help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published ahead of print on August 27, 2004, doi:10.1165/rcmb.2004-0182OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-0182OCv1
31/6/679    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, F.
Right arrow Articles by Mason, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, F.
Right arrow Articles by Mason, R. J.
American Journal of Respiratory Cell and Molecular Biology. Vol. 31, pp. 679-686, 2004
© 2004 American Thoracic Society
DOI: 10.1165/rcmb.2004-0182OC

Transforming Growth Factor–ß Antagonizes Alveolar Type II Cell Proliferation Induced by Keratinocyte Growth Factor

Feijie Zhang, Larry D. Nielsen, Joseph J. Lucas and Robert J. Mason

Departments of Medicine and Pediatrics, National Jewish Medical and Research Center, Denver, Colorado

Address correspondence to: Robert J. Mason, M.D., National Jewish Medical and Research Center, 1400 Jackson Street, Denver, CO 80206. E-mail: masonb{at}njc.org


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Keratinocyte growth factor (KGF) is a mitogen for rat type II cells and also stimulates differentiation in vitro. Administration of KGF also protects the lung from a variety of injuries and subsequent development of fibrosis. Because transforming growth factor (TGF)-ß has been shown to inhibit epithelial cell proliferation and surfactant protein gene expression in other systems and is thought to be a major effector in pulmonary fibrosis, we sought to determine if TGF-ß would antagonize the effects of KGF in primary cultures of alveolar type II cells. Type II cells were cultured on a matrix of type I collagen and Matrigel in the presence or absence of KGF and/or TGF-ß. KGF alone greatly stimulated proliferation and increased cyclin-dependent kinase (cdk) 2 kinase activity and Retinoblastoma susceptibility gene product (Rb) phosphorylation. Cyclin D1, cdk2, and cdc25A protein levels were increased, and p15Ink4b and p27Kip1 protein levels were decreased. TGF-ß markedly inhibited alveolar epithelial cell proliferation induced by KGF. TGF-ß inhibited cdk2 enzyme activity and Rb phosphorylation and increased p15Ink4b protein levels. TGF-ß also inhibited differentiation induced by KGF as measured by secretion of surfactant protein–A into the apical media. In summary, TGF-ß inhibits the proliferative effect of KGF in vitro and may be a biologic antagonist of KGF.

Abbreviations: Dulbecco's modified Eagle's medium, DMEM • dithiothreitol, DTT • horseradish peroxidase, HRP • immunoglobulin, Ig • immunoprecipitation, IP • keratinocyte growth factor, KGF • polyacrylamide gel electrophoresis, PAGE • phosphate-buffered saline, PBS • Retinoblastoma susceptibility gene product, Rb • real-time polymerase chain reaction, RT-PCR • sodium dodecyl sulfate, SDS • transforming growth factor, TGF


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Alveolar type II cells serve as progenitor cells for the alveolar epithelium (1). After lung injury and damage to type I cells, type II cells proliferate to repair the epithelium. This type II cell proliferation is a common response to alveolar injury, and is seen in many forms of acute lung injury and interstitial lung disease. Keratinocyte growth factor (KGF, also known as FGF-7) is a potent mitogen for alveolar type II cells in vivo and in vitro (24). KGF induces type II cell hyperplasia and KGF pretreatment can protect the lung from a variety of injuries, including bleomycin, acid instillation, irradiation, and hyperoxia (57). KGF also protects epithelial cells from oxidant-induced stress, in part by activation of p21-activated protein kinase 4 (8). KGF stimulates the extracellular signal–regulated kinase and Akt pathways in alveolar type II cells (9). Hence, KGF likely activates a variety of survival pathways and inhibits apoptosis.

There are likely opposing paracrine or autocrine factors that limit proliferation induced by KGF. Transforming growth factor (TGF)-ß may be one of these factors. In fibrotic lung, TGF-ß is expressed in type II cells as well as in alveolar macrophages (10, 11). In addition to its ability to suppress inflammation and increase extracellular matrix, TGF-ß is known to inhibit proliferation of many epithelial cell types (12). TGF-ß is expressed intracellularly in hypertrophic type II cells and extracellularly in the fibrotic areas immediately beneath the hypertrophic type II cells (13, 14). The original bioassay for TGF-ß was based on its ability to inhibit proliferation of a mink pulmonary epithelial cell line. More recently, TGF-ß has been reported to inhibit proliferation of murine and human mammary epithelial cells, human HepG2 cells, human prostate epithelial cells, and a rat kidney cell line, among others (12, 1518). One of the limitations of the previous studies is that many used cancer and transformed cell lines. There is much less information on normal epithelial cells in primary culture.

TGF-ß is also thought to be a critical factor in the development of pulmonary fibrosis. Much of the attention on TGF-ß has focused on its ability to convert fibroblasts into myofibroblasts and to stimulate the production of extracellular matrix by mesenchymal cells. However, part of the adverse role of TGF-ß in fibrotic disease could be its ability to limit alveolar epithelial cell proliferation and repair. Failure of epithelial repair and dysregulation of alveolar type II cells has been postulated as an important mechanism in the development of pulmonary fibrosis (19, 20).

The mechanisms whereby TGF-ß inhibits epithelial proliferation are variable and dependent on the stimulus for proliferation and the specific epithelial cell type involved (12). In general, TGF-ß inhibits the cell cycle before the restriction (R) point in the transition from the G1 to the S phase of the cell cycle. After the restriction point, cells no longer need serum to proliferate and are no longer sensitive to inhibition by TBF-ß. TGF-ß has been reported to inhibit cdk2, cdk4, and cdk6 cyclin-dependent complexes. The mechanism of inhibition of these kinase complexes has been attributed to increased p15 (p15Ink4b), increased p21 (p21Cip1), displacement of p27 (p27Kip1), and inhibition of cdc25A, an activating phosphatase, which removes an inhibitory phosphotyrosine on cdk2 (12, 21). Another proposed mechanism of TGF-ß inhibition of proliferation is by inhibition of a cyclin activating kinase, of which there may be several (15). There are no detailed reports on the effect of TGF-ß on proliferating adult alveolar type II epithelial cells or interactions with KGF signaling.

In this study, we sought to determine whether TGF-ß would inhibit type II cell proliferation induced by KGF and the mechanisms for this inhibition. Because the potential pathways for inhibition of proliferation by TGF-ß are multiple and varied with the cell line used, we chose to use rat alveolar type II cells in primary culture. Rat type II cells were selected because many of the reports on the protective effect of KGF for acute lung injury were done with this species.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The source of most reagents is stated in the description of the individual methods. Recombinant human KGF (rhKGF) and recombinant human TGF-ß1 (rhTGF-ß1) were purchased from R&D Systems (Minneapolis, MN).

Antibodies Used in This Study
The following antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA): goat anti-actin (I-19): sc-1616; rabbit anti-cdk2 (M-2): sc-163; rabbit anti-cdk4 (C-22): sc-260; rabbit anti-cdk6 (C-21): sc-177; rabbit anti-cyclin E (M-20): sc-481, mouse anti-cyclin D-1 (72–13G): sc-450; rabbit anti-cyclin A (H-432): sc-751; goat anti-p15 (M-20): sc-1429; rabbit anti-p16 (M-156): sc-1207; rabbit anti-p18 (N-20): sc-865; rabbit anti-p21 (C-19): sc-397; rabbit anti-p27 (C-19): sc-528, goat anti-p57 (M-20): sc-1039; and rabbit anti-cdc25A (144): sc-97. Mouse anti-Retinoblastoma susceptibility gene product (Rb): 14001A and anti-p27 was purchased from BD-Pharmingen (San Diego, CA) and mouse anti-P53 (Ab-1): OP03 was purchased from Calbiochem (San Diego, CA). Horseradish peroxidase (HRP)-conjugated AffiniPure donkey anti-rabbit IgG: 711–035–152, HRP-conjugated AffiniPure donkey anti-mouse immunoglobulin (Ig) G: 715–035–151, and HRP-conjugated AffiniPure donkey anti-goat IgG: 705–035–147 were purchased from Jackson ImmunoResearch (West Grove, PA). Rabbit anti–surfactant protein (SP)-A and anti–SP-D were gifts of Dennis Voelker, National Jewish Medical and Research Center, Denver, CO.

Isolation and Culture of Type II Cells
Alveolar type II cells were isolated from specific pathogen-free adult male Sprague-Dawley rats (Harlan, Indianapolis, IN) by dissociation with porcine pancreatic elastase (Worthington Biochemical, Freehold, NJ) and partial purification on discontinuous metrizamide gradients (22). Type II cells were cultured on a filter insert (30-mm-diameter Millicell-CM; Millipore, Bedford, MA) that had been coated with 0.4 ml of a 4:1 (vol/vol) mixture of rat-tail collagen and Engelbreth-Holm-Swarm (EHS) tumor matrix (Matrigel; Collaborative Biomedical Products, Bedford, MA). The matrix was prepared on ice and allowed to gel at 37°C for 15 min. Viable cells (2.5 x 106) were plated in 1 ml of Dulbecco's modified Eagle's medium (DMEM) containing 5% rat serum (Pel Freez Biologicals, Rogers, AK) plus 2 mM glutamine, 2.5 µg/ml amphotericin B, 10 µg/ml gentamicin, 100 µg/ml streptomycin, and 100 µg/ml penicillin (Sigma, St. Louis, MO). Two milliliters of the same medium was added to each well outside the insert. After overnight incubation at 37°C in 10% CO2, the attached monolayers were rinsed with DMEM, and 0.4 ml of the specified medium was added to the apical surface and 2 ml of the medium was placed outside the insert. In different experiments, the medium contained combinations of 1% charcoal-stripped fetal bovine serum, 5% rat serum, 10 ng/ml KGF, and varying concentrations of TGF-ß. The plates were placed on a rocking platform inside an incubator gassed with 10% CO2 at 37°C. The medium was changed every 2 d.

DNA Assay
To harvest type II cells for the DNA assay, the matrix was digested by incubation in dispase (BD Biosciences, Bedford, MA) and collagenase (Worthington Biochemical Corporation, Lakewood, NJ) mixture for 1 h at 37°C after the medium was removed. Once released from matrix, the cells were pelleted by centrifugation at 500 x g for 10 min. The cells were washed twice with ice-cold saline. DNA content was determined fluorometrically by the procedure of Labarca and Paigen, as described previously (23).

Measurement of SP-A and SP-D
SP-A and SP-D were measured by enzyme-linked immunosorbent assay (23). Briefly, recombinant rat SP-A and SP-D produced in Chinese hamster ovary cells were used as the SP-A and SP-D standards. Polyclonal anti-rat SP-A or anti–SP-D rabbit IgG (10 µg/ml in 0.1 M Na bicarbonate) was bound to wells in microtiter plates (Immulon 1 plates; Dynatech Laboratories, Alexandria, VA) overnight at room temperature. The wells were then incubated with a 4% (wt/vol) solution of nonfat dry milk in phosphate-buffered saline (PBS) (1% triton X-100 in PBS) to block nonspecific binding (blocking buffer) for at least 30 min at room temperature. The samples were added and the enzyme-linked immunosorbent assay performed as described previously (23).

Immunoblotting
Preparation of cell lysates. Cells were lysed using ice-cold RIPA buffer containing freshly added inhibitors. RIPA buffer contained 10 mM Tris-HCl, pH 8, 50 mM NaCl, 0.5% Na deoxycholate, 0.2% sodium dodecyl sulfate (SDS) (all from Sigma), and 1% Nonidet P-40 (USB, Cleveland, OH). This buffer also contained 1x protease inhibitor cocktail (Pharmingen) (benzamidine-HCl, phenanthroline, aprotinin, leupeptin, pepstatin A, and phenylmethylsulfonyl-fluoride), 1x phosphatase inhibitor cocktail 2 (Sigma) (Na orthovanadate, Na molybdate, Na tartrate, and imidazole) and ALLN (N-acetyl-Leu-Leu-Nle-CHO) (Calbiochem) at 25 µg/ml. Dishes containing air–liquid cultures were placed on ice, the medium removed, and the cell/matrix layer carefully rinsed three times with ice-cold PBS. Ice-cold RIPA lysis buffer (0.2–0.4 ml) was applied to the cell layer for 15 min on ice. During this time, the dishes were rocked gently to prevent disruption of the matrix. The lysate was transferred to a 1.5 ml Eppendorf tube. The cell layer was extracted a second time with 0.2–0.4 ml of RIPA lysis buffer by repeating this procedure and pooling the extracts. DNA was sheared using a syringe and 25-gauge needle 15 times. Insoluble material was removed by centrifugation at 14,000 x g at 4°C for 10 min. One part 4x SDS-polyacrylamide gel electrophoresis (PAGE) reducing sample buffer was added to three parts lysate. The mixtures were boiled for 5 min and stored at –20°C until used.

SDS-PAGE. Aliquots of the lysates in reducing sample buffer were layered onto precast 8–16% Tris-glycine polyacrylamide slab gels and the proteins separated by electrophoresis in a Novex X cell Mini-cell (Invitrogen, Carlsbad, CA). The volumes of lysates were adjusted to give equal amounts of actin protein. The proteins were transferred to nitrocellulose membranes using the Novex X cell blot module, according to manufacturer's instructions.

Immunodetection of proteins. Immunoblotting was done as described previously (22). Nonspecific binding sites on the nitrocellulose membranes were blocked by incubating the blots in 5% nonfat dry milk in TTBS (20 mM Tris-HCl, pH 7.5, 137 mM NaCl, and 0.05% Tween-20, all from Sigma) at 4°C overnight. Primary antibodies to specific proteins were diluted in 5% bovine serum albumin or 5% nonfat dry milk in TTBS. Protein detection was by HRP-enhanced chemiluminescence (ECL-plus; Amersham Pharmacia Biotech, Piscataway, NJ) according to manufacturer's instructions. Exposure to Hyperfilm (Amersham Pharmacia Biotech) was used to measure chemiluminescence, and exposure time was varied depending on the strength of the signal.

Immunoprecipitation and Kinase Assay
Preparation of cell lysates. Cells were lysed using ice-cold immunoprecipitation (IP) lysis buffer containing freshly added inhibitors and 10% glycerol (vol/vol). IP lysis buffer contained 50 mM Hepes (pH 7.5), 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid, 2.5 mM ethyleneglycol-bis-(ß-aminoethyl ether)-N,N'-tetraacetic acid, 1 mM dithiothreitol (DTT), 0.1% Tween 20, and inhibitors (same as RIPA buffer above) (24, 25). Dishes containing air–liquid cultures were placed on ice, the medium removed, and the cell–matrix layer carefully rinsed three times with ice-cold PBS. Ice-cold IP lysis buffer (0.5 ml) was applied to the cell layer for 30 min on ice. During this time, the dishes were rocked gently. The lysate was transferred to a 1.5 ml Eppendorf tube. The cell layer was extracted a second time with 0.5 ml of IP lysis buffer by repeating this procedure and pooling the extracts. DNA was sheared using a syringe and 25-gauge needle. Insoluble material was removed by centrifugation at 14,000 x g at 4°C for 10 min. The lysates were used immediately for immunoprecipitation.

Immunoprecipitation. The IP lysates were precleared using 20 µl of washed protein G sepharose beads (Protein G Sepharose 4 Fast Flow; Amersham Pharmacia), washed 3 times in IP lysis buffer without glycerol or inhibitors. The mixtures were incubated for 30 min at 4°C on a tube rotator. The beads were removed by centrifugation. Equal aliquots (usually ~ 500 µl) of the cleared lysates from each culture condition were incubated for 90 min at 4°C with 1 µg of either rabbit anti-cdk2, anti-cdk4 or anti-cdk6 (see ANTIBODIES USED IN THIS STUDY above) on a tube rotator. Fresh-washed protein G sepharose beads (10 µl) were added to each sample and incubated for an additional 60 min at 4°C on a rotator. The beads were collected by centrifugation at 1,000 x g for 5 min at 4°C and washed 3 times in IP lysis buffer without glycerol or inhibitors. The immunoprecipate–bead complexes were assayed immediately for kinase activity.

Kinase assays. Kinase assays were performed as described previously (24, 25). The washed beads containing the bound immunoprecipitates were washed one additional time in kinase buffer. The cdk2 kinase buffer contained 50 mM Tris (pH 7.4), 10 mM MgCl2, and 1 mM DTT, and the cdk4/6 kinase buffer contained 50 mM Hepes (pH 7.2), 10 mM MgCl2, 5 mM MnCl2, and 1 mM DTT. Each of the immunoprecipitate–bead complexes was then suspended in 25 µl of the appropriate kinase buffer containing 40 uM ATP (Amersham Pharmacia), 20 uCi {gamma}-32P-ATP (Perkin Elmer, Boston MA) and 1 µg calf thymus histone H-1 (Calbiochem) for cdk2 or 0.5 µg truncated Rb protein (p56RB from QED Bioscience, San Diego, CA) for cdk4 and cdk6. The mixtures were incubated for 30 min at 30°C. The reactions were stopped by adding 10 µl of 4x Laemmli reducing buffer and heating for 5 min at 80°C. Equal aliquots of each kinase reaction product were electrophoresed on precast 8–16% Tris-glycine Novex gels (see SDS-PAGE method above). The gels were stained with Coomassie blue and dried onto filter paper. Autoradiography was performed using Hyperfilm.

Labeling Index
DNA synthesis was monitored and the labeling index determined as previously described (26). Briefly, cells in the air–liquid culture were labeled with 1 uCi of 3H-thymidine (adjusted to 1.12 uCi/nmole thymidine) for 24 h before harvest. Cell cultures were harvested on Days 2, 4, and 6 after the addition of KGF (Figure 1). The cultures were washed three times with DMEM, then fixed with 4% paraformaldehyde and processed for histology as previously described (22). Multiple sections (of each culture) on microscope slides were dipped in photographic emulsion (NTB2; Kodak, Rochester, NY). Slides were developed after 2, 3, and 7 d exposure. Hematoxylin was used to counterstain the cells. Cells were counted and the percent containing label was determined.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. Effects of KGF and TGF-ß on type II cell proliferation. Adult rat lung alveolar type II cells were plated in 5% rat serum for 24 h and then cultured 6 d with or without the addition of KGF (10 ng/ml) and/or TGF-ß (1 ng/ml). The media were changed every other day. The cells were plated on Day 0 and harvested on Days 1, 2, 3, 5, and 7. To collect the type II cells for DNA analysis, the matrix was digested with type I collagenase and dispase. The DNA content was determined fluorometrically. The mean ± SEM of four independent experiments is shown. Day 0 represents the amount of cells plated into each well. The symbols are identified on the figure. *Values significantly different from rat serum alone (P < 0.05). Circles, 5% rat serum; squares, 5% rat serum + KGF; Xs, 5% rat serum + TGF-ß; triangles, 5% rat serum + KGF + TGF-ß.

 
Real-Time Polymerase Chain Reaction
To document gene expression, mRNA was extracted, isolated, and prepared as described previously (22). Real-time polymerase chain reaction (RT-PCR) was performed with specific primers and probes. We designed primers and probes for cyclin D1 (accession # D14014), p15 (accession # NM_130812), p27 (accession # NM_031762), and cdc25A (accession # NM_133571) using Primers express 1.5a software (Applied Biosystems, Branchburg, NJ). For cyclin D1, the forward primer was CCACGATTTCATCGAACACTTC, the reverse primer was GTGCATGTTTGCGGATGATC, and the probe was CTCATCCGCCTCTGGCATTTTGGAG. For p15, the forward primer was CCGCCTGCCGGTAGACTTA, the reverse primer was TGGCAGCGTGCAGATACCT, and the probe was CAATATCACGGTGGCCCTGCTCTTCAG. For p27, the forward primer was GCCAGCAGAACAGAAGAAAATGT, the reverse primer was GGGCGTCTGCTCCACAGT, and the probe was TCAGACGGTTCCCCGAATGCTGG. For cdc25A, the forward primer was CCCGTCGTGCATGTCAAG, the reverse primer was ACATCGATCGGCAAGGTTTG, and the probe was TCTGGACCGCTCCCCTTGTCATG.

Statistical Analysis
An analysis of variance was used to compare the outcome variables with different treatments. Dunnett's multiple comparison method was used to compare the treatments to the control. Values are presented as the means ± SE and a P value < 0.05 was considered statistically significant. Analyses were done with the JMP statistical analysis program (SAS Institute Inc., Cary, NC).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
KGF Stimulates Proliferation and Rb Phosphorylation
Previous reports have established that KGF can stimulate rat type II cell proliferation in vivo and in vitro (2, 4, 23). As shown in Figure 1, KGF stimulated proliferation as measured by DNA per well, which is the most reliable means of assessing cell number in these cultures on the Matrigel–collagen matrix. Most of the proliferation appeared to occur within the first 2 d after KGF addition. This conclusion was supported by measuring tritiated thymidine labeling indices. The labeling index for rat serum alone was 16.2 ± 1.1% on Day 3 of culture, 0.4 ± 0.2% on Day 5 of culture, and 1.1 ± 0.3% on Day 7 of culture (n = 12 slides from 2 independent experiments). KGF increased the labeling index to 57.6 ± 2.2% on Day 3 of culture (2 d with KGF), 37.4 ± 2.8% on Day 5 of culture (4 d with KGF) and 7.1 ± 1.2% on Day 7 (6 d with KGF). Hence, to define the pathways stimulated by KGF, cell cycle proteins were measured by immunoblotting in whole-cell lysates at 24 and 48 h after the addition of KGF. Because both time points gave similar results, only the 24 h data are shown in Figure 2.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 2. Alterations in cell cycle proteins by KGF and TGF-ß. Adult rat lung alveolar type II cells were cultured with or without the addition of KGF and/or TGF-ß for 24 h from Day 1 to Day 2 of culture. Cells were lysed using ice-cold RIPA buffer containing freshly added protease and phosphatase inhibitors. Protein amounts and migration were determined by immunoblotting, as stated in MATERIALS AND METHODS. Lane 1 is from an extract of cells on Day 1 cultured in rat serum before the addition of KGF or TGF-ß. Lane 2 is an additional 24 h (Day 2) with rat serum. Lane 3 is 24 h with 10 ng/ml KGF (Day 2). Lane 4 is 24 h with 1 ng/ml TGF-ß (Day 2). Lane 5 is 24 h with KGF and TGF-ß (Day 2). (A) The hyperphosphorylated forms of Rb required for progression through the cell cycle are in the upper band and migrate slower than the parent protein; (B) cdc25A; (C) The lower, faster migrating band represents the active cdk2 isoform; (D) cyclin E; (E) cdk4; (F) cyclin D1; (G) p15; (H) p27; and (I) actin. This figure is representative of at least three independent experiments.

 
A critical step for the progression out of the G1 phase and into the S phase of the cell cycle is Rb hyperphosphorylation. As shown in Figure 2A (lane 3), KGF increased the amount of the upper, slower running band of Rb, which corresponds to the hyperphosphorylated forms. Rb is at least partly phosphorylated by cdk2. For activation, cdk2 must bind to a cyclin, be phosphorylated at Thr160, and be diphosphorylated at Tyr15 and Thr14. As shown in Figure 2C (lane 3), KGF increased the lower, faster migrating, active form of cdk2. Phosphorylation at Thr160 is responsible for this increase in electrophoretic mobility (27). The phosphatase responsible for the activation of cdk2 by removal of the inhibitory phosphate is cdc25A (28). This phosphatase was also increased by KGF (Figure 2B, lane 3). Cyclin E associates with and activates cdk2 in the G1 phase of the cell cycle. However, there was no major change in cyclin E (Figure 2D, lanes 2 and 3). KGF also greatly increased cyclin D1, decreased p27, but had no apparent effect on p15. At 48 h, the increase in Rb hyperphosphorylation and in cyclin D1 due to KGF was less than at 24 h. The other results were nearly identical, except that the decrease in p27 due to KGF was even more apparent.

Although an increase in cdk2 activity with KGF is suggested by the increase in the faster migrating band (Figure 2C, lane 3), kinase activity was also measured as shown in Figure 3. Cdk2, cdk4, and cdk6 kinases were immunoprecipitated, and their kinase activities were measured with histone H1 as the substrate for cdk2 and truncated Rb as the substrate for cdk4 and cdk6. As shown in Figure 3, KGF only stimulated cdk2 kinase activity at the 24 h time point. There was no change in cdk4 and cdk6 kinase activity at this time point.



View larger version (68K):
[in this window]
[in a new window]
 
Figure 3. Effect of KGF and TGF-ß on cdk2, cdk4, and cdk6 kinase activity. Adult rat lung alveolar type II cells were cultured with or without the addition of 10 ng/ml KGF and/or 1 ng/ml TGF-ß for 24 h from Day 1 to Day 2 of culture. Cells were lysed using ice-cold IP buffer containing freshly added protease and phosphatase inhibitors. Cdk2, cdk4, and cdk6 complexes were immunoprecipitated using anti-cdk2, anti-cdk4, and anti-cdk6 antibodies and protein G sepharose beads. The cdk2 kinase assay was performed on the IP complexes using {gamma} 32P-ATP and histone H1 as substrate. Labeled histone was resolved by electrophoresis on an acrylamide gel and measured by autoradiography. Cdk4 and cdk6 kinase activity was measured with truncated Rb as the substrate. The lanes are (1) rat serum, (2) rat serum + KGF, (3) rat serum + TGF-ß, and (4) rat serum + KGF and TGF-ß. (A) cdk2; (B) cdk4; and (C) cdk6. These results are representative of at least three independent experiments.

 
TGF-ß Inhibits Rb Phosphorylation, Increases p15Ink4b, and Decreases cdc25A Levels
As indicated by the labeling indices, there was some basal cell cycling in these primary cultures in rat serum alone, which appears to be suppressed by the addition of TGF-ß alone (Figure 1). TGF-ß decreased the slower migrating hyperphosphorylated form of Rb (compared with rat serum alone) (Figure 2A, comparison of lanes 2 and 4). TGF-ß increased p15Ink4b, a member of the INK4 family of inhibitory proteins. TGF-ß did not alter p27Kip1, p18Ink4c, p21Cip1, or p57Kip2 levels (Figure 2 and data not shown). TGF-ß markedly reduced cdk2 activity (Figure 3, lanes 1 and 3).

TGF-ß Inhibits Proliferation and Rb Phosphorylation Induced by KGF
As shown in Figure 1, TGF-ß blocked the proliferation induced by KGF. This effect is further defined in Figure 4A, which shows the dose response for the effect of TGF-ß at 6 d in separate experiments. The cell cycle protein measurements were evaluated at 24 and 48 h after the addition of TGF-ß. At 24 h, TGF-ß inhibited the KGF-induced increase in Rb phosphorylation, and the active form of cdk2 (Figures 2A and 2C, lanes 3 and 5). TGF-ß had no apparent effect on the stimulation of cyclin D1 or cdk4 by KGF. However, TGF-ß increased p15 in the presence of KGF. Moreover, TGF-ß markedly inhibited the increase in cdk2 activity stimulated by KGF (Figure 3, lanes 2 and 4). There was no change in p18, p21, p27, or p57 in the cultures treated with both KGF and TGF-ß (Figure 2 and data not shown).





View larger version (43K):
[in this window]
[in a new window]
 
Figure 4. Effects of TGF-ß on SP-A and SP-D in the apical media. Adult rat lung alveolar type II cells were cultured as stated in Figure 1. The apical media was collected for the last 48 h for SP-A or SP-D measurement by enzyme-linked immunosorbent assay, and the amount of cells in the cultures was quantitated by DNA. (A) DNA per well and the dose response of adding increasing amounts of TGF-ß (0–1.0 ng/ml). (B) SP-A (ng/µg DNA) and (C) SP-D (ng/µg DNA). Data are expressed as means ± SE for seven experiments. *Significantly different from the value for rat serum and KGF (P < 0.05).

 
The inhibition of KGF-induced proliferation by TGF-ß correlated with a dramatic decrease in cdk2 activity and Rb hyperphosphorylation and an increase in p15Ink4b. Although p15 is not known to bind to cdk2, it may inhibit its activity indirectly by binding to cdk4 or cdk6 and releasing other cip (cyclin dependent kinase inhibitory protein) or kip (kinase inhibitory protein) inhibitory kinase proteins, which can then bind to and inhibit cdk2. Increased inhibitory effects by inhibitory kinase proteins, such as p27, could occur without a change in total p27 protein in the whole-cell lysates. However, examination of p27 amounts coimmunoprecipitated with either cyclin E complexes (IP cyclin E) or cdk2 complexes (IP cdk2) showed no detectable increase in associated p27 with TGF-ß or decrease with KGF. However, these immunoblots were difficult to evaluate because of the presence of heavy and light chains in these immunoprecipitations. Attempts to complex the primary antibody to polystyrene beads or to run the gels unreduced did not resolve this problem (data not shown).

When KGF stimulates type II cell proliferation in these cultures, the cells differentiate and express and secrete SP-A and SP-D (23). One of the possible consequences of TGF-ß inhibition of KGF proliferation might be a failure to differentiate. As shown in Figure 4B, TGF-ß inhibited the secretion of SP-A but not of SP-D. These data are expressed per µg DNA because there is a change in cell number with the treatments. If the SP-D concentration is expressed per ml or per culture, TGF also reduces SP-D levels (data not shown). The inhibition of SP-A secretion into the media and DNA content was apparent on whichever day TGF-ß was added to the KGF-stimulated cultures. Addition of TGF-ß for the last 48 or 96 h inhibited proliferation and SP-A secretion from the time it was added (data not shown).

KGF increases cyclin D1 and cdc25A and TGF-ß increases p15 mRNA levels. To confirm the protein data and to define the responses to KGF and TGF-ß more completely, we also evaluated mRNA levels for selected cell cycle–related proteins by quantitative RT-PCR. We found that KGF increased cyclin D1, but TGF-ß by itself did not alter its mRNA level (Figure 5A). TGF-ß did, however, significantly increase the mRNA for p15 at both 6 and 24 h, whereas KGF decreased p15 mRNA level at 24 h (Figure 5B). KGF slightly decreased the mRNA level of p27 at both 6 and 24 h, whereas TGF-ß decreased p27 at 24 h (Figure 5C). KGF increased cdc25A mRNA level at 24 h, whereas TGF-ß had no effect (Figure 5D).






View larger version (72K):
[in this window]
[in a new window]
 
Figure 5. Changes in mRNA levels with KGF and TGF-ß. Type II cells were cultured as in Figure 3. mRNA was harvested at 6 or 24 h after the addition of KGF or TGF-ß and processed as described in MATERIALS AND METHODS. The results for quantitative RT-PCR were normalized to glyceraldehyde-3-phosphate dehydrogenase and expressed as a fold change in comparison to rat serum at the designated times. Results shown are for (A) cyclin D1, (B) p15, (C) p27, and (D) cdc25A. The results are presented as means ± SE for four experiments. *Significantly different from the appropriate rat serum control (P < 0.05).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TGF-ß strongly inhibited proliferation induced by KGF in primary cultures of rat alveolar type II cells. TGF-ß is expressed in pulmonary fibrosis and is regarded as an essential mediator of pulmonary fibrosis. The implication is that in states of chronic lung injury, TGF-ß could produce fibrosis not only by direct stimulation of extracellular matrix production by fibroblasts and the conversion of fibroblasts into myofibroblasts, but also by impairing epithelial proliferation and wound healing. For example, in usual interstitial pneumonia, the pathologic lesion that is thought to be most important is the fibroblastic focus, and this lesion is regarded as a site for myofibroblast accumulation and increased TGF-ß activity (11, 14). It is noteworthy that the alveolar epithelial covering of these fibroblastic foci is commonly incomplete and quite different from the Masson body of organizing pneumonia, which is covered by a more intact epithelial lining, and resolves or heals (29). Hence, in usual interstitial pneumonia, TGF-ß could impair epithelial proliferation and inhibit normal wound healing.

The mechanism whereby TGF-ß inhibits alveolar type II cell proliferation is complex and will require additional studies to define the multiple potential sites of action of TGF-ß on the cell cycle (see Figure 6 for a summary diagram) (12). We found a marked decrease in cdk2 activity but no marked change in cdk4 and cdk6 activity with TGF-ß at 24 h. Others have reported a decrease in cdk4 and cdk6 in other epithelial cell systems (12, 28). It is possible that these could be decreases at earlier time points. We found an increase in p15 protein level, which also has been reported by several other groups (18, 30, 31), and an increase in p15 mRNA levels. Nevertheless, p15 is not essential for the inhibition of cell proliferation by TGF-ß, as shown in p15-deficient cell lines, and p15 mostly inhibits cdk4 and cdk6, the activity of which was not changed significantly in our experiments. In addition, there was an increase in cyclin D1 with the combination of KGF and TGF-ß, which could provide additional binding capacity for p15 and p27. We could not rule out the possibility that the increase in p15 might displace some p27 from cdk4 and cdk6 complexes, and that the displaced p27 might bind to cdk2–cyclin E complexes and inhibit cdk2 kinase activity. Despite repeated attempts to demonstrate this hypothesis, we were not successful. We found no change in p27 protein level with the addition of TGF-ß. It is possible that cyclin activating kinase activity was also inhibited by TGF-ß, because the appearance of the higher mobility form of cdk2 was reduced.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 6. KGF and TGF-ß act at multiple points in the G1 phase of the cell cycle. This figure shows the multiple steps in the cell cycle in which KGF stimulates proliferation (increased cyclin D, cdc25A, cdk2, and Rb hyperphosphorylation) (A) and TGF-ß inhibits proliferation (increased p15 and reduced cdk2, and Rb hyperphosphorylation) (B). The changes are indicated by the black enclosures with white letters and the direction of the change with an arrow. In our studies, KGF consistently increased cyclin D mRNA and protein content,but without significant change in cdk4 activity at the time point examined. Therefore, only free cyclin D is shown to be increased, but it is likely that cyclin D complexed to cdk4 was also increased (this figure was modified from the one by Sherr and Roberts, Reference 35).

 
The mechanism of TGF-ß inhibition of epithelial proliferation is complex, manifold, and varies with cell type. In primary cultures of human prostate epithelial cells, TGF-ß inhibits proliferation induced by a mixture of growth factors by upregulating p15, p21, and p27 (18). In human mammary epithelial cells, TGF-ß inhibits cdk4 and cdk6 by both an increase in p15 and a repression of cdc25A, an activating phosphatase, which leads to increased tyrosine phosphorylation of cdk4 and cdk6 (28). In a rat kidney cell line, TGF-ß inhibits activation of cyclin E–cdk2 complexes by addition of p57 with no effect on cdk4 or cdk6 kinase activity, cdc25A, or p27 in the cyclin E–cdk2 complexes (16). In transformed human mammary epithelial cells stimulated by epidermal growth factor, TGF-ß decreases proliferation by a p15-dependent pathway, which both inhibits cyclin D–cdk4 complexes and also displaces p27 to inhibit cyclin E-cdk2 complexes (30). The inhibition of cyclin E-cdk2 complexes by p27 is thought to be especially important in tumor derived epithelial cells (17). Hence, our observations are consistent with other reports but will require additional studies to define all the interacting pathways. It appears likely that TGF-ß inhibits cell proliferation by affecting several components of the cell cycle regulatory units, even within a single cell type.

KGF stimulated cell proliferation and activated the cell cycle. The major effects were an increase in cyclin D1, a decrease in p27, an increase in cdc25A, an increase in cdk2 activity, and resultant Rb hyperphosphorylation. There was no change in p15. These results were all compatible with growth stimulation and progress through the cell cycle and are comparable to changes induced by other mitogens such as epidermal growth factor in epithelial cells (16). However, we did not find an increase in cdk4 or cdk6 kinase activity at the 24 h time point. The activity may have been increased earlier, or was at least sufficient for progression through the cell cycle.

In our studies, TGF-ß decreased differentiation as measured by the secretion of SP-A and SP-D. The inhibition of proliferation by TGF-ß also inhibited the development of a cuboidal monolayer, which is thought to be critical for surfactant gene expression (32). This failure of proliferation and the conversion of squamous epithelial cells into a cuboidal monolayer would likely prevent SP-A and SP-D expression. In cultured human fetal lung, Beers and colleagues reported that TGF-ß inhibited expression of SP-A, SP-B, and SP-C (33). TGF-ß has also been reported to inhibit SP-B expression in H441 cells, and this inhibition was thought to be due to inhibition of thyroid transcription factor 1 phosphorylation and nuclear translocation (34). Hence, the inhibition of SP-A and SP-D secretion in these cultures is consistent with other reports in other in vitro systems. In summary, KGF stimulates and TGF-ß antagonizes alveolar type II cell proliferation in vitro. As a consequence, TGF-ß also inhibits differentiation in this cell culture system.


    Acknowledgments
 
The authors are grateful to Shirley Pearce and Teneke M. Warren for help in preparing this manuscript. This work was supported by National Institutes of Health grants HL-67671 and HL-29891.


    Footnotes
 
Conflict of Interest Statement: F.Z. has no declared conflicts of interest; L.D.N. has no declared conflicts of interest; J.J.L. has no declared conflicts of interest; and R.J.M. has no declared conflicts of interest.

Received in original form June 4, 2004

Received in final form August 20, 2004


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Fehrenbach, H. 2001. Alveolar epithelial type II cell: defender of the alveolus revisited. Respir. Res. 2:33–46.[CrossRef][Medline]
  2. Ulich, T. R., E. S. Yi, K. Longmuir, S. Yin, R. Blitz, C. F. Morris, R. M. Housley, and G. F. Pierce. 1994. Keratinocyte growth factor is a growth factor for type II pneumocytes in vivo. J. Clin. Invest. 93:1298–1306.
  3. Yano, T., R. J. Mason, T. Pan, R. R. Deterding, L. D. Nielsen, and J. M. Shannon. 2000. KGF regulates pulmonary epithelial proliferation and surfactant protein gene expression in the adult rat lung. Am. J. Physiol. Lung Cell. Mol. Physiol. 279:L1146–L1158.[Abstract/Free Full Text]
  4. Panos, R. J., J. S. Rubin, S. A. Aaronson, and R. J. Mason. 1993. Keratinocyte growth factor and hepatocyte growth factor/scatter factor are heparin-binding growth factors for alveolar type II cells in fibroblast-conditioned medium. J. Clin. Invest. 92:969–977.
  5. Panos, R. J., P. Bak, W. S. Simonet, S. L. Aukerman, J. S. Rubin, and L. J. Smith. 1995. Keratinocyte growth factor (KGF) prevents hyperoxia-induced mortality in rats. Am. J. Respir. Crit. Care Med. 151:A181. (Abstr.)
  6. Yano, T., R. R. Deterding, W. S. Simonet, J. M. Shannon, and R. J. Mason. 1996. Keratinocyte growth factor reduces lung damage due to acid instillation in rats. Am. J. Respir. Cell Mol. Biol. 15:433–442.[Abstract]
  7. Deterding, R. R., A. M. Havill, T. Yano, S. C. Middleton, C. R. Jacoby, J. M. Shannon, W. S. Simonet, and R. J. Mason. 1997. Prevention of bleomycin-induced lung injury in rats by keratinocyte growth factor. Proc. Assoc. Am. Physicians 109:254–268.[Medline]
  8. Lu, Y., Z. Z. Pan, Y. Devaux, and P. Ray. 2003. p21-activated protein kinase 4 (PAK4) interacts with the keratinocyte growth factor receptor and participates in keratinocyte growth factor-mediated inhibition of oxidant-induced cell death. J. Biol. Chem. 278:10374–10380.[Abstract/Free Full Text]
  9. Portnoy, J., D. Curran-Everett, and R. J. Mason. 2004. KGF stimulates alveolar type II cell proliferation through the ERK and PI3 Kinase pathways. Am. J. Respir. Cell Mol. Biol.
  10. Khalil, N., R. N. O'Connor, H. W. Unruh, P. W. Warren, K. C. Flanders, A. Kemp, O. H. Bereznay, and A. H. Greenberg. 1991. Increased production and immunohistochemical localization of transforming growth factor-ß in idiopathic pulmonary fibrosis. Am. J. Respir. Cell Mol. Biol. 5:155–162.
  11. Broekelmann, T. J., A. H. Limper, T. V. Colby, and J. A. McDonald. 1991. Transforming growth factor beta 1 is present at sites of extracellular matrix gene expression in human pulmonary fibrosis. Proc. Natl. Acad. Sci. USA 88:6642–6646.[Abstract/Free Full Text]
  12. Herrera, R. E. 1998. The growth-inhibitory effects of TGF beta. Prog. Mol. Subcell. Biol. 20:11–24.[Medline]
  13. Khalil, N., R. N. O'Connor, K. C. Flanders, and H. Unruh. 1996. TGF-beta 1, but not TGF-beta 2 or TGF-beta 3, is differentially present in epithelial cells of advanced pulmonary fibrosis: an immunohistochemical study. Am. J. Respir. Cell Mol. Biol. 14:131–138.[Abstract]
  14. Corrin, B., D. Butcher, B. J. McAnulty, R. M. Dubois, C. M. Black, G. J. Laurent, and N. K. Harrison. 1994. Immunohistochemical localization of transforming growth factor-beta 1 in the lungs of patients with systemic sclerosis, cryptogenic fibrosing alveolitis and other lung disorders. Histopathology 24:145–150.[Medline]
  15. Nagahara, H., S. A. Ezhevsky, A. M. Vocero-Akbani, P. Kaldis, M. J. Solomon, and S. F. Dowdy. 1999. Transforming growth factor beta targeted inactivation of cyclin E:cyclin-dependent kinase 2 (cdk2) complexes by inhibition of cdk2 activating kinase activity. Proc. Natl. Acad. Sci. USA 96:14961–14966.[Abstract/Free Full Text]
  16. Liu, B., and P. Preisig. 1999. TGF-beta1–mediated hypertrophy involves inhibiting pRB phosphorylation by blocking activation of cyclin E kinase. Am. J. Physiol. 277:F186–F194.
  17. Donovan, J. C., J. M. Rothenstein, and J. M. Slingerland. 2002. Non-malignant and tumor-derived cells differ in their requirement for p27Kip1 in transforming growth factor-beta–mediated G1 arrest. J. Biol. Chem. 277:41686–41692.[Abstract/Free Full Text]
  18. Robson, C. N., V. Gnanapragasam, R. L. Byrne, A. T. Collins, and D. E. Neal. 1999. Transforming growth factor-beta1 up-regulates p15, p21 and p27 and blocks cell cycling in G1 in human prostate epithelium. J. Endocrinol. 160:257–266.[Abstract]
  19. Selman, M., T. E. King, and A. Pardo. 2001. Idiopathic pulmonary fibrosis: prevailing and evolving hypotheses about its pathogenesis and implications for therapy. Ann. Intern. Med. 134:136–151.[Abstract/Free Full Text]
  20. Selman, M., and A. Pardo. 2002. Idiopathic pulmonary fibrosis: an epithelial/fibroblastic cross-talk disorder. Respir. Res. 3:1–8.[CrossRef][Medline]
  21. Bhowmick, N. A., M. Ghiassi, M. Aakre, K. Brown, V. Singh, and H. L. Moses. 2003. TGF-beta–induced RhoA and p160ROCK activation is involved in the inhibition of cdc25A with resultant cell-cycle arrest. Proc. Natl. Acad. Sci. USA 100:15548–15553.[Abstract/Free Full Text]
  22. Mason, R. J., T. Pan, K. E. Edeen, L. D. Nielsen, F. Zhang, M. Longphre, M. R. Eckart, and S. Neben. 2003. Keratinocyte growth factor and the transcription factors C/EBPalpha, C/EBPdelta, and SREBP-1c regulate fatty acid synthesis in alveolar type II cells. J. Clin. Invest. 112:244–255.[CrossRef][Medline]
  23. Mason, R. J., M. C. Lewis, K. E. Edeen, K. McCormick-Shannon, L. D. Nielsen, and J. M. Shannon. 2002. Maintenance of surfactant protein A and D secretion by rat alveolar type II cells in vitro. Am. J. Physiol. Lung Cell. Mol. Physiol. 282:L249–L258.[Abstract/Free Full Text]
  24. Lucas, J. J., A. Szepesi, J. F. Modiano, J. Domenico, and E. W. Gelfand. 1995. Regulation of synthesis and activity of the PLSTIRE protein (cyclin-dependent kinase 6 (cdk6)), a major cyclin D-associated cdk4 homologue in normal human T lymphocytes. J. Immunol. 154:6275–6284.[Abstract]
  25. Lucas, J. J., A. Szepesi, J. Domenico, A. Tordai, N. Terada, and E. W. Gelfand. 1995. Differential regulation of the synthesis and activity of the major cyclin-dependent kinases, p34cdc2, p33cdk2, and p34cdk4, during cell cycle entry and progression in normal human T lymphocytes. J. Cell. Physiol. 165:406–416.[CrossRef][Medline]
  26. Leslie, C. C., K. McCormick-Shannon, and R. J. Mason. 1989. Bronchoalveolar lavage fluid from normal rats stimulates DNA synthesis in rat alveolar type II cells. Am. Rev. Respir. Dis. 139:360–366.[Medline]
  27. Gu, Y., J. Rosenblatt, and D. O. Morgan. 1992. Cell cycle regulation of CDK2 activity by phosphorylation of Thr160 and Tyr15. EMBO J. 11:3995–4005.[Medline]
  28. Iavarone, A., and J. Massague. 1997. Repression of the CDK activator Cdc25A and cell-cycle arrest by cytokine TGF-beta in cells lacking the CDK inhibitor p15. Nature 387:417–422.[CrossRef][Medline]
  29. Lappi-Blanco, E., R. Kaarteenaho-Wiik, S. Salo, R. Sormunen, M. Maatta, H. Autio-Harmainen, Y. Soini, and P. Paakko. 2004. Laminin-5 gamma2 chain in cryptogenic organizing pneumonia and idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 169:27–33.[Abstract/Free Full Text]
  30. Sandhu, C., J. Garbe, N. Bhattacharya, J. Daksis, C. H. Pan, P. Yaswen, J. Koh, J. M. Slingerland, and M. R. Stampfer. 1997. Transforming growth factor beta stabilizes p15INK4B protein, increases p15INK4B-cdk4 complexes, and inhibits cyclin D1-cdk4 association in human mammary epithelial cells. Mol. Cell. Biol. 17:2458–2467.[Abstract]
  31. Reynisdottir, I., K. Polyak, A. Iavarone, and J. Massague. 1995. Kip/Cip and Ink4 cdk inhibitors cooperate to induce cell cycle arrest in response to TGF-beta. Genes Dev. 9:1831–1845.[Abstract/Free Full Text]
  32. Shannon, J. M., T. Pan, K. E. Edeen, and L. D. Nielsen. 1998. Influence of the cytoskeleton on surfactant protein gene expression in cultured rat alveolar type II cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 18:L87–L96.
  33. Beers, M. F., K. O. Solarin, S. H. Guttentag, J. Rosenbloom, A. Kormilli, L. W. Gonzales, and P. L. Ballard. 1998. TGF-beta inhibits surfactant component expression and epithelial cell maturation in cultured human fetal lung. Am. J. Physiol. 275:L950–L960.
  34. Kumar, A. S., L. W. Gonzales, and P. L. Ballard. 2000. Transforming growth factor-beta1 regulation of surfactant protein B gene expression is mediated by protein kinase–dependent intracellular translocation of thyroid transcription factor-1 and hepatocyte nuclear factor 3. Biochim. Biophys. Acta 1492:45–55.[Medline]
  35. Sherr, C. J., and J. M. Roberts. 1995. Inhibitors of mammalian G1 cyclin–dependent kinases. Genes Dev. 9:1149–1163.[Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Respir. Cell Mol. Bio.Home page
R. Qiao, W. Yan, C. Clavijo, R. Mehrian-Shai, Q. Zhong, K.-J. Kim, D. Ann, E. D. Crandall, and Z. Borok
Effects of KGF on Alveolar Epithelial Cell Transdifferentiation Are Mediated by JNK Signaling
Am. J. Respir. Cell Mol. Biol., February 1, 2008; 38(2): 239 - 246.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Bhaskaran, N. Kolliputi, Y. Wang, D. Gou, N. R. Chintagari, and L. Liu
Trans-differentiation of Alveolar Epithelial Type II Cells to Type I Cells Involves Autocrine Signaling by Transforming Growth Factor beta1 through the Smad Pathway
J. Biol. Chem., February 9, 2007; 282(6): 3968 - 3976.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. A. Alejandre-Alcazar, G. Kwapiszewska, I. Reiss, O. V. Amarie, L. M. Marsh, J. Sevilla-Perez, M. Wygrecka, B. Eul, S. Kobrich, M. Hesse, et al.
Hyperoxia modulates TGF-beta/BMP signaling in a mouse model of bronchopulmonary dysplasia
Am J Physiol Lung Cell Mol Physiol, February 1, 2007; 292(2): L537 - L549.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
Y. Chang, J. Wang, X. Lu, D. P. Thewke, and R. J. Mason
KGF induces lipogenic genes through a PI3K and JNK/SREBP-1 pathway in H292 cells
J. Lipid Res., December 1, 2005; 46(12): 2624 - 2635.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-0182OCv1
31/6/679    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, F.
Right arrow Articles by Mason, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, F.
Right arrow Articles by Mason, R. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2004 American Thoracic Society.