help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published ahead of print on July 15, 2004, doi:10.1165/rcmb.2004-0057OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-0057OCv1
31/4/432    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bowler, R. P.
Right arrow Articles by Worthen, G. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bowler, R. P.
Right arrow Articles by Worthen, G. S.
American Journal of Respiratory Cell and Molecular Biology. Vol. 31, pp. 432-439, 2004
© 2004 American Thoracic Society
DOI: 10.1165/rcmb.2004-0057OC

Extracellular Superoxide Dismutase Attenuates Lipopolysaccharide-Induced Neutrophilic Inflammation

Russell P. Bowler, Mike Nicks, Karen Tran, Grant Tanner, Ling-Yi Chang, Scott K. Young and G. Scott Worthen

Department of Medicine, National Jewish Medical and Research Center, Denver, Colorado

Address correspondence to: Russell P. Bowler, M.D., Ph.D., National Jewish Medical and Research Center, K736a, 1400 Jackson Street, Denver, CO 80206. E-mail: BowlerR{at}njc.org


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Extracellular superoxide dismutase (EC-SOD) is an abundant antioxidant in the lung and vascular walls. Previous studies have shown that EC-SOD attenuates lung injury in a diverse variety of lung injury models. In this study, we examined the role of EC-SOD in mediating lipopolysaccharide (LPS)-induced lung inflammation. We found that LPS-induced neutrophilic lung inflammation was exaggerated in EC-SOD–deficient mice and diminished in mice that overexpressed EC-SOD specifically in the lung. Similar patterns were seen for bronchoalveolar lavage cytokines, such as tumor necrosis factor–{alpha}, keratinocyte-derived chemokines, and macrophage inflammatory protein-2 as well as expression of lung intercellular adhesion molecule–1, vascular cell adhesion molecule–1, endothelial cell selectin, and platelet selectin. In a macrophage cell line, EC-SOD inhibited LPS-induced macrophage cytokine release, but did not alter expression of intercellular adhesion molecules in endothelial cells. These results suggest that EC-SOD plays an important role in attenuating the inflammatory response in the lung most likely by decreasing release of proinflammatory cytokines from phagocytes.

Abbreviations: bronchoalveolar lavage, BAL • BAL fluid, BALF • extracellular superoxide dismutase, EC-SOD • endothelial cell selectin, E-selectin • fluorescence-activated cell sorter buffer, FB • intercellular adhesion molecule, ICAM • interleukin, IL • keratinocyte-derived chemokines, KC • lipopolysaccharide, LPS • macrophage inflammatory protein, MIP • myeloperoxidase, MPO • nuclear factor–{kappa}B, NF-{kappa}B • phosphate-buffered saline, PBS • platelet selectin, P-selectin • reactive oxygen species, ROS • superoxide dismutase, SOD • tumor necrosis factor, TNF • vascular cell adhesion molecule, VCAM


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Superoxide is a by-product of aerobic metabolism that has been co-opted by phagocytic cells to serve in microbial killing. Because excessive production of superoxide also damages host cells, most organisms have evolved efficient enzymes to locally decrease its concentration. These enzymes are referred to as superoxide dismutases (SOD). Although the traditional view has been that reactive oxygen species (ROS), such as superoxide, kill microbes directly, newer evidence suggests that superoxide may also play a signaling role in phagocytes by activating proteases (1) and reacting with nitric oxide to form peroxynitrite (2). This suggests a potential role for SOD enzymes in modulating these signaling events.

Three SOD isoenzymes have been identified in mammals. The major intracellular SOD is a 32 kD copper and zinc-containing SOD (SOD1) homodimer present throughout the cytoplasm and nucleus (3). The mitochondrial SOD is a manganese-containing SOD (SOD2) 93 kD homotetramer that is synthesized in the nucleus and translocated to the inner matrix of mitochondria (4). The most recently discovered mammalian SOD is primarily extracellular (EC-SOD) (5), is highly expressed in lungs, and accounts for the majority of SOD activity in vessels and airways (6, 7).

The original description of SOD emphasized its ability to prevent oxidation and reduction reactions from superoxide (8). Thus, EC-SOD has been primarily described as an enzyme that protects against oxidative damage to proteins, lipids, and DNA. Evidence supporting EC-SOD's role as an in vivo antioxidant include animals studies in which EC-SOD has been shown to prevent ischemia–reperfusion injury in the ischemic paw (9), myocardial damage from ischemia–reperfusion (10), brain injury due to ischemia–reperfusion (11, 12) and trauma (13), and lung injury from hyperoxia (14, 15), hemorrhage (16, 17), ozone (18), influenza (19), bleomycin (20, 21), and oil fly ash (22). As several of these studies noted that the protective effects of EC-SOD were associated with decreased recruitment of neutrophils, we hypothesize that EC-SOD plays an important role in regulating pulmonary inflammation.

The relationship between EC-SOD and inflammation was first reported in tissue culture lines. Proinflammatory cytokines, such as interferon-{gamma} and interleukin-1, were noted to increase EC-SOD expression in fibroblasts (23) and alveolar type-2 cells (24). These cytokines have also been associated with increased nuclear factor–{kappa}B (NF-{kappa}B) activation, thus it has been proposed that NF-{kappa}B may regulate EC-SOD transcription (24, 25). Indeed, agents that block NF-{kappa}B activation also block EC-SOD expression (24). Correlations between NF-{kappa}B activation and increased EC-SOD transcription have also been shown in animal models of lung injury (16, 17). Although these studies indicate that cytokines play a role in the regulation of EC-SOD, it is unknown whether EC-SOD in turn regulates the inflammatory response to lipopolysaccharide (LPS). Because ROS are increasingly shown to mediate cell-signaling events in inflammation, EC-SOD may play an important role in the inflammatory cascade by reducing the positive feedback associated with ROS.

We hypothesize that one mechanism by which EC-SOD protects the lung is by attenuating the recruitment of neutrophils during inflammation. In the present experiments, we tested this hypothesis by exposing EC-SOD knockout mice and mice that overexpress EC-SOD specifically in the lung to nebulized LPS. To further investigate the mechanisms by which EC-SOD attenuates lung inflammation, we examined EC-SOD's effects on macrophage and endothelial cells exposed to LPS. The present study confirms that EC-SOD plays a role in attenuating LPS-induced lung inflammation and indicates that EC-SOD may inhibit cytokine release from phagocytic cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents, Supplies, and Antibodies
Heparin was obtained from Elkins-Sinns (Cherry Hill, NJ). The LPS was serotype E. coli 0111:B4 (Sigma Chemical Co., St. Louis, MO). Recombinant mouse tumor necrosis factor (TNF)-{alpha} was obtained from Research Diagnostics Inc. (Flanders, NJ). RNAlater was obtained from Ambion, Inc. (Austin, TX). Low-attachment 24-well plates were from Corning, Inc. (Corning, NY). Bovine erythrocyte SOD, horseradish SOD, and catalase (Sigma) were further purified over PD-10 desalting columns (Amersham Pharmacia Biotech, Uppsala, Sweden) then twice-purified with Microcon Centrifugal YM-3 filters (Millipore, Billerica, MA). Rat monoclonal antibodies to vascular cell adhesion molecule (VCAM)–1 and E-selectin were obtained from R&D Systems (Minneapolis, MN); intercellular adhesion molecule (ICAM)–1 and platelet selectin (P-selectin) were obtained from Research Diagnostics, Inc. (Flanders, NJ). Five-micron membrane filters were from Poretics (Livermore, CA). {alpha}-rat fluorescein isothiocyanate–conjugated antibody was obtained from Jackson ImmunoResearch Labs (West Grove, PA). All other reagents were supplied by Sigma Chemical Co. unless otherwise noted.

Animals
All experiments were conducted in accordance with institutional review board–approved protocols. The derivation of EC-SOD knockout mice has been previously described (14). EC-SOD deficiency does not induce other SOD or antioxidant enzymes (14). Similarly, mice that overexpress human EC-SOD using a surfactant protein C promoter have been previously described and have no known induction of other antioxidant enzymes (15, 20). EC-SOD–knockout and –overexpressing mice were bred into a C57BL/6 background (Harlan, Indianapolis, IN) for more than 10 generations. Max-Bax testing (Charles River Laboratories, Wilmington, MA) revealed 100% homology to the C57BL/6 strain. All mice were genotyped using previously described protocols (17, 20).

LPS Exposure
Saline alone (control) or LPS 1 mg/ml in saline was sonicated 3 times for 10 s with a Branson Signifier 400 (Branson Ultrasonic, Danbury, CT) and then nebulized with bio-aerosol mobilizing generator (CH Technologies, Westwood, NJ). Mice were exposed to LPS or control for 15 min and killed at 0, 4, 24, 48, and 72 h. After bronchoalveolar lavage (BAL), the lungs were removed, minced, and flash-frozen in liquid nitrogen or placed in RNAlater. EC-SOD protein was quantitated by western blotting as previously described (20).

BAL
BAL was performed four times with 0.8 ml of phosphate-buffered saline (PBS) with 10 U heparin as an anticoagulant. The BAL returns were pooled from each sample and centrifuged at 1,000 x g for 10 min. The supernatant was removed and flash-frozen in liquid nitrogen and the cell pellet was resuspended in 1 ml PBS.

Cell Counts and Differential Cell Counts
Total cell counts were determined by hemocytometer. To determine the differential cell count, the cell pellet was resuspended in 1 ml PBS and 2 x 105 cells were placed onto slides and stained using a Hema 3 stain kit (Fisher Scientific, Fair Lawn, NJ); a minimum of 200 cells were counted for each sample.

Cytokines Assays
Enzyme-linked immunosorbent assays were used to determine the BAL concentration of TNF-{alpha}, keratinocyte-derived chemokines (KC), and macrophage inflammatory protein (MIP)–2 (ELISA Tech, Aurora, CO).

Expression of Adhesion Molecules
Mouse endothelial cells (bend.3, CRL-2299; American Type Culture Collection, Manassas, VA) were cultured in Dulbecco's modified Eagle medium (DMEM, Gibco; Invitrogen, Carlsbad, CA) with 10% fetal bovine serum using 75 cm2 flasks. Only passages 25–30 were used. Confluent cultures were stimulated with LPS at 5 µg/ml or TNF-{alpha} at 100 U/ml in the presence of recombinant EC-SOD (0, 100 or 1,000 U/ml) for 18 h. Cells were removed by incubation with Ca2+, Mg2+-free Hank's Balanced Salt Solution with 5 mM ethylenediamine-N,N,N',N'-tetra acetic acid (EDTA) for 30 min at 37°C followed by vigorous pipetting to produce a homogenous single cell suspension (26). The suspended culture was then divided into ~ 0.5 x 106 cell aliquots.

Cells were washed twice for 5 min in fluorescence-activated cell sorter buffer (FB), 2% fetal bovine serum/0.2% NaN3/PBS. Rat monoclonal antibodies to VCAM-1, E-selectin, ICAM-1, and P-selectin at a concentration of 10 µg/ml in FB were incubated with cells for 30 min at 4°C. The secondary antibody, goat {alpha}-rat FITC (Jackson ImmunoResearch Labs, West Grove, PA), was added at 15 µg/ml in FB for 30 min at 4°C. Flow cytometry for ICAM-1, VCAM-1, E-selectin, and P-selectin was performed with a FACSCalibur flow cytometer (Becton Dickinson, San Jose, CA), and data were analyzed with CELLQUEST software (BD Biosciences).

Quantitative Real-Time Polymerase Chain Reaction
Total RNA was extracted as per RNeasy Midi kit animal tissue protocol (Qiagen, Valencia, CA). cDNA was made using the RETROscript kit (Ambion, Austin, TX). Quantitative rapid thermal cycling in a Cepheid Smart Cycler (Sunnyvale, CA) was used to determine the mRNA levels of VCAM-1, ICAM-1, E-selectin, P-selectin, and cyclophilin A (control). The cyclophilin A was labeled at the 5' and 3' ends with a carboxy-X-rhodamine reporter and a Black Hole–2 quencher (BHQ-2; Biosearch Technologies, Inc., Novato, CA). The other gene product probes were labeled at the 5' and 3' ends with a 6-carboxy fluorescein reporter and a Black Hole-1 quencher (BHQ-1; Biosearch Technologies). RNA levels were normalized to cyclophilin A. Primer pair/probe sequences for adhesion molecules VCAM-1, ICAM-1, and cyclophilin A have been previously reported (27, 28). E-selectin primer sequences were as follows (5'-3'): forward—AAAGTTTCTCCAGTCTAGCGC; reverse—AAAGCGCGAGGCATT; the E-selectin gene probe was: GGATGAAAGCAACTGCTGGAGT. P-selectin primer sequences were as follows (5'-3'): forward—GCTGCCCAAAAGGTTCC; reverse—GAGTTGAGCCCCTCCCA; the P-selectin gene probe was: GACGCCAAGACTCCGGAGTGTG. Quantitation of mRNA for mouse EC-SOD was done as previously described (20).

Polymerase chain reaction (PCR) was performed in sealed optical tubes (Cepheid) using 0.3 µM gene-specific primers and either 1 µl 25X SYBR Green (Invitrogen) or 0.2 µM fluorogenic probes. PCR components consisted of 2 µl of sample cDNA and 23 µl of reaction mix containing a final concentration of 4 mM MgCl2 and Ready-To-Go PCR beads (Amersham Biosciences, Piscataway, NJ). Thermal cycling conditions for each gene product are as follows: cyclophilin, VCAM-1, and ICAM-1: 30 cycles of denaturation, 95°C, 30 s; annealing/extension: 66°C, 60 s. E- and P-selectins used the same thermal cycling conditions as for cyclophilin, VCAM-1, and ICAM-1, but with 60 cycles of amplification. All reaction products were run on 2% SeaKem LE agarose gels (BioWhittaker, Rockland, ME) to verify correct amplicon sizes.

Myeloperoxidase
Myeloperoxidase activity was assayed using a modification of Anderson and colleagues (29, 30). A lobe of the lung from each animal was homogenized for 30 s in 1.5 ml 20 mM potassium phosphate, pH 7.4, and centrifuged at 4°C for 30 min at 40,000 x g. The pellet was resuspended in 1.5 ml of 40 mM potassium phosphate, pH 6.0, containing 0.5% hexacetyltrimethyl ammonium bromide, sonicated for 90 s, incubated at 60°C for 2 h, and centrifuged. The supernatant was assayed for peroxidase activity and corrected to lung weight.

Statistical Analysis
A one-way ANOVA was used to determine if the means were significantly different (P < 0.05). If means were significantly different, a Tukey-Kramer multiple group comparison test was used to compare individual groups. Error bars in figures represent ± 1 SEM. All values were calculated using GraphPad Prism version 3.00 for Windows (GraphPad Software, San Diego, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
EC-SOD Expression after LPS Exposure
Lung EC-SOD is partially proteolytically processed so that it is missing its heparin-binding carboxyterminus (3133). It has been postulated that inflammation from bleomycin may accelerate clearance of EC-SOD via this mechanism (34). To determine whether LPS also modulates EC-SOD clearance, we examined the expression of EC-SOD protein and mRNA in the lung tissue from wild-type mice 0–3 d after exposure to LPS. There was a 41, 54, and 61% decrease in EC-SOD protein 1, 2, and 3 d, respectively, after LPS (P < 0.001 for Day 0 compared with Days 1–3); however, this decline was not statistically significant when EC-SOD protein was expressed as total EC-SOD per lung (P = 0.07). In the first 2 d, the ratio of cleaved to intact EC-SOD decreased from 0.88 to 0.66 (P < 0.05), indicating most of the decline in EC-SOD was associated with a decline in proteolytically processed EC-SOD. There was no difference in EC-SOD mRNA expression as determined by real-time PCR (data not shown).

Effects of EC-SOD on Pulmonary Inflammation after Exposure to LPS
Although expression of EC-SOD is inversely related to lung neutrophil infiltration in several animal models (1518, 22), the effects of nebulized LPS are unknown in mice with EC-SOD deficiency and overexpression. To study this interaction, we exposed wild-type mice, mice that overexpressed EC-SOD specifically in the lung, and EC-SOD knockout mice to inhaled nebulized LPS and quantitated neutrophils by the activity of myeloperoxidase (MPO) (Figure 1). As soon as 4 h after exposure to LPS, there was a rapid rise in MPO activity in the lung homogenate, but compared with wild-type mice, the mice that overexpressed EC-SOD in the lung had a 57 ± 10% reduction in MPO activity at 4 h (P < 0.001). Compared with wild-type mice, mice that were deficient in EC-SOD had a prolonged increase in MPO, even 3 d after exposure to LPS (P < 0.001 at 1, 2, and 3 d). MPO activity in the lungs of mice that overexpressed EC-SOD did not differ from that of wild-type mice at 1, 2 and 3 d. This suggests that EC-SOD deficiency is associated with increased and prolonged neutrophilic inflammation in the lung.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 1. MPO in EC-SOD overexpressor (diamonds), wild-type (squares), and EC-SOD knockout (triangles) mice exposed to nebulized LPS. Means and SEMs of MPO activity per mg of lung protein are shown for time 0 and 4 h, and 1, 2, and 3 d. Four hours after LPS inhalation, lung MPO activity was significantly less in the mice that overexpressed EC-SOD. At 1, 2, and 3 d, there was a persistent elevation in MPO activity in the EC-SOD knockout mice compared with wild-type mice. *P < 0.05 compared with wild-type; **P < 0.01 compared with wild-type; ***P < 0.001 EC-SOD knockout compared with wild-type. #P < 0.05 compared with wild-type; ##P < 0.01 compared with wild-type; ###P < 0.001 EC-SOD overexpressor compared with wild-type.

 
To further investigate the effects of EC-SOD on LPS-induced lung inflammation, we quantitated airway inflammation using BAL (Figure 2). In unstimulated mice (Day 0), the majority of cells in the BAL were macrophages (range, 89–99%). In response to LPS, there was a marked increase in both the relative and absolute amount of BAL neutrophils; however, the maximal increase was delayed to 24 h compared with the MPO activity in lung tissue, which peaked at 4 h. Compared with the wild-type mice, there were 29% fewer neutrophils in mice that overexpressed EC-SOD and 107% more neutrophils in the mice that were deficient in EC-SOD (P < 0.001 compared with wild-type mice). There was no significant difference in cell counts for macrophages (except at 3 d in the wild-type mice), eosinophils (except at 48 h in the EC-SOD overexpressor mice), and lymphocytes.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 2. BAL cells in EC-SOD overexpressor (diamonds), wild-type (squares), and EC-SOD knockout (triangles) mice exposed to nebulized LPS. Mean totals and SEM of (A) neutrophils, (B) macrophages, (C) eosinophils, and (D) lymphocytes are shown for time 0 and 4 h, and 1, 2, and 3 d. There were significant increases in neutrophil counts at 1 d in the EC-SOD knockout mice and statistically significant decreases in the EC-SOD–overexpressing mice at 4 h and at 2 d. There were no differences in macrophage counts except at 3 d, when there were statistically more macrophages in the BAL of wild-type mice. There were no differences in eosinophil counts except at 2 d, when there were statistically more eosinophils in the EC-SOD overexpressor mice compared with wild-type mice. *P < 0.05 compared with wild-type; **P < 0.01 compared with wild-type; ***P < 0.001 EC-SOD knockout compared with wild-type. #P < 0.05 compared with wild-type; ##P < 0.01 compared with wild-type; ###P < 0.001 EC-SOD overexpressor compared with wild-type.

 
BAL Cytokines
Inhaled LPS was associated with a rapid release of multiple proinflammatory cytokines in BAL fluid (BALF) (Figure 3). Four hours after exposure to LPS, the BALF concentration of TNF-{alpha} increased from 170 ± 70 pg/ml to 17,367 ± 2,028 pg/ml in wild-type mice, and to 28,090 ± 3,134 pg/ml in EC-SOD knockout mice (P < 0.01). There was no significant difference in TNF-{alpha} concentration between the wild-type and EC-SOD–overexpressing mice. There was a rapid fall in TNF-{alpha} concentration 1–3 d after LPS exposure, but there were no significant differences among the EC-SOD genotypes. Four hours after LPS exposure, BALF MIP-2 concentrations increased from 71 ± 47 pg/ml to 13,543 ± 3,386 pg/ml in the wild-type mice, and to 27,651 ± 5,818 pg/ml in the EC-SOD knockout mice (P < 0.05). At 4 h, there was no significant difference in MIP-2 concentrations between the wild-type and EC-SOD–overexpressing mice. At 24 h after LPS exposure, there was a rapid fall in MIP-2 concentration, but there were no significant differences among the EC-SOD genotypes. Although BALF KC cytokine increased from 275 ± 163 pg/ml to 8,180 ± 4,051 pg/ml in the wild-type mice, it rapidly decreased to baseline by Day 1 and there were no significant differences among the EC-SOD genotypes, except that the concentration was slightly higher 2 d after exposure in the EC-SOD–overexpressing mice compared with the wild-type mice (882 ± 390 pg/ml versus 217 ± 78 pg/ml; P < 0.01).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. BAL cytokine concentrations in extracellular EC-SOD overexpressor (diamonds), wild-type (squares), and EC-SOD knockout (triangles) mice exposed to nebulized LPS. Means and SEMs of TNF-{alpha} per ml of BALF are shown for time 0 and 4 h, and 1, 2, and 3 d. *P < 0.05 compared with wild-type; **P < 0.01 compared with wild-type; ***P < 0.001 EC-SOD knockout compared with wild-type. #P< 0.05 compared with wild-type; ##P < 0.01 compared with wild-type; ###P < 0.001 EC-SOD overexpressor compared with wild-type.

 
The Effect of EC-SOD on Expression of Adhesion Molecules
Superoxide has been shown to induce expression of cell adhesion molecules, such as the selectins (3537). To test whether EC-SOD might modulate expression of adhesion molecules, we examined the ratio of mRNA expression of VCAM-1, ICAM-1, E-selectin, and P-selectin compared to mRNA expression of cyclophilin. The expression of these adhesion molecules markedly increased 4 h after LPS exposure, but returned to near-normal levels after 24 h (Figure 4). Compared with wild-type mice, the lungs of EC-SOD knockout mice had significantly more expression of ICAM-1 (7.2 ± 0.5 versus 9.8 ± 0.6; P < 0.01). Compared with wild-type mice, ICAM-1 and VCAM-1 expression from EC-SOD knockout mice remained persistently above control even at 2 (P < 0.001 and P < 0.001) and 3 d (P < 0.001 and P < 0.05). Compared with wild-type mice, the lungs of EC-SOD–overexpressing mice had significantly less expression of ICAM-1 (7.2 ± 0.5 versus 4.9 ± 1.0; P < 0.05) and VCAM-1 (9.3 ± 0.6 versus 5.9 ± 1.0; P < 0.01). After 4 h, P-selectin expression was significantly higher in the EC-SOD knockout mice compared with the EC-SOD–overexpressing mice (103 ± 17 versus 42 ± 14; P < 0.01). E-selectin was not statistically different among genotypes.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. Expression of adhesion molecule mRNA in EC-SOD overexpressor (diamonds), wild-type (squares), and EC-SOD knockout (triangles) mice exposed to nebulized LPS. (A) ICAM-1, (B) VCAM-1, (C) E-Selectin, and (D) P-selectin. Values are expressed as a ratio to cyclophilin expression. Data are shown for eight experiments. Results are expressed as mean and SEM *P < 0.05 compared with wild-type; **P < 0.01 compared with wild-type; ***P < 0.001 EC-SOD knockout compared with wild-type. #P < 0.05 compared with wild-type; ##P < 0.01 compared with wild-type; ###P < 0.001 EC-SOD overexpressor compared with wild-type.

 
Because endothelial cells have previously been shown to express adhesion molecules that are crucial to neutrophil recruitment in the lung, we examined whether EC-SOD could attenuate cytokine-mediated cell surface expression of these molecules in a mouse endothelial cell line. Although both LPS and TNF-{alpha} were able to induce a significant increase in the cell surface expression of ICAM-1 and VCAM-1 and a mild increase in the cell surface expression of E- and P-selectin, there was no reduction in cell surface expression of these adhesion molecules in the presence of EC-SOD at either 100 (data not shown) or 1,000 U/ml (Figures 5A and 5B).




View larger version (57K):
[in this window]
[in a new window]
 
Figure 5. EC-SOD has minimal effect on the cell surface expression of endothelial cells that have been exposed to LPS and TNF-{alpha}. Mouse endothelial cells were incubated for 18 h at 37°C (A) in control media (purple lines), LPS 5 µg/ml (red lines), or LPS 5 µg/ml + EC-SOD 1,000 U/ml (yellow lines), or (B) in control media (purple lines), TNF-{alpha} 100 U/ml (red lines), or TNF-{alpha} 100 U/ml + EC-SOD 1,000 U/ml (yellow lines). Cells were detached and incubated with one of four primary antibodies specific for VCAM-1, ICAM-1, E-selectin, or P-selectin, and then with a fluorescent secondary antibody. A histogram of intensity of cell surface expression (log-scale) is shown for representative experiments.

 
LPS-Induced Release of Cytokines by Macrophages in the Presence of EC-SOD
Because macrophages release chemokines that attract neutrophils, we examined whether EC-SOD could attenuate cytokine release in a macrophage cell line. Preliminary experiments showed that these cells secreted a maximal amount of TNF-{alpha} and MIP-2 after stimulation with LPS 5–50 ng/ml for 18 h (data not shown), but there was no detectable secretion of KC. TNF-{alpha} secretion (Figure 6A) increased from 328 ± 73 ng/ml at baseline to 3,250 ± 394 ng/ml in the presence of LPS (P < 0.001); there was no significant difference in TNF-{alpha} secretion in the presence of EC-SOD 10 U/ml; however, TNF-{alpha} secretion was only 2,112 ± 208 ng/ml in the presence of EC-SOD 100 U/ml and 1,335 ± 48 ng/ml presence of EC-SOD 1,000 U/ml. Similarly, MIP-2 secretion (Figure 6B) increased from 797 ± 84 ng/ml at baseline to 5,940 ± 143 ng/ml in the presence of LPS (P < 0.001); there was no statistically significant difference in MIP-2 secretion in the presence of EC-SOD 10 U/ml; however, MIP-2 secretion was only 2,973 ± 269 ng/ml in the presence of EC-SOD 100 U/ml (P < 0.01 compared with LPS alone) and 2,035 ± 252 ng/ml presence of EC-SOD 1,000 U/ml (P = nonsignificant compared with LPS alone). Neither bovine SOD1 nor horseradish SOD had a statistically significant effect on TNF-{alpha} or MIP-2 cytokine release at 100 or 1,000 U/ml (data not shown). Addition of catalase at 100 and 1,000 U/ml did not significantly change cytokine release in the presence of EC-SOD (data not shown).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 6. LPS-induced macrophage cytokine release is attenuated in the presence of EC-SOD. Mouse macrophage cells (RAW 264.7) were incubated for 18 h at 37°C in the presence of LPS 5 µg/ml and/or EC-SOD (0–1,000 U/ml). Concentrations of (A) TNF-{alpha} or (B) MIP-2 were assayed in the media using enzyme-linked immunosorbent assays. Results are expressed as the mean ± SE of four experiments. *P < 0.05, **P < 0.01, ***P < 0.001 compared with LPS without EC-SOD. Open bars, LPS 5 µg/ml; closed bars, control cells.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The prevailing dogma regarding the role of SOD enzymes is that they protect cells because they reduce damage resulting from excessive superoxide production. While this has been clearly demonstrated for all three SOD enzymes in mammals, the data from this study as well as that from studies of other lung injury models strongly suggest that EC-SOD also decreases lung injury by modulating inflammation (1419, 22). The results from this investigation indicate that one mechanism by which EC-SOD may modulate inflammation is by attenuating macrophage cytokine release and may explain why EC-SOD reduces neutrophil inflammation as early as 4 h after administration of LPS.

The observation that EC-SOD affects in vivo neutrophil responses as early as 4 h after LPS exposure suggests that EC-SOD may modulate the alveolar macrophage response. These effects may occur via several mechanisms, including release of proinflammatory cytokines that recruit neutrophils to the lung and engulfment of apoptotic neutrophils to promote resolution of neutrophilic inflammation (38). We found both in vivo and in vitro evidence that EC-SOD attenuates release of proinflammatory cytokines. These findings are consistent with the concept that ROS and antioxidants play a role in macrophage release of cytokines. For instance, catalase inhibits the activation of the transcription factor complex activator protein–1 (39) and the zymosan-induced activation of extracellular signal–regulated protein kinase pathways (40). Hyperoxia, a potent source of ROS, is associated with macrophage release of TNF-{alpha}, IL-1ß, and IL-6 after just a few hours of exposure (41), ozone causes increases in MIP-2 (42), and hydrogen peroxide mediates monocyte production of IL-8 (43). Antioxidants, such as N-acetylcysteine, have been shown to decrease TNF-{alpha} (44), IL-2 (45), and MIP-2 (46) release in macrophages stimulated by LPS. The signaling pathways by which this occurs are not completely known, but may include extracellular signal-related kinase and p38 (45) or NF-{kappa}B, activator protein–1, and cyclic adenosine monophosphate response element binding protein (47).

Several observations suggest that isoenzymes of SOD may affect macrophages differently. For instance, we observed decreased BAL cytokine production in mice that overexpressed EC-SOD and decreased cytokine release by macrophages that were incubated in the presence of EC-SOD; yet it has recently been shown that overexpression of SOD1 results in increased TNF-{alpha} release by LPS-stimulated peritoneal macrophages (48). In contrast to these findings, other investigators have shown that a superoxide generator, such as xanthine oxidase, is capable of increasing TNF-{alpha} in rat alveolar macrophages (49). Furthermore, SOD1 and SOD2 have been shown to be therapeutically useful in protecting the lung from hyperoxia-induced inflammation in animal models (50, 51), and SOD1 has been used to reduce bronchopulmonary dysplasia in preterm infants (52, 53). Thus, the majority of evidence suggests that the family of SOD enzymes reduces inflammation in vivo. One difference between EC-SOD and other SOD enzymes is that EC-SOD is primarily an extracellular enzyme. Additionally, SOD1 has undesirable properties, such as a short half-life and a net negative charge that inhibits it from binding to cellular surfaces or moving through the interstitial space. To overcome these limitations, researchers have had to deliver SOD1 in special carrier substances (50, 54, 55) or genetically engineer SOD2 to have the heparin-binding carboxyterminus found in EC-SOD (56). EC-SOD is a naturally occurring enzyme that does not require these modifications.

The role of TNF-{alpha} and other macrophage cytokines may be important in neutrophil apoptosis and clearance and may partially explain why EC-SOD knockout mice had persistent neutrophilic inflammation. Although TNF-{alpha} enhances neutrophil apoptosis at 6 h (57, 58), it impairs LPS-mediated apoptosis at 20 h (57). The relationship between ROS, cytokine release, and neutrophil apoptosis and clearance is unclear because other investigators have found that ROS, in particular hydrogen peroxide, causes increased neutrophil apoptosis (59, 60). Because hydrogen peroxide is a by-product of the EC-SOD reaction, it is possible that deficiency in EC-SOD results in less hydrogen peroxide–mediated neutrophil apoptosis. Supporting this theory is a report in which overexpression of EC-SOD, using adenoviral vectors, reduced paracetamol-induced hepatocyte apoptosis in mice (61). Another mechanism by which EC-SOD results in prolonged neutrophil inflammation could be the persistent release of neutrophil chemoattractants. The identity of such a persistent signal remains unknown, because in this model we observed rapid resolution in the proinflammatory cytokines TNF-{alpha}, MIP-S, and KC. Furthermore, mice that overexpress EC-SOD in the lung had similar MPO activity at Days 2 and 3 compared with wild-type mice, suggesting that the amount of EC-SOD in wild-type mouse lungs may be sufficient to promote the clearance of neutrophils and that boosting this amount through overexpression has no additive effect.

An additional step that is required for neutrophils to migrate into lung tissue is an interaction with adhesion molecules on endothelium, and there is increasing evidence that ROS mediate this process. For instance, ROS increase endothelial expression of ICAM-1 (62) and mediate increases in angiotensin II–induced expression of VCAM-1 (63). Superoxide has been specifically implicated in the regulation of selectin expression in endothelial cells. Superoxide derived from both xanthine oxidase and nicotinamide adenine dinucleotide phosphate oxidase increases P-selectin expression in vascular beds that undergo ischemia–reperfusion (35), and inhibition of xanthine oxidase decreases P-selectin expression in a pancreatitis model of acute lung injury (64). SOD inhibits increased endothelial E-selectin expression after ischemia–reperfusion (36). The mechanism by which ROS induce expression of these molecules is unknown; however, it may involve nitric oxide because peroxynitrite increases E-selectin expression on endothelial cells (65).

We found that EC-SOD decreased LPS-mediated expression of intercellular adhesion molecules in vivo, but not in vitro. There are at least two possible explanations that may account for this discrepancy. First, we added LPS directly to endothelial cells but did not provide an external source of ROS. Because exogenous sources of superoxide have been shown to increase endothelial expression of adhesion molecules (35, 62, 65), this suggests that LPS does not cause endothelial cells to make significant amounts of extracellular superoxide, but that other cell types, such as phagocytes, are the source of ROS in vivo. Second, we used whole lung preparations of RNA to examine changes in mRNA expression for selected adhesion molecules, but examined cell surface expression of these molecules in cell culture. The distinction between mRNA and protein is important because some adhesion molecules, such as P-selectin, are stored in intracellular pools and are not expressed on the cell surface after LPS stimulation (66). No synthesis of new protein is required for this expression, thus adhesion molecule mRNA may not correlate with cell surface expression. Subsequent studies that elucidate the role of EC-SOD in the neutrophil–endothelial cell interaction will be required to fully answer these questions.

There may be additional mechanisms by which EC-SOD modulates lung inflammation, and future studies will elucidate these roles. For instance, EC-SOD has recently been shown to modulate blood pressure (67) and glomerular filtration (68) through its interactions with nitric oxide. EC-SOD directly binds to collagen (7, 21) and can prevent ROS-induced collagen fragmentation in vivo and in vitro (21, 69). Protection of collagen fragmentation may reduce inflammation because collagen fragments are chemoattractants and activators of neutrophils (70). There is also accumulating evidence that ROS by themselves may function as signaling molecules (see review in Ref. 71). The discovery of a family of superoxide-generating membrane oxidases and dual oxidases that generate superoxide in a regulated manner implies an important role for ROS in signal transduction (72). Oxidation of cysteine to sulfenic acid may be the mechanism by which ROS regulate protein kinase activity and cell signaling (73); for instance, superoxide produced by nicotinamide adenine dinucleotide phosphate–oxidases results in the oxidation of a thiol residue in a low–molecular-weight protein tyrosine phosphatase, resulting in its inactivation (74). Modulation of phosphatases by ROS has recently been implicated in other pathways, such as signal transducers and activations of transcription (75) and apoptosis signal–regulating kinase 1 (76). Other potential signaling targets for ROS include lipids. Lipid peroxidation by ROS can generate 4-hydroxynonenal, which is implicated as a mediator of intracellular signaling in apoptosis and cell proliferation (77).

In summary, we have used EC-SOD knockout and overexpressing mice to show that EC-SOD modulates neutrophil inflammation after inhalation of nebulized LPS. EC-SOD reduced the expression of adhesion molecules in vivo, but did not significantly affect endothelial expression of adhesion molecules in vitro. One mechanism by which EC-SOD might modulate neutrophil inflammation is by reducing cytokine release from macrophages. This suggests that EC-SOD should be considered as an anti-inflammatory enzyme as well as a bulk antioxidant.


    Acknowledgments
 
The authors thank Nancy Tyler and Elizabeth Regan, M.D., for their assistance with the manuscript. This work was supported by National Institutes of Health grant HL-04407 (R.P.B.).


    Footnotes
 
Conflict of Interest Statement: R.P.B. has no declared conflicts of interest; M.N. has no declared conflicts of interest; K.T. has no declared conflicts of interest; G.T. has no declared conflicts of interest; L.-Y.C. has no declared conflicts of interest; G.S.W. has no declared conflicts of interest.

Received in original form February 13, 2004

Received in final form June 28, 2004


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Reeves, E. P., H. Lu, H. L. Jacobs, C. G. Messina, S. Bolsover, G. Gabella, E. O. Potma, A. Warley, J. Roes, and A. W. Segal. 2002. Killing activity of neutrophils is mediated through activation of proteases by K+ flux. Nature 416:291–297.[CrossRef][Medline]
  2. Beckman, J. S. 1996. Oxidative damage and tyrosine nitration from peroxynitrite. Chem. Res. Toxicol. 9:836–844.[CrossRef][Medline]
  3. Crapo, J. D., T. Oury, C. Rabouille, J. W. Slot, and L. Y. Chang. 1992. Copper,zinc superoxide dismutase is primarily a cytosolic protein in human cells. Proc. Natl. Acad. Sci. USA 89:10405–10409.[Abstract/Free Full Text]
  4. Weisiger, R. A., and I. Fridovich. 1973. Mitochondrial superoxide simutase: site of synthesis and intramitochondrial localization. J. Biol. Chem. 248:4793–4796.[Abstract/Free Full Text]
  5. Marklund, S. L. 1982. Human copper-containing superoxide dismutase of high molecular weight. Proc. Natl. Acad. Sci. USA 79:7634–7638.[Abstract/Free Full Text]
  6. Oury, T. D., B. J. Day, and J. D. Crapo. 1996. Extracellular superoxide dismutase in vessels and airways of humans and baboons. Free Radic. Biol. Med. 20:957–965.[CrossRef][Medline]
  7. Oury, T. D., L. Y. Chang, S. L. Marklund, B. J. Day, and J. D. Crapo. 1994. Immunocytochemical localization of extracellular superoxide dismutase in human lung. Lab. Invest. 70:889–898.[Medline]
  8. McCord, J. M., and I. Fridovich. 1969. Superoxide dismutase: an enzymic function for erythrocuprein (hemocuprein). J. Biol. Chem. 244:6049–6055.[Abstract/Free Full Text]
  9. Oyanagui, Y., and S. Sato. 1990. Heparin, a potent releasing agent of extracellular superoxide dismutase (EC-SOD C), suppresses ischaemic paw oedema in mice. Free Radic. Res. Commun. 9:87–99.[Medline]
  10. Sjoquist, P. O., and S. L. Marklund. 1992. Endothelium bound extracellular superoxide dismutase type C reduces damage in reperfused ischaemic rat hearts. Cardiovasc. Res. 26:347–350.[Medline]
  11. Sheng, H., T. C. Brady, R. D. Pearlstein, J. D. Crapo, and D. S. Warner. 1999. Extracellular superoxide dismutase deficiency worsens outcome from focal cerebral ischemia in the mouse. Neurosci. Lett. 267:13–16.[CrossRef][Medline]
  12. Sheng, H., M. Kudo, G. B. Mackensen, R. D. Pearlstein, J. D. Crapo, and D. S. Warner. 2000. Mice overexpressing extracellular superoxide dismutase have increased resistance to global cerebral ischemia. Exp. Neurol. 163:392–398.[CrossRef][Medline]
  13. Pineda, J. A., M. Aono, H. Sheng, J. Lynch, J. C. Wellons, D. T. Laskowitz, R. D. Pearlstein, R. Bowler, J. Crapo, and D. S. Warner. 2001. Extracellular superoxide dismutase overexpression improves behavioral outcome from closed head injury in the mouse. J. Neurotrauma 18:625–634.[CrossRef][Medline]
  14. Carlsson, L. M., J. Jonsson, T. Edlund, and S. L. Marklund. 1995. Mice lacking extracellular superoxide dismutase are more sensitive to hyperoxia. Proc. Natl. Acad. Sci. USA 92:6264–6268.[Abstract/Free Full Text]
  15. Folz, R. J., A. M. Abushamaa, and H. B. Suliman. 1999. Extracellular superoxide dismutase in the airways of transgenic mice reduces inflammation and attenuates lung toxicity following hyperoxia. J. Clin. Invest. 103:1055–1066.[Medline]
  16. Bowler, R. P., J. Arcaroli, J. D. Crapo, A. Ross, J. W. Slot, and E. Abraham. 2001. Extracellular superoxide dismutase attenuates lung injury after hemorrhage. Am. J. Respir. Crit. Care Med. 164:290–294.[Abstract/Free Full Text]
  17. Bowler, R. P., J. Arcaroli, E. Abraham, M. Patel, L. Y. Chang, and J. D. Crapo. 2003. Evidence for extracellular superoxide dismutase as a mediator of hemorrhage-induced lung injury. Am. J. Physiol. Lung Cell. Mol. Physiol. 284:L680–L687.[Abstract/Free Full Text]
  18. Jonsson, L. M., T. Edlund, S. L. Marklund, and T. Sandstrom. 2002. Increased ozone-induced airway neutrophilic inflammation in extracellular-superoxide dismutase null mice. Respir. Med. 96:209–214.[CrossRef][Medline]
  19. Suliman, H. B., L. K. Ryan, L. Bishop, and R. J. Folz. 2001. Prevention of influenza-induced lung injury in mice overexpressing extracellular superoxide dismutase. Am. J. Physiol. Lung Cell. Mol. Physiol. 280:L69–L78.[Abstract/Free Full Text]
  20. Bowler, R. P., M. Nicks, K. Warnick, and J. D. Crapo. 2002. Role of extracellular superoxide dismutase in bleomycin-induced pulmonary fibrosis. Am. J. Physiol. Lung Cell. Mol. Physiol. 282:L719–L726.[Abstract/Free Full Text]
  21. Fattman, C. L., L. Y. Chang, T. A. Termin, L. Petersen, J. J. Enghild, and T. D. Oury. 2003. Enhanced bleomycin-induced pulmonary damage in mice lacking extracellular superoxide dismutase. Free Radic. Biol. Med. 35:763–771.[CrossRef][Medline]
  22. Ghio, A. J., H. B. Suliman, J. D. Carter, A. M. Abushamaa, and R. J. Folz. 2002. Overexpression of extracellular superoxide dismutase decreases lung injury after exposure to oil fly ash. Am. J. Physiol. Lung Cell. Mol. Physiol. 283:L211–L218.[Abstract/Free Full Text]
  23. Marklund, S. L. 1992. Regulation by cytokines of extracellular superoxide dismutase and other superoxide dismutase isoenzymes in fibroblasts. J. Biol. Chem. 267:6696–6701.[Abstract/Free Full Text]
  24. Brady, T. C., L. Y. Chang, B. J. Day, and J. D. Crapo. 1997. Extracellular superoxide dismutase is upregulated with inducible nitric oxide synthase after NF-kappa B activation. Am. J. Physiol. 273:L1002–L1006.
  25. Folz, R. J., and J. D. Crapo. 1994. Extracellular superoxide dismutase (SOD3): tissue-specific expression, genomic characterization, and computer-assisted sequence analysis of the human EC SOD gene. Genomics 22:162–171.[CrossRef][Medline]
  26. Sikorski, E. E., R. Hallmann, E. L. Berg, and E. C. Butcher. 1993. The Peyer's patch high endothelial receptor for lymphocytes, the mucosal vascular addressin, is induced on a murine endothelial cell line by tumor necrosis factor-alpha and IL-1. J. Immunol. 151:5239–5250.[Abstract]
  27. Trogan, E., R. P. Choudhury, H. M. Dansky, J. X. Rong, J. L. Breslow, and E. A. Fisher. 2002. Laser capture microdissection analysis of gene expression in macrophages from atherosclerotic lesions of apolipoprotein E–deficient mice. Proc. Natl. Acad. Sci. USA 99:2234–2239.[Abstract/Free Full Text]
  28. Molenaar, T. J., J. Twisk, S. A. de Haas, N. Peterse, B. J. Vogelaar, S. H. van Leeuwen, I. N. Michon, T. J. van Berkel, J. Kuiper, and E. A. Biessen. 2003. P-selectin as a candidate target in atherosclerosis. Biochem. Pharmacol. 66:859–866.[CrossRef][Medline]
  29. Anderson, B. O., J. M. Brown, P. F. Shanley, D. D. Bensard, and A. H. Harken. 1991. Marginating neutrophils are reversibly adherent to normal lung endothelium. Surgery 109:51–61.[Medline]
  30. Parsey, M. V., R. M. Tuder, and E. Abraham. 1998. Neutrophils are major contributors to intraparenchymal lung IL-1 beta expression after hemorrhage and endotoxemia. J. Immunol. 160:1007–1013.[Abstract/Free Full Text]
  31. Olsen, D. A., S. V. Petersen, T. D. Oury, Z. Valnickova, I. B. Thogersen, T. Kristensen, R. P. Bowler, J. D. Crapo, and J. J. Enghild. 2004. The intracellular proteolytic processing of extracellular superoxide dismutase (EC-SOD) is a two-step event. J. Biol. Chem. 279:22152–22157.[Abstract/Free Full Text]
  32. Bowler, R. P., M. Nicks, D. A. Olsen, I. B. Thogersen, Z. Valnickova, P. Hojrup, A. Franzusoff, J. J. Enghild, and J. D. Crapo. 2002. Furin proteolytically processes the heparin-binding region of extracellular superoxide dismutase. J. Biol. Chem. 277:16505–16511.[Abstract/Free Full Text]
  33. Enghild, J. J., I. B. Thogersen, T. D. Oury, Z. Valnickova, P. Hojrup, and J. D. Crapo. 1999. The heparin-binding domain of extracellular superoxide dismutase is proteolytically processed intracellularly during biosynthesis. J. Biol. Chem. 274:14818–14822.[Abstract/Free Full Text]
  34. Fattman, C. L., C. T. Chu, S. M. Kulich, J. J. Enghild, and T. D. Oury. 2001. Altered expression of extracellular superoxide dismutase in mouse lung after bleomycin treatment. Free Radic. Biol. Med. 31:1198–1207.[CrossRef][Medline]
  35. Akgur, F. M., M. F. Brown, G. B. Zibari, J. C. McDonald, C. J. Epstein, C. R. Ross, and D. N. Granger. 2000. Role of superoxide in hemorrhagic shock-induced P-selectin expression. Am. J. Physiol. Heart Circ. Physiol. 279:H791–H797.[Abstract/Free Full Text]
  36. Russell, J., C. J. Epstein, M. B. Grisham, J. S. Alexander, K. Y. Yeh, and D. N. Granger. 2000. Regulation of E-selectin expression in postischemic intestinal microvasculature. Am. J. Physiol. Gastrointest. Liver Physiol. 278:G878–G885.[Abstract/Free Full Text]
  37. Cuzzocrea, S., E. Mazzon, L. Dugo, A. P. Caputi, K. Aston, D. P. Riley, and D. Salvemini. 2001. Protective effects of a new stable, highly active SOD mimetic, M40401 in splanchnic artery occlusion and reperfusion. Br. J. Pharmacol. 132:19–29.[CrossRef][Medline]
  38. Cox, G., J. Crossley, and Z. Xing. 1995. Macrophage engulfment of apoptotic neutrophils contributes to the resolution of acute pulmonary inflammation in vivo. Am. J. Respir. Cell Mol. Biol. 12:232–237.[Abstract]
  39. Iles, K. E., D. A. Dickinson, N. Watanabe, T. Iwamoto, and H. J. Forman. 2002. AP-1 activation through endogenous H(2)O(2) generation by alveolar macrophages. Free Radic. Biol. Med. 32:1304–1313.[CrossRef][Medline]
  40. Torres, M., and H. J. Forman. 1999. Activation of several MAP kinases upon stimulation of rat alveolar macrophages: role of the NADPH oxidase. Arch. Biochem. Biophys. 366:231–239.[CrossRef][Medline]
  41. Desmarquest, P., K. Chadelat, S. Corroyer, V. Cazals, and A. Clement. 1998. Effect of hyperoxia on human macrophage cytokine response. Respir. Med. 92:951–960.[CrossRef][Medline]
  42. Michalec, L., B. K. Choudhury, E. Postlethwait, J. S. Wild, R. Alam, M. Lett-Brown, and S. Sur. 2002. CCL7 and CXCL10 orchestrate oxidative stress-induced neutrophilic lung inflammation. J. Immunol. 168:846–852.[Abstract/Free Full Text]
  43. DeForge, L. E., J. C. Fantone, J. S. Kenney, and D. G. Remick. 1992. Oxygen radical scavengers selectively inhibit interleukin 8 production in human whole blood. J. Clin. Invest. 90:2123–2129.
  44. Victor, V. M., and M. De la Fuente. 2003. Immune cells redox state from mice with endotoxin-induced oxidative stress: involvement of NF-kappaB. Free Radic. Res. 37:19–27.[CrossRef][Medline]
  45. Hsu, H. Y., and M. H. Wen. 2002. Lipopolysaccharide-mediated reactive oxygen species and signal transduction in the regulation of interleukin-1 gene expression. J. Biol. Chem. 277:22131–22139.[Abstract/Free Full Text]
  46. Shi, M. M., I. Chong, J. J. Godleski, and J. D. Paulauskis. 1999. Regulation of macrophage inflammatory protein–2 gene expression by oxidative stress in rat alveolar macrophages. Immunology 97:309–315.[CrossRef][Medline]
  47. Jaramillo, M., and M. Olivier. 2002. Hydrogen peroxide induces murine macrophage chemokine gene transcription via extracellular signal-regulated kinase- and cyclic adenosine 5'-monophosphate (cAMP)–dependent pathways: involvement of NF-kappa B, activator protein 1, and cAMP response element binding protein. J. Immunol. 169:7026–7038.[Abstract/Free Full Text]
  48. Marikovsky, M., V. Ziv, N. Nevo, C. Harris-Cerruti, and O. Mahler. 2003. Cu/Zn superoxide dismutase plays important role in immune response. J. Immunol. 170:2993–3001.[Abstract/Free Full Text]
  49. Simeonova, P. P., and M. I. Luster. 1995. Iron and reactive oxygen species in the asbestos-induced tumor necrosis factor-{alpha} response from alveolar macrophages. Am. J. Respir. Cell Mol. Biol. 12:676–683.[Abstract]
  50. Walther, F. J., C. E. Gidding, I. M. Kuipers, D. Willebrand, E. M. Bevers, A. Abuchowski, and A. T. Viau. 1986. Prevention of oxygen toxicity with superoxide dismutase and catalase in premature lambs. J. Free Radic. Biol. Med. 2:289–293.[CrossRef][Medline]
  51. Robbins, C. G., S. Horowitz, T. A. Merritt, A. Kheiter, J. Tierney, P. Narula, and J. M. Davis. 1997. Recombinant human superoxide dismutase reduces lung injury caused by inhaled nitric oxide and hyperoxia. Am. J. Physiol. 272:L903–L907.
  52. Rosenfeld, W., H. Evans, L. Concepcion, R. Jhaveri, H. Schaeffer, and A. Friedman. 1984. Prevention of bronchopulmonary dysplasia by administration of bovine superoxide dismutase in preterm infants with respiratory distress syndrome. J. Pediatr. 105:781–785.[CrossRef][Medline]
  53. Suresh, G. K., J. M. Davis, and R. F. Soll. 2001. Superoxide dismutase for preventing chronic lung disease in mechanically ventilated preterm infants. Cochrane Database Syst Rev 1:CD001968.
  54. Walther, F. J., R. David-Cu, and S. L. Lopez. 1995. Antioxidant–surfactant liposomes mitigate hyperoxic lung injury in premature rabbits. Am. J. Physiol. 269:L613–L617.
  55. Yamamoto, H., T. Koizumi, T. Kaneki, M. Hanaoka, and K. Kubo. 2000. Effects of lecithinized superoxide dismutase and a neutrophil elastase inhibitor (ONO-5046) on hyperoxic lung injury in rat. Eur. J. Pharmacol. 409:179–183.[CrossRef][Medline]
  56. Gao, B., S. C. Flores, J. A. Leff, S. K. Bose, and J. M. McCord. 2003. Synthesis and anti-inflammatory activity of a chimeric recombinant superoxide dismutase: SOD2/3. Am. J. Physiol. Lung Cell. Mol. Physiol. 284:L917–L925.[Abstract/Free Full Text]
  57. Murray, J., J. A. Barbara, S. A. Dunkley, A. F. Lopez, X. Van Ostade, A. M. Condliffe, I. Dransfield, C. Haslett, and E. R. Chilvers. 1997. Regulation of neutrophil apoptosis by tumor necrosis factor-alpha: requirement for TNFR55 and TNFR75 for induction of apoptosis in vitro. Blood 90:2772–2783.[Abstract/Free Full Text]
  58. Misso, N. L., C. D. Peacock, D. N. Watkins, and P. J. Thompson. 2000. Nitrite generation and antioxidant effects during neutrophil apoptosis. Free Radic. Biol. Med. 28:934–943.[CrossRef][Medline]
  59. Ruiz, L. M., G. Bedoya, J. Salazar, O. D. de Garcia, and P. J. Patino. 2002. Dexamethasone inhibits apoptosis of human neutrophils induced by reactive oxygen species. Inflammation 26:215–222.[CrossRef][Medline]
  60. Wang, L., D. Medan, R. Mercer, D. Overmiller, S. Leornard, V. Castranova, X. Shi, M. Ding, C. Huang, and Y. Rojanasakul. 2003. Vanadium-induced apoptosis and pulmonary inflammation in mice: role of reactive oxygen species. J. Cell. Physiol. 195:99–107.[CrossRef][Medline]
  61. Laukkanen, M. O., P. Leppanen, P. Turunen, T. Tuomisto, J. Naarala, and S. Yla-Herttuala. 2001. EC-SOD gene therapy reduces paracetamol-induced liver damage in mice. J. Gene Med. 3:321–325.[CrossRef][Medline]
  62. Hubbard, A. K., and R. Rothlein. 2000. Intercellular adhesion molecule–1 (ICAM-1) expression and cell signaling cascades. Free Radic. Biol. Med. 28:1379–1386.[CrossRef][Medline]
  63. Pueyo, M. E., W. Gonzalez, A. Nicoletti, F. Savoie, J. F. Arnal, and J. B. Michel. 2000. Angiotensin II stimulates endothelial vascular cell adhesion molecule–1 via nuclear factor–kappaB activation induced by intracellular oxidative stress. Arterioscler. Thromb. Vasc. Biol. 20:645–651.[Abstract/Free Full Text]
  64. Folch, E., A. Salas, J. Panes, E. Gelpi, J. Rosello-Catafau, D. C. Anderson, S. Navarro, J. M. Pique, L. Fernandez-Cruz, and D. Closa. 1999. Role of P-selectin and ICAM-1 in pancreatitis-induced lung inflammation in rats: significance of oxidative stress. Ann. Surg. 230:792–798.[CrossRef][Medline]
  65. Sohn, H. Y., F. Krotz, S. Zahler, T. Gloe, M. Keller, K. Theisen, T. M. Schiele, V. Klauss, and U. Pohl. 2003. Crucial role of local peroxynitrite formation in neutrophil-induced endothelial cell activation. Cardiovasc. Res. 57:804–815.[Abstract/Free Full Text]
  66. Gotsch, U., U. Jager, M. Dominis, and D. Vestweber. 1994. Expression of P-selectin on endothelial cells is upregulated by LPS and TNF-alpha in vivo. Cell Adhes. Commun. 2:7–14.[Medline]
  67. Jonsson, L. M., D. D. Rees, T. Edlund, and S. L. Marklund. 2002. Nitric oxide and blood pressure in mice lacking extracellular-superoxide dismutase. Free Radic. Res. 36:755–758.[CrossRef][Medline]
  68. Wang, W., S. Jittikanont, S. A. Falk, P. Li, L. Feng, P. E. Gengaro, B. D. Poole, R. P. Bowler, B. J. Day, J. D. Crapo, and R. W. Schrier. 2003. Interaction among nitric oxide, reactive oxygen species, and antioxidants during endotoxemia-related acute renal failure. Am. J. Physiol. Renal Physiol. 284:F532–F537.[Abstract/Free Full Text]
  69. Petersen, S. V., T. D. Oury, L. Ostergaard, Z. Valnickova, J. Wegrzyn, I. B. Thogersen, C. Jacobsen, R. P. Bowler, C. L. Fattman, J. D. Crapo, and J. J. Enghild. 2004. Extracellular superoxide dismutase (EC-SOD) binds to type i collagen and protects against oxidative fragmentation. J. Biol. Chem. 279:13705–13710.[Abstract/Free Full Text]
  70. Monboisse, J. C., G. Bellon, A. Randoux, J. Dufer, and J. P. Borel. 1990. Activation of human neutrophils by type I collagen: requirement of two different sequences. Biochem. J. 270:459–462.[Medline]
  71. Thannickal, V. J., and B. L. Fanburg. 2000. Reactive oxygen species in cell signaling. Am. J. Physiol. Lung Cell. Mol. Physiol. 279:L1005–L1028.[Abstract/Free Full Text]
  72. Lambeth, J. D. 2004. NOX enzymes and the biology of reactive oxygen. Nat. Rev. Immunol. 4:181–189.[CrossRef][Medline]
  73. Meng, T. C., T. Fukada, and N. K. Tonks. 2002. Reversible oxidation and inactivation of protein tyrosine phosphatases in vivo. Mol. Cell 9:387–399.[CrossRef][Medline]
  74. Nimnual, A. S., L. J. Taylor, and D. Bar-Sagi. 2003. Redox-dependent downregulation of Rho by Rac. Nat. Cell Biol. 5:236–241.[CrossRef][Medline]
  75. Liu, T., S. Castro, A. R. Brasier, M. Jamaluddin, R. P. Garofalo, and A. Casola. 2004. Reactive oxygen species mediate virus-induced STAT activation: role of tyrosine phosphatases. J. Biol. Chem. 279:2461–2469.[Abstract/Free Full Text]
  76. Goldman, E. H., L. Chen, and H. Fu. 2004. Activation of apoptosis signal–regulating kinase 1 by reactive oxygen species through dephosphorylation at serine 967 and 14–3-3 dissociation. J. Biol. Chem. 279:10442–10449.[Abstract/Free Full Text]
  77. Yang, Y., R. Sharma, A. Sharma, S. Awasthi, and Y. C. Awasthi. 2003. Lipid peroxidation and cell cycle signaling: 4-hydroxynonenal, a key molecule in stress-mediated signaling. Acta Biochim. Pol. 50:319–336.[Medline]



This article has been cited by other articles:


Home page
Am. J. Respir. Crit. Care Med.Home page
H. E. Marshall, E. N. Potts, Z. T. Kelleher, J. S. Stamler, W. M. Foster, and R. L. Auten
Protection from Lipopolysaccharide-induced Lung Injury by Augmentation of Airway S-Nitrosothiols
Am. J. Respir. Crit. Care Med., July 1, 2009; 180(1): 11 - 18.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
T. R. Richens, D. J. Linderman, S. A. Horstmann, C. Lambert, Y.-Q. Xiao, R. L. Keith, D. M. Boe, K. Morimoto, R. P. Bowler, B. J. Day, et al.
Cigarette Smoke Impairs Clearance of Apoptotic Cells through Oxidant-dependent Activation of RhoA
Am. J. Respir. Crit. Care Med., June 1, 2009; 179(11): 1011 - 1021.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. D. Lund, Y. Chu, J. D. Miller, and D. D. Heistad
Protective effect of extracellular superoxide dismutase on endothelial function during aging
Am J Physiol Heart Circ Physiol, June 1, 2009; 296(6): H1920 - H1925.
[Abstract] [Full Text] [PDF]


Home page
Ann Clin BiochemHome page
R Laskaj, S Dodig, I Cepelak, and I Kuzman
Superoxide dismutase, copper and zinc concentrations in platelet-rich plasma of pneumonia patients
Ann Clin Biochem, March 1, 2009; 46(2): 123 - 128.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. R. Kliment, J. M. Englert, B. R. Gochuico, G. Yu, N. Kaminski, I. Rosas, and T. D. Oury
Oxidative Stress Alters Syndecan-1 Distribution in Lungs with Pulmonary Fibrosis
J. Biol. Chem., February 6, 2009; 284(6): 3537 - 3545.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
J. J. Arcaroli, J. E. Hokanson, E. Abraham, M. Geraci, J. R. Murphy, R. P. Bowler, C. A. Dinarello, L. Silveira, J. Sankoff, D. Heyland, et al.
Extracellular Superoxide Dismutase Haplotypes Are Associated with Acute Lung Injury and Mortality
Am. J. Respir. Crit. Care Med., January 15, 2009; 179(2): 105 - 112.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
M. Dahl, R. P. Bowler, K. Juul, J. D. Crapo, S. Levy, and B. G. Nordestgaard
Superoxide Dismutase 3 Polymorphism Associated with Reduced Lung Function in Two Large Populations
Am. J. Respir. Crit. Care Med., November 1, 2008; 178(9): 906 - 912.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
E. Nozik-Grayck, H. B. Suliman, S. Majka, J. Albietz, Z. Van Rheen, K. Roush, and K. R. Stenmark
Lung EC-SOD overexpression attenuates hypoxic induction of Egr-1 and chronic hypoxic pulmonary vascular remodeling
Am J Physiol Lung Cell Mol Physiol, September 1, 2008; 295(3): L422 - L430.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
H. W. Kim, A. Lin, R. E. Guldberg, M. Ushio-Fukai, and T. Fukai
Essential Role of Extracellular SOD in Reparative Neovascularization Induced by Hindlimb Ischemia
Circ. Res., August 17, 2007; 101(4): 409 - 419.
[Abstract] [Full Text] [PDF]


Home page
Anesth. Analg.Home page
D. Suter, D. R. Spahn, S. Blumenthal, L. Reyes, C. Booy, B. R. Z'graggen, and B. Beck-Schimmer
The Immunomodulatory Effect of Sevoflurane in Endotoxin-Injured Alveolar Epithelial Cells
Anesth. Analg., March 1, 2007; 104(3): 638 - 645.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
K. Juul, A. Tybjaerg-Hansen, S. Marklund, P. Lange, and B. G. Nordestgaard
Genetically Increased Antioxidative Protection and Decreased Chronic Obstructive Pulmonary Disease
Am. J. Respir. Crit. Care Med., April 15, 2006; 173(8): 858 - 864.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
R. J. Tan, J. S. Lee, M. L. Manni, C. L. Fattman, J. M. Tobolewski, M. Zheng, J. K. Kolls, T. R. Martin, and T. D. Oury
Inflammatory Cells as a Source of Airspace Extracellular Superoxide Dismutase after Pulmonary Injury
Am. J. Respir. Cell Mol. Biol., February 1, 2006; 34(2): 226 - 232.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. M. Condliffe, K. Davidson, K. E. Anderson, C. D. Ellson, T. Crabbe, K. Okkenhaug, B. Vanhaesebroeck, M. Turner, L. Webb, M. P. Wymann, et al.
Sequential activation of class IB and class IA PI3K is important for the primed respiratory burst of human but not murine neutrophils
Blood, August 15, 2005; 106(4): 1432 - 1440.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
R. S. Munford
Invited review: Detoxifying endotoxin: time, place and person
Innate Immunity, April 1, 2005; 11(2): 69 - 84.
[Abstract] [PDF]


Home page
Am. J. Pathol.Home page
Y. Janssen-Heininger, K. Ckless, N. Reynaert, and A. van der Vliet
SOD Inactivation in Asthma: Bad News or NO News?
Am. J. Pathol., March 1, 2005; 166(3): 649 - 652.
[Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. Rojas, C. R. Woods, A. L. Mora, J. Xu, and K. L. Brigham
Endotoxin-induced lung injury in mice: structural, functional, and biochemical responses
Am J Physiol Lung Cell Mol Physiol, February 1, 2005; 288(2): L333 - L341.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-0057OCv1
31/4/432    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bowler, R. P.
Right arrow Articles by Worthen, G. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bowler, R. P.
Right arrow Articles by Worthen, G. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2004 American Thoracic Society.