B). In these studies we used a commercially available ABCA1 antibody generated against synthetic ABCA1 peptide. The antibody cross-reacts with both human and murine ABCA1. Although the antibody reacts with several lower molecular weight bands, detection of the desired product was made by demonstrating selective induction of ABCA1 protein by 22HC and 9-cis RA coupled with a predicted molecular mass of 200 kD (Figure 2C). Real-time PCR revealed that these ligands produced a 3- to 5-fold increase in expression of the ABCA1 transcript (Figure 3A). These findings suggest that LXR/RXR agonists transcriptionally activate the ABCA1 gene. The ABCA1 gene is activated by an LXR/RXR-dependent pathway via binding of 22HC and 9-cis RA ligands to LXR and RXR nuclear heterodimers, respectively, resulting in transactivaton of its promoter within a specific response motif (DR-4 locus). To examine this in lung epithelia, we cloned two fragments of the ABCA1 promoter (ABCA1644 and ABCA1948), coupled them to a reporter gene, and performed transient transfections to assess transcriptional regulatory activity. The ABCA1644 construct lacks a DR-4 element, whereas the ABCA1948 fragment contains this response element. As shown in Figures 3B and 3C, the LXR/RXR ligands selectively activated ABCA1948 promoter activity but did not stimulate ABCA1644 activity. Thus, oxysterols induce ABCA1 by a DR-4 dependent pathway in lung epithelia.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 2. LXR/RXR agonists increase immunoreactive ABCA1 levels in lung epithelia. (A) ABCA1 protein and ß-actin levels (lower three panels) were determined by immunoblotting. MLE cells were incubated for various times with or without 22HC (25 µM) and 9-cis RA (1 µM). Cell lysates (50 µg protein) were separated by SDS-10% polyacrylamide gel electrophoresis, transferred to nitrocellulose, and probed with an anti-ABCA1 rabbit polyclonal antibody (A), or polyclonal antibody to ß-actin (lower three panels). (B) Densitometric analysis of immunoblots showing the relative amount of immunoreactive proteins corrected for ß-actin loading using arbitrary densitometric values. Results are mean ± SEM from three independent experiments. Filled bars, control; open bars, 22HC/RA. (C) A representative immunoblot from A (48 h) showing selective induction of the ABCA1 protein at a predicted molecular mass of 200 kD.
|
|

View larger version (14K):
[in this window]
[in a new window]
|
Figure 3. LXR/RXR agonists transcriptionally induce ABCA1 expression in lung epithelia. (A) MLE cells were cultured with or without 22HC (25 µM) with 9-cis RA (1 µM) for various times and total cellular RNA was harvested for analysis of ABCA1 transcripts by real-time PCR. Values are expressed as the mean ± SEM of relative units, which were first normalized to murine 18S. (B and C) MLE cells were transiently transfected with two pGL3-ABCA1 reporter constructs, ABCA1948 (B) or ABCA1644 (C) that harbor or lack a critical LXR/RXR response motif (DR-4), respectively. Cells were transfected with either promoter-reporter plasmid and after a 4-h recovery period subsequently exposed for 3 h or 24 h in medium with or without LXR/RXR ligands as above. ABCA1 promoter activity was then assayed by analysis of luciferase activity after controlling for transfection efficiency using pSV-ß-galactosidase activity. *P < 0.05 versus control. Values are expressed as mean ± SEM from three independent experiments. Filled bars, 22HC/RA; open bars, control.
|
|
LXR/RXR Agonists Stimulate PtdCho Efflux
To separate apical from basolateral secretion, we cultured cells in transwell dishes (Figure 4A). Under stimulatory conditions using 22HC and 9-cis RA, there was a 2- to 3-fold increase in apical (Figure 4A, inset) and basolateral efflux of PtdCho from cells (Figure 4A). Interestingly, only agonist-induced basolateral PtdCho efflux was blocked by glyburide, an ABCA1 inhibitor (Figure 4A).

View larger version (37K):
[in this window]
[in a new window]
|
Figure 4. ABCA1 is an oxysterol-sensitive basolateral exporter for surfactant PtdCho. (A) Effects of 22HC and 9-cis RA on PtdCho efflux on the basolateral and apical route (inset) was assayed by plating cells in transwell dishes containing 20 µg/ml of HDL and labeling with [3H]-choline. Cells were exposed to glyburide (250 µM) alone for 1 h or in combination with LXR/RXR agonists as in Figure 1. Filled bars, control; vertically striped bars, 22HC/RA; open bars, glyburide; diagonally striped bars, glyburide + 22HC/RA. (BD) ABCA1 mRNA silencing. Cells were labeled with [methyl 3H]-choline with or without 22HC and 9-cis RA for 24 h and basolateral or apical medium was initially removed for PtdCho efflux analysis (see C and D, left bars, 24 h). Cells were then rinsed and transfected with ABCA1 siRNA (100 nM siRNA) using 0.65 µL Fugene6 for an additional 24 h in medium devoid of 22HC and 9-cis RA. (B) Cells treated with or without 22HC/RA for 24 h were concurrently exposed to ABCA1 siRNA or scrambled siRNA (SCRMsi) and processed for ABCA1 immunoblotting. (C and D) Lipids were extracted from medium in apical or basolateral compartments after 24 h with or without agonists or ABCA1 siRNA treatment (48 h) and processed for PtdCho analysis. Filled bars, control; vertically striped bars, 22HC/RA; open bars, control + ABCA1 si; diagonally striped bars, 22HC/RA + ABCA1 si. For A (basolateral) and D, *P < 0.05 versus control, or versus control plus ABCA1 si (D), +P < 0.001 versus all other groups (A) and ++P < 0.01 versus 24 h control (D); for C, *P < 0.05 versus groups receiving ABCA1 si treatment, xP = 0.07 versus 22HC and 9 cis-RA group, and ++P < 0.01 versus 24 h control. For A (inset), *P < 0.05, +P < 0.001, and ++P < 0.01 for each group versus glyburide in combination with 22HC and 9 cis-RA group as determined using an ANOVA. Values are mean ± SEM from three independent experiments.
|
|
As a complementary approach, we transfected cells with siRNA to ABCA1 (Figures 4B4D). Cells were labeled with [methyl 3H]-choline with or without 22HC and 9-cis RA for 24 h, and basolateral or apical medium was initially removed for analysis of PtdCho efflux. Cells were then rinsed and transfected with ABCA1 siRNA for an additional 24 h devoid of 22HC and 9-cis RA in the medium. Immunoblotting at 48 h confirmed that ABCA1 siRNA, unlike scrambled siRNA, reduced levels of ABCA1 protein without altering ß-actin levels compared with control (Figure 4B). Analysis of [methyl 3H]-PtdCho efflux within the basolateral or apical medium at 24 h confirmed that 22HC and 9-cis RA significantly stimulated phospholipid release (Figures 4C and 4D). Assays conducted on basolateral medium (Figure 4C) at 48 h revealed that 22HC and 9-cis RA still produced nearly a 60% increase in PtdCho efflux above control (P = 0.07); moreover, exposure to ABCA1 siRNA totally blocked agonist-induced basolateral PtdCho efflux (P < 0.05). In contrast, ABCA1 siRNA did not attenuate 22HC and 9-cis RA stimulation of the apical PtdCho export pathway (Figure 4D). Together, the data suggest that alveolar lung epithelia harbor an oxysterol-sensitive basolateral ATP-binding cassette transporter involved in phospholipid export. These effects of 22HC and 9-cis RA on PtdCho efflux results in diminished availability of surfactant phospholipids.
Upregulation of ABCA1 Increases PtdCho Efflux Selectively
To examine if ABCA1 directly stimulates PtdCho export within alveolar epithelia, we transiently expressed full-length ABCA1 in MLE cells. We also examined whether 22HC/9-cis RA selectively eliminated PtdCho species distinct from DSPtdCho. As shown in Figures 5A and 5B, transient transfection of cells resulted in increased immunoreactive ABCA1 content. The efflux of total PtdCho increased 2-fold after ABCA1 expression compared with untransfected cells (Figure 5C). Moreover, expression of an ABCA1 construct harboring a mutation at Trp590 resulted in partial loss of efflux activity as it was only 65% as active as wild-type ABCA1 (Figure 5D).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 5. ABCA1 upregulation triggers efflux of PtdCho selectively in lung epithelia. (A and B) MLE cells were incubated in medium containing 20 µg/ml of HDL, transfected with or without full-length (wild-type) ABCA1 plasmid (2 µg) for 90 min, and subsequently pulsed with 1 µCi [3H]-choline the final 2 h of incubation. Cells were harvested and lysates processed for ABCA1 (A) or ß-actin (B) immunoblotting. (C) Supernatant lipids from the above experiments were extracted and radioactivity in effluxed [3H] PC was determined. *P < 0.05 versus control. (D) Cells were transiently transfected with or without a full-length ABCA1 plasmid or an ABCA1 variant (ABCA1W590S) harboring a point mutation where Trp590 was mutated to Ser590. Cells were pulsed with [3H]-choline as above and processed for PtdCho efflux. Results are corrected for baseline efflux in untransfected cells and data expressed as percent above control efflux. *P < 0.05 versus control. Values are expressed as mean ± SEM from four independent experiments.
|
|
In separate studies, murine lung epithelia were cultured in serum- and fatty acidfree medium containing the lipid acceptor, Apo AI, in the presence or absence of 22HC/9-cis RA. After stimulation, medium was harvested, lipids extracted, PtdCho isolated using TLC, and processed for analysis of fatty acid molecular species using GLC. Cells were observed to constitutively release PtdCho into the medium containing high levels of the polyunsaturates (20:4/20:1), monounsaturates (18:1), and saturated species (16:0/18:0). Moreover, upregulation of ABCA1 by 22HC and 9-cis RA tended to decrease linoleic acid (18:2) efflux and significantly increase in export of PtdCho species containing saturated (16:0) molecular species into the medium (Table 1). The results suggest that both genetic and pharmacologic manipulation of ABCA1 activity can result in the export of PtdCho from lung epithelia, and that oxysterols selectively trigger elimination of surfactant-associated phospholipids.
View this table:
[in this window]
[in a new window]
|
TABLE 1. Effect of 22-hydroxycholesterol and 9-cis retinoic acid on composition of phosphatidylcholine fatty acid molecular species effluxed from murine lung epithelia
|
|
 |
Discussion
|
|---|
These results provide evidence of a viable ABCA1-mediated basolateral export pathway for surfactant PtdCho in polarized alveolar epithelia under transcriptional control by oxysterols. We used pharmacologic and genetic strategies to modulate ABCA1 activity providing evidence in support of a functional ABCA1 transporter in lung epithelia. The data further show that oxysterol-activation of ABCA1 results in export of saturated PtdCho species typical of surfactant films. The pathophysiologic significance of these studies is that in acute lung injury, leakage of circulating LDL into the alveolus under an oxidant stress results in formation of oxidatively modified particles (Ox-LDL) containing oxysterols (3, 4). Ox-LDL not only decrease surfactant synthesis (3), but the present results suggest that bioactive components within LDL might also impact cellular phospholipid levels by modulating release of surfactant-like PtdCho species via basolateral alveolar export. Ultimately, this could lead to diminished pools of surfactant needed to maintain alveolar stability.
The existence of a constitutively active basolateral PtdCho efflux route provides additional complexity to the existing model whereby surfactant PtdCho is synthesized, stored, and released from the alveolar type II epithelium. The classic secretory pathway for PtdCho involves biosynthesis within the cytoplasmic compartment, packaging into lamellar bodies with other surfactant apoproteins, and agonist-induced apical secretion into the alveolar lumen. Once within the alveolus, the surfactant film undergoes significant modification morphologically and biochemically; apical re-uptake of both lipid and protein components is well described (22). The current results show constitutive and inducible apical and basolateral release of PtdCho from alveolar cells; oxysterol-stimulated apical release might be mediated by second messengers well recognized in surfactant lipid secretion such as protein kinase C (23). Consistent with this, apically-stimulated PtdCho export by 22HC and 9-cis RA was partially blocked by the protein kinase C inhibitor, sphingosine (data not shown). On the other hand, it is plausible that different members of the ABC family export PtdCho apically, whereas basolateral phospholipid efflux is ABCA1-mediated. In this regard, several other ABC pumps are targets for 22HC and 9-cis RA (24). Moreover, these half-transporters, such as ABCG5 and ABCG8, have recently been identified in apical membranes within polarized epithelia (25). Thus, our data in Figure 4 showing oxysterol stimulation of apical PtdCho secretion that is not blocked by ABCA1 siRNA is in line with distinct pathways involved in apical surfactant lipid secretion catalyzed perhaps by other ABC transport pumps.
The identification of a basolateral surfactant lipid efflux pathway in alveolar cells that is LXR/RXR- regulated appears to be driven by ABCA1 as this route, but not the apical pathway, was glyburide sensitive (Figure 4). By using an mRNA silencing approach, we were also able to selectively inhibit this basolateral efflux pathway, demonstrating that ABCA1 is a functionally relevant and likely polarized protein within alveolar epithelia presumably involved in reverse lipid transport. In the process of preparation of this manuscript, Bortnick and coworkers recently demonstrated existence of an LXR/RXR-sensitive ABCA1 protein in rodent alveolar epithelia, leading the authors to hypothesize that ABCA1 might partake in lung cholesterol homeostasis (26). Although ABCA1 is a well characterized cholesterol exporter, some studies suggest that phospholipids may be primary substrates for ABCA1 (27, 28). Our studies are distinct from that of Bortnick and colleagues and from those of others in that we pursued a complementary hypothesis that ABCA1 activation might selectively release PtdCho basolaterally, with varying molecular composition. This was achieved by using a transwell system to allow biochemical analysis of both apical and basolateral pathways. To our knowledge, these data are the first showing the molecular species of PtdCho released in response to ABCA1 activation. Murine lung cells released large amounts of polyunsaturates, monounsaturates, and saturated species to Apo AI under native conditions (Table 1). This fatty acid profile is not consistent with highly conserved mammalian surfactant, but is suggestive of PtdCho species observed in serum and within rodent type II epithelia (29, 30). Further, the results might indicate a novel role for ABCA1 or other related efflux pumps such as multidrug-resistant glycoproteins in enriching type II epithelia with DSPtdCho by eliminating unsaturated PtdCho. In contrast to this baseline pattern of efflux, 22HC/9-cis RA increased export of 16:0 PtdCho species to Apo AI, suggesting that agonist-induced activation of ABCA1 might contribute significantly to trafficking of surfactant-associated phospholipids. Overall, these data suggest that ABCA1 functions in a capacity to eliminate excess phospholipid from type II epithelia. This might simply be a mechanism by which alveolar cells tightly control steady-state PtdCho content, or a means to avoid cellular lipotoxicity as observed elseware (31); however, the prospect that ABCA1 is a basolateral exporter of nonsurfactant phospholipids allowing for these cells to acquire the type II cell lipophenotype is an attractive possibility but will require comparative analysis with other epithelia and as well as within primary type II cell isolates.
To investigate the structural basis for lung epithelial PtdCho efflux, we engineered a point mutation within ABCA1 at Trp590 and expressed this variant in MLE cells. There are over thirty ABCA1 mutations in patients with Tangier's Disease, but recent loss-of-function studies suggest that such mutations within the first extracellular loop of the transporter's primary structure results in markedly attenuated phospholipid efflux (18, 32, 33). Accordingly, the ABCA1590 construct compared with control was observed to exhibit significantly lower rates of PtdCho efflux in MLE cells. However, in lung epithelia this mutation alone did not completely abolish or drastically eliminate PtdCho efflux as observed elsewhere (18); this raises the possibility that additional sites or distinct hydrophobic domains within ABCA1 might confer activity or exhibit differential binding affinities for various PtdCho species.
Our studies do not define the relative contribution of ABCA1 mediated basolateral lipid efflux of PtdCho to the overall model of surfactant secretion and recycling, but presumably, a delicate balance between apical and basolateral export, when perturbed, might impact the cellular reserve of surfactant lipid. Another related flipase, ABCA3, is exclusively detected in lung lamellar bodies and thus might complement ABCA1 activity providing a level of redundancy or coordinate intracellular transport of phospholipid destined for apical export (14, 15). The fact that targeted disruption of the ABCA1 gene in mice results in respiratory failure, reduced serum phospholipids, and striking accumulation of lipid within type II cells provides support to the supposition that ABCA1 might regulate surfactant trafficking in vivo. (13). Although alveolar PtdCho levels were not measured in this study, the results are consistent with our data showing that manipulation of ABCA1 expression in lung epithelia can significantly regulate surfactant PtdCho balance. In this regard, 22HC/9-cis RA treatment led to increased transporter expression and basolateral efflux of PtdCho resulting in decreased phospholipid mass.
Finally, LXR/RXR ligand activation of ABCA1 transporter activity clearly resulted from increased gene transcription as evidenced by our protein, mRNA, and transfectional studies using ABCA1 promoterreporter constructs. To date, the characterization and regulation of two distinct proximal promoters for ABCA1 has been reported (28, 34). Our ABCA1644 construct harbors a weak TATA box, lacks a DR-4 element, and shows weak activity. A larger promoter fragment (ABCA1948) was also cloned in view of studies suggesting different transcription initiation sites (35). This construct harbors a TATA box and a DR-4 element that appears to confer more robust core activity (35, 36). Indeed, transactivation of ABCA1 in alveolar cells by 22HC and 9-cis RA was dependent on the DR-4 locus within the proximal 5' flanking region of the gene. Further studies on the role of oxysterols in ABCA1 transcriptional activation using promoter-reporter mice or other suitable in vivo models will be important in clarifying the contribution of these efflux pumps to surfactant metabolism.
 |
Acknowledgments
|
|---|
The authors thank Dr. P. Burns, Diann McCoy, and Brian Wagner for technical assistance. This study was supported by a Merit Review Award from the Office of Research & Development, Department of Veterans Affairs, NIH RO1 Grants HL68135, HL55584, and HL71040 (to R.K.M.).
 |
Footnotes
|
|---|
Conflict of Interest Statement: M.A. has no declared conflicts of interest; S.N.M. has no declared conflicts of interest; J.Z. has no declared conflicts of interest; F.J.F. has no declared conflicts of interest; R.K.M. has no declared conflicts of interest.
Received in original form February 3, 2004
Received in final form March 13, 2004
 |
References
|
|---|
- Holm, B. A., and R. H. Notter. 1987. Effects of hemoglobin and cell membrane lipids on pulmonary surfactant activity. J. Appl. Physiol. 63:14341442.[Abstract/Free Full Text]
- Emmett, M., A. A. Fowler, T. M. Hyers, and A. J. Crowle. 1987. Crossed immunoelectrophoretic analysis of ARDS lavage proteins. Proc. Soc. Exp. Biol. Med. 184:8391.[Abstract]
- Zhou, J., A. J. Ryan, J. Medh, and R. K. Mallampalli. 2003. Oxidized lipoproteins inhibit surfactant phosphatidylcholine synthesis via calpain mediated cleavage of CTP:phosphocholine cytidylyltransferase. J. Biol. Chem. 278:3703237040.[Abstract/Free Full Text]
- Heeley, E. L., J. M. Hohlfeld, N. Krug, and A. D. Postle. 2000. Phospholipid molecular species of bronchoalveolar lavage fluid after local allergen challenge in asthma. Am. J. Physiol. 278:L305L311.
- Bjorkhem, I., S. Meaney, and U. Diczfalusy. 2002. Oxysterols in human circulation: which role do they have? Curr. Opin. Lipidol. 13:247253.[CrossRef][Medline]
- Edwards, P. A., M. A. Kennedy, and P. A. Mak. 2002. LXRs; oxysterol-activated nuclear receptors that regulate genes controlling lipid homeostasis. Vascul. Pharmacol. 38:249256.[CrossRef][Medline]
- Chen, W., Y. Sun, C. Welch, A. Gorelik, A. R. Leventhal, I. Tabas, and A. R. Tall. 2001. Preferential ATP-binding cassette transporter A1-mediated cholesterol efflux from late endosomes/lysosomes. J. Biol. Chem. 276:4356443569.[Abstract/Free Full Text]
- Feng, B., and I. Tabas. 2002. ABCA1-mediated cholesterol efflux is defective in free cholesterol-loaded macrophages: mechanism involves enhanced ABCA1 degradation in a process requiring full NPC1 activity. J. Biol. Chem. 277:4327143280.[Abstract/Free Full Text]
- Venkateswaran, A., B. A. Laffitte, S. B. Joseph, P. A. Mak, D. C. Wilpitz, P. A. Edwards, and P. Tontonoz. 2000. Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR alpha. Proc. Natl. Acad. Sci. USA 97:1209712102.[Abstract/Free Full Text]
- Schmitz, G., T. Langmann, and S. Heimerl. 2001. Role of ABCG1 and other ABCG family members in lipid metabolism. J. Lipid Res. 42:15131520.[Abstract/Free Full Text]
- Wang, N., D. L. Silver, C. Thiele, and A. R. Tall. 2001. ATP-binding cassette transporter A1 (ABCA1) functions as a cholesterol efflux regulatory protein. J. Biol. Chem. 276:2374223747.[Abstract/Free Full Text]
- Costet, P., Y. Luo, N. Wang, and A. R. Tall. 2000. Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor. J. Biol. Chem. 275:2824028245.[Abstract/Free Full Text]
- McNeish, J., R. J. Aiello, D. Guyot, T. Turi, C. Gabel, C. Aldinger, K. L. Hoppe, M. L. Roach, L. J. Royer, J. de Wet, C. Broccardo, G. Chimini, and O. L. Francone. 2000. High density lipoprotein deficiency and foam cell accumulation in mice with targeted disruption of ATP-binding cassette transporter-1. Proc. Natl. Acad. Sci. USA 97:42454250.[Abstract/Free Full Text]
- Yamano, G., H. Funahashi, O. Kawanami, L. X. Zhao, N. Ban, Y. Uchida, T. Morohoshi, J. Ogawa, S. Shioda, and N. Inagaki. 2001. ABCA3 is a lamellar body membrane protein in human lung alveolar type II cells. FEBS Lett. 508:221225.[CrossRef][Medline]
- Mulugeta, S., J. M. Gray, K. L. Notarfrancesco, L. W. Gonzales, M. Koval, S. I. Feinstein, P. L. Ballard, A. B. Fisher, and H. Shuman. 2002. Identification of LBM180, a lamellar body limiting membrane protein of alveolar type II cells, as the ABC transporter protein ABCA3. J. Biol. Chem. 277:2214722155.[Abstract/Free Full Text]
- Mallampalli, R. K., A. J. Ryan, R. G. Salome, and S. Jackowski. 2000. Tumor necrosis factor-
inhibits expression of CTP:Phosphocholine cytidylyltransferase. J. Biol. Chem. 275:96999708.[Abstract/Free Full Text]
- Pullinger, C. R., H. Hakamata, P. N. Duchateau, C. Eng, B. E. Aouizerat, M. H. Cho, C. J. Fielding, and J. P. Kane. 2000. Analysis of hABC1 gene 5' end: additional peptide sequence, promoter region, and four polymorphisms. Biochem. Biophys. Res. Commun. 271:451455.[CrossRef][Medline]
- Tanaka, A. R., S. Abe-Dohmae, T. Ohnishi, R. Aoki, G. Morinaga, K. Okuhira, Y. Ikeda, F. Kano, M. Matsuo, N. Kioka, T. Amachi, M. Murata, S. Yokoyama, and K. Ueda. 2003. Effects of mutations of ABCA1 in the first extracellular domain on subcellular trafficking and ATP binding/hydrolysis. J. Biol. Chem. 278:88158819. (erratum appears in J Biol Chem. 2003;278:14586)[Abstract/Free Full Text]
- Bligh, E. G., and W. J. Dyer. 1959. A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 37:911917.
- Ryan, A. J., J. D. Medh, D. M. McCoy, R. G. Salome, and R. K. Mallampalli. 2002. Maternal loading with very low-density lipoproteins stimulates fetal surfactant synthesis. Am. J. Physiol. 283:L310L318.
- Rosner, B. A. 1995. Fundamentals of Biostatistics. Wadsworth Publishing Co., Belmont, CA.
- Wright, J. R. 1990. Clearance and recycling of pulmonary surfactant. Am. J. Physiol. 259:L112.
- Rooney, S. A., S. L. Young, and C. R. Mendelson. 1994. Molecular and cellular processing of lung surfactant. FASEB J. 8:957967.[Abstract]
- Tontonoz, P., and D. J. Mangelsdorf. 2003. Liver X receptor signaling pathways in cardiovascular disease. Mol. Endocrinol. 17:985993.[Abstract/Free Full Text]
- Graf, G. A., W. P. Li, R. D. Gerard, I. Gelissen, A. White, J. C. Cohen, and H. H. Hobbs. 2002. Coexpression of ATP-binding cassette proteins ABCG5 and ABCG8 permits their transport to the apical surface. J. Clin. Invest. 110:659669.[CrossRef][Medline]
- Bortnik A. E., E. Favari, J. Q. Tao, O. L. Francone, M. Reilly, Y. Zhang, G. H. Rothblat, and S. R. Bates. 2003. Identification and characterization of rodent ABCA1 in isolated type II pneumocytes. Am. J. Physiol. 285:L869L878.
- Wang, N., D. L. Silver, C. Thiele, and A. R. Tall. 2001. ATP-binding cassette transporter A1 (ABCA1) functions as a cholesterol efflux regulatory protein. J. Biol. Chem. 276:2374223747.
- Santamarina-Fojo, S., A. T. Remaley, E. B. Neufeld, and H. B. Brewer, Jr. 2001. Regulation and intracellular trafficking of the ABCA1 transporter. J. Lipid Res. 42:13391345.[Abstract/Free Full Text]
- Postle, A. D., E. L. Heeley, and D. C. Wilton. 2001. A comparison of the molecular species compositions of mammalian lung surfactant phospholipids. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 129:6573.[CrossRef][Medline]
- Hradec, J., P. Dufek, and M. Matucha. 1998. Quantitation of individual molecular species of phosphatidylcholines by reversed-phase high-performance liquid chromatography with fluorometric detection. J. Chromatogr. B Biomed. Sci. Appl. 714:145151.[CrossRef][Medline]
- Unger, R. H. 2003. The physiology of cellular liporegulation. Annu. Rev. Physiol. 65:333347.[CrossRef][Medline]
- Attie, A. D., Y. Hamon, A. R. Brooks-Wilson, M. P. Gray-Keller, M. L. MacDonald, V. Rigot, A. Tebon, L. H. Zhang, J. D. Mulligan, R. R. Singaraja, J. J. Bitgood, M. E. Cook, J. J. Kastelein, G. Chimini, and M. R. Hayden. 2002. Identification and functional analysis of a naturally occurring E89K mutation in the ABCA1 gene of the WHAM chicken. J. Lipid Res. 43:16101617.[Abstract/Free Full Text]
- Fitzgerald, M. L., A. L. Morris, J. S. Rhee, L. P. Andersson, A. J. Mendez, and M. W. Freeman. 2002. Naturally occurring mutations in the largest extracellular loops of ABCA1 can disrupt its direct interaction with apolipoprotein A-I. J. Biol. Chem. 277:3317833187.[Abstract/Free Full Text]
- Singaraja, R. R., V. Bocher, E. R. James, S. M. Clee, L. H. Zhang, B. R. Leavitt, B. Tan, A. Brooks-Wilson, A. Kwok, N. Bissada, Y. Z. Yang, G. Liu, S. R. Tafuri, C. Fievet, C. L. Wellington, B. Staels, and M. R. Hayden. 2001. Human ABCA1 BAC transgenic mice show increased high density lipoprotein cholesterol and ApoAI-dependent efflux stimulated by an internal promoter containing liver X receptor response elements in intron 1. J. Biol. Chem. 276:3396933979.[Abstract/Free Full Text]
- Costet, P., Y. Luo, N. Wang, and A. R. Tall. 2000. Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor. J. Biol. Chem. 275:2824028245.
- Langmann, T., M. Porsch-Ozcurumez, S. Heimerl, M. Probst, C. Moehle, M. Taher, H. Borsukova, D. Kielar, W. E. Kaminski, E. Dittrich-Wengenroth, and G. Schmitz. 2002. Identification of sterol-independent regulatory elements in the human ATP-binding cassette transporter A1 promoter: role of Sp1/3, E-box binding factors, and an oncostatin M-responsive element. J. Biol. Chem. 277:1444314450.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
S. R. Bates, J.-Q. Tao, K. J. Yu, Z. Borok, E. D. Crandall, H. L. Collins, and G. H. Rothblat
Expression and Biological Activity of ABCA1 in Alveolar Epithelial Cells
Am. J. Respir. Cell Mol. Biol.,
March 1, 2008;
38(3):
283 - 292.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. V. Andreeva, M. A. Kutuzov, and T. A. Voyno-Yasenetskaya
Regulation of surfactant secretion in alveolar type II cells
Am J Physiol Lung Cell Mol Physiol,
August 1, 2007;
293(2):
L259 - L271.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Delvecchio, P. Bilan, K. Radford, J. Stephen, B. L. Trigatti, G. Cox, K. Parameswaran, and J. P. Capone
Liver X Receptor Stimulates Cholesterol Efflux and Inhibits Expression of Proinflammatory Mediators in Human Airway Smooth Muscle Cells
Mol. Endocrinol.,
June 1, 2007;
21(6):
1324 - 1334.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Farke, E. Viturro, H. H. D. Meyer, and C. Albrecht
Identification of the bovine cholesterol efflux regulatory protein ABCA1 and its expression in various tissues
J Anim Sci,
November 1, 2006;
84(11):
2887 - 2894.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Baldan, P. Tarr, C. S. Vales, J. Frank, T. K. Shimotake, S. Hawgood, and P. A. Edwards
Deletion of the Transmembrane Transporter ABCG1 Results in Progressive Pulmonary Lipidosis
J. Biol. Chem.,
September 29, 2006;
281(39):
29401 - 29410.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Agassandian, J. Zhou, L. A. Tephly, A. J. Ryan, A. B. Carter, and R. K. Mallampalli
Oxysterols Inhibit Phosphatidylcholine Synthesis via ERK Docking and Phosphorylation of CTP:Phosphocholine Cytidylyltransferase
J. Biol. Chem.,
June 3, 2005;
280(22):
21577 - 21587.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Xu, J. Zhou, D. M. McCoy, and R. K. Mallampalli
LASS5 is the predominant ceramide synthase isoform involved in de novo sphingolipid synthesis in lung epithelia
J. Lipid Res.,
June 1, 2005;
46(6):
1229 - 1238.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Meaney, T. L. Bonfield, M. Hansson, A. Babiker, M. S. Kavuru, and M. J. Thomassen
Serum cholestenoic acid as a potential marker of pulmonary cholesterol homeostasis: increased levels in patients with pulmonary alveolar proteinosis
J. Lipid Res.,
December 1, 2004;
45(12):
2354 - 2360.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2004 American Thoracic Society.
|