help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published ahead of print on September 10, 2004, doi:10.1165/rcmb.2003-0422OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-0422OCv1
32/1/35    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, M.-C. W.
Right arrow Articles by Yang, Y.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, M.-C. W.
Right arrow Articles by Yang, Y.-S.
American Journal of Respiratory Cell and Molecular Biology. Vol. 32, pp. 35-43, 2005
© 2005 American Thoracic Society
DOI: 10.1165/rcmb.2003-0422OC

Pleiomorphic Adenoma Gene–Like–2, a Zinc Finger Protein, Transactivates the Surfactant Protein–C Promoter

Meng-Chun W. Yang, Jonathan C. Weissler, Lance S. Terada, Feitao Deng and Yih-Sheng Yang

Department of Internal Medicine, Pulmonary and Critical Care Medicine, The University of Texas Southwestern Medical Center at Dallas; and Dallas Veterans Affairs Medical Center, Dallas, Texas

Correspondence and requests for reprints should be addressed to Yih-Sheng Yang, Ph.D., Department of Internal Medicine, Pulmonary and Critical Care Medicine, UT Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390-9034. E-mail: Yih-Sheng.Yang{at}UTSouthwestern.edu


    Abstract
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Expression of surfactant protein (SP)-C occurs principally in type II pneumocytes located in the distal lung alveolae. SP-C expression is thought to be primarily regulated by thyroid transcription factor (TTF)-1 and its associated proteins interacting with a previously defined promoter region between –197 and –158 in mice. We screened a human lung cDNA library using a modified yeast one-hybrid system and identified pleiomorphic adenoma gene–like (PLAGL)–2, a ubiquitously expressed zinc finger protein, as a transfactor of the SP-C promoter. The PLAGL2 DNA-binding site was located in the SP-C promoter proximal region close to the TTF-1 sites. This site was demonstrated to be functional by use of electrophoresis mobility shift assay, mutagenesis analysis, and transfection studies. PLAGL2 bound to DNA via its N-terminus zinc fingers and activated the SP-C promoter in a TTF-1–independent manner. Both human and mouse SP-C promoters, but not the SP-B promoter, could be activated by PLAGL2 in transfected human embryonic kidney–293 (HEK293) cells as well as in murine type II (MLE12) cells. The expression of PLAGL2 in isolated human embryonic lung type II cells and its transactivation activity on the SP-C promoter suggest that PLAGL2 may modulate SP-C expression during lung development.

Key Words: gene expression • PLAGL2 • SP-C • TTF-1 • zinc finger protein


    Introduction
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Pulmonary surfactant containing phospholipids and specific surfactant proteins (SPs) is present in the alveolar space. The hydrophobic SP-B and SP-C reduce alveolar surface tension by enhancing the adsorption and spreading of surfactant phospholipid onto the air–liquid interface. They are essential for respiratory function and pulmonary homeostasis. Deficiencies in these proteins caused by premature birth, lung injury, or gene mutations can result in respiratory failure or chronic lung disease. Reports have shown that patients with some lung diseases harbor various mutations in either SP-B or SP-C genes (1, 2). Aside from the mutated polypeptides, aberrant expression of SPs by alteration of their promoter activities via unidentified proteins or modifiers may also lead to lung abnormalities (2).

Over- or underexpression of SP-C is associated with lung diseases (2). Both SP-B and SP-C pro-proteins are transported through a secretory pathway via the endoplasmic reticulum, Golgi, and plasma membrane for secretion. Overexpression of SP-C can cause pro–SP-C aggregation in the secretory pathway and lead to type II cell injury in mice (3). In humans, mutations of the SP-C gene are found associated with sporadic and familial interstitial lung disease or with idiopathic pulmonary fibrosis (46). Mutations in the SP-C coding region caused by the alternation of splice-site (4), mis-sense, and frame-shift translation (5), or transversion/point mutations (6), may produce misfolded polypeptides and subsequently block the functionally coupled processing, folding, and routing pathways inside the type II cells. Therefore, overexpression and accumulation of SP-C polypeptides inside the cells can eventually lead to cell cytotoxicity and injury (7, 8).

Transgenic mice overexpressing SP-C peptide in type II cells die shortly after birth (3). The phenomenon coincided well with the theory that aggregated SP-C polypeptide in the secretory pathway of type II cells could block and damage normal cellular functions. Under a converse condition under which SP-C expression is eliminated in vivo, some mouse strains developed emphysema (9). The results from these animal studies suggest that aberrant expression of SP-C in vivo could lead to various chronic pulmonary diseases. The finding of correlations between SP-C expression and various lung diseases (36, 9) prompted us to search for factors that could specifically modulate SP-C promoter activity but not affect expression of other SPs.

SP-B and SP-C are expressed in alveolar type II cells with additional expression of SP-B in Clara cells. Their cell type–specific expression is thought to be mediated through thyroid transcription factor (TTF)-1, a homeodomain transcription factor expressed in thyroid, lung, and pituitary gland (10). In the lung, TTF-1 binds to consensus elements CAAG, located at the promoter regions of many lung cell type–specific genes (1114). Given the fact that TTF-1 is expressed in multiple tissues and is also required for the expression of many lung-specific genes, TTF-1 alone cannot fully account for the differential expression of SP-B and SP-C in the alveolar epithelial cells. A network of regulatory molecules involving TTF-1 and its associated protein complexes may be necessary for the specific expression of each individual gene in vivo (15).

The SP-B and SP-C gene promoters have been well characterized. Both promoters have a unique proximal region to confer the cell type–specific expression in lung: –118 to –64 of human SP-B (12), –197 to –158 of mouse SP-C (13), and within the –215 region of human SP-C promoters (16). Previously, by integrating the SP-B promoter proximal region into a yeast one-hybrid system to screen a human lung cDNA library in yeast, 26 kD TTF-1–associated protein (TAP26) was identified as a TTF-1–associated factor to synergistically transactivate the SP-B promoter in the transfected human embryonic kidney (HEK)–293 cells (1719). Aside from TAP26, GATA-6 and transcriptional co-activator with PDZ-binding motif (TAZ) are the other two TTF-1–associated proteins that can synergistically activate the SP-C promoter (20, 21). In addition, TAP26 appears to stimulate TTF-1–dependent activity of the SP-C promoter as well (unpublished data).

Pleiomorphic adenoma gene–like (PLAGL) 2 is a member of the zinc finger–containing PLAG gene family, the function of which remains poorly defined (22). All three PLAG proteins (PLAG1, PLAGL1, and PLAGL2) are highly homologous, especially in their N-terminal zinc finger DNA–binding domain. PLAGL2 can bind to the consensus of PLAG1 binding site, a core (GRGGC, R:A or G) and a cluster sequence (RGGK, K: A, G or T) separated by seven random nucleotides (23, 24). This consensus sequence is different from that of PLAGL1 DNA–binding site (ACGGGGGGCCCCTTTA) (25). In this study, when the proximal promoter region of SP-C was used to screen for interacting factors, PLAGL2 was recovered as a putative transfactor of the promoter. We demonstrate that PLAGL2 can preferentially transactivate the SP-C promoter through direct binding to a PLAGL2 consensus element within the proximal region of the SP-C promoter. Unlike GATA-6, TAZ, and TAP26, PLAGL2 is unique in that it transactivates the SP-C promoter independent of TTF-1.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Yeast Analyses
Plasmid pHISi-SPCP, a reporter plasmid of yeast one-hybrid system, was constructed to have the yeast HIS3 gene expression controlled by a mouse SP-C promoter fragment (–197 to –158). This plasmid was linearized at Xho1 site and integrated into the his3 locus of the Y187 yeast strain, which harbored a Gal4-responsive LacZ reporter, via homologous recombination. The resulting yeast strain was then cotransformed with GBT-TTF1HD (GBT–TTF-1 homeodomain) and a human lung cDNA library fused with a GAL4 activation domain (BD Bioscience Clontech, Palo Alto, CA). Yeast transformants were plated on the selection medium without leucine, tryptophan, and histidine (SD/–LWH). To reduce the nonspecific background, 45 mM 3-aminotriazole was added to medium during the selection. For a more stringent library selection, a ß-galactosidase filter-lifted (blue color) assay was further performed to eliminate those nonresponsive clones. The DNA-binding activity of identified candidates was confirmed in vivo by using yeast one-hybrid analysis as described by the manufacturer. DNA of the potential yeast candidate clones was prepared and transformed into XL1-blue–competent cells by electroporation to recover the carried plasmids. Plasmid DNAs were further amplified and purified from bacteria for sequence analysis.

Plasmid Construction
The primers used to construct plasmid GBT-TTF1HD by using the exonuclease recession method (26) are: GBT-TTF161–5' CCCGGGGATCCGCAGGAAGCGCCGGGTG (vector sequence is underlined; from TTF-1 amino acid 161) and GBT-TTF220–3' TCGACGGATCAGGCCTGGCGCTTCATTTTGTA (from TTF-1 amino acid 220).

Plasmid pHISi-SPCP was constructed by blunt-end ligation of oligonucleotide containing the SP-C promoter sequence (mouse –197 to –158) into the Sma I site of pHISi vector (BD Bioscience Clontech). Plasmids pHISi-SPBP and pGL3-SPBP are prepared as described previously (17). Plasmids, pGL3-hSPCP and pGL3-mSPCP, were constructed by inserting a 320 bp (–320 to +1) of human and mouse SP-C promoter fragment into Bgl II/Hind III-digested pGL3 vector (Promega, Madison, WI), respectively. These SP-C promoter fragments were generated by polymerase chain reaction (PCR) amplification using human or mouse genomic DNA as templates. The primers used for these reactions were: 5'SPCP(-320)(Nhe1/Bgl II) GCTAGCAGATCTGGGGCAGGTGCCAGC AAG; 3'SPCP(+1) (Xho I/Hind III) ATCTAGAAGCTTCTCTCCTCTCCTC(A/C)TC. All of the constructed reporter gene promoter sequences were confirmed by DNA sequence analysis.

Site-Directed Mutagenesis
QuikChange site-directed mutagenesis (Stratagene, La Jolla, CA) was employed with modifications to generate various promoter and gene mutants. For mutated SP-C promoter construction, the human SP-C promoter plasmid, pGL3-hSPCP, was used as the DNA template to generate mCore and mComCl, which contained altered PLAGL2 DNA–binding site at the core (mCore), or core and cluster sequences (mComCl). Similarly, mT4, mT5, and mT4mT5 are mutated promoters with TTF-1 binding sites T4, T5, or both being eliminated. Flag-PLAGL2 plasmid DNA was used for PLAGL2 mutant construction by changing the first histidine (CAC [H145], CAC [H209] and CAC [H233]) of zinc finger 4, 6, or 7 (mF4, mF6, or mF7) to alanine (GCC). PLAGL2 truncation or deletion mutants pCIN-PLAGL2-N249, -N189, and -carboxyl-terminus domains (CTD) were generated by subcloning PCR-amplified fragments from PLAGL2 amino acid 105–249, 105–189, and 250–496 into the EcoRI site of the pCIN-Flag vector by using the exonuclease recession method (26). All of the mutations were confirmed by DNA sequence analysis.

Transient Transfection and Luciferase Reporter Gene Assay
This assay was conducted as described previously (17). Briefly, HEK293 cells (human embryonic kidney cells, CRL-1573; American Type Culture Collection, Manassas, VA) or MLE12 cells (murine type II cells, CRL-2110; ATCC) at 70–80% confluences were harvested, seeded overnight on 24-well plates (2 x 104/well) before being transfected with DNA. Cells were cotransfected with reporters and expression plasmids by using FuGENE 6 transfection reagent (Roche, Indianapolis, IN). Reporter gene plasmids, pGL3-hSPBP(–118/+41) and (–500/+41) were two fly luciferase reporter genes controlled by a human SP-B promoter from –118 to +41, or –500 to +41 fragment; and the human or mouse SP-C promoter fragment from –320 to +1 was constructed into the same vector as pGL3-hSPCP and pGL3-mSPCP, respectively. The transfection mixtures contained up to 100 ng of fly luciferase reporter gene, 10 ng of pRL-TK, and various amounts of expression protein genes. Total amounts of DNA in each well were equalized by adding pCIN-Flag plasmid DNA. The compound mixtures of FuGENE 6 and DNA were prepared as described in the manufacturer's instructions. Transfection was carried out for 48 h with the DNA mixture before harvesting for luciferase analysis. Cells were examined under microscope before harvest to ensure that cell density and morphology were the same in each well. Cells were then lysed by 100 µl Glo lysis buffer (Promega) after removing medium from the wells. An aliquot of 25 µl cell lysates from each sample well was transferred to a 96-well plate, mixed with equal amounts of Bright Glo luciferase reagent (Promega), and luciferase activity measured by Microplate Luminometer (Tunner Design, Sunnyvalle, CA). The average fly luciferase activity was compared with the cotransfected empty vector alone control to calculate the fold transcriptional activity changes. Cotransfected Renilla luciferase was used to monitor transfection efficiency variations among transfected wells. The actual average changes in fly luciferase activity were statistically analyzed to minimize the reporter activity variations. Each data point presented in the transfection studies, unless specified, was collected from at least three individual experiments with triplicates (n = 9 or > 9). The statistical data were then summarized and plotted.

Electrophoresis Mobility Shift Assay
Annealed oligo duplexes with sequence extracted from the proximal region of SP-C promoter, as listed in Figure 1, was used as a probe for protein–DNA interaction analysis. DNA duplex was labeled with {gamma}-32p-ATP and T4 polynucleotide kinase. A total of 100,000 cpm probe was incubated with 5 µl of in vitro–translated reticulocyte lysates for 30 min at room temperature before fractionation on 4% native polyacrylamide gel. In vitro–translated lysates were programmed by adding 1 µg of plasmid DNA containing the expressed gene into reactions, per the manufacturer's manual. Those RNAs synthesized in the reticulocyte lysates for protein synthesis were all transcribed by T7 RNA polymerase. Annealed oligo duplexes (25 or 50 ng) containing the wild-type, TTF-1, or PLAGL2 binding site mutants were added to reaction cocktails at the same time in the competition analysis. The binding cocktail contained 40 mM HEPES (pH 7.5), 100 mM KCl, 1 mM EDTA, and 10% glycerol. Additional nonspecific competitors including 250 ng poly (dI-dC) and 100 ng double-stranded calf thymus DNA were added to samples to reduce nonspecific background.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 1. (A) Sequence alignment of human SP-C, mouse SP-C, and human SP-B promoters. Predicted PLAGL2 DNA–binding consensus sequence is underlined. TTF-1 (T) and HNF-3 (H) binding sites in the promoters are in bold. T4 and T5 are the TTF-1 binding sites in the SP-C promoters (13); 5T and 3T are the TTF-1 interaction sites in the SP-B promoter (12); and the Smad binding–related sequence (dash line) (38) is also indicated. (B) The binding of PLAGL2 to the SP-C promoter has sequence-specificity. Reticulocyte lysates programmed with PLAGL2 or its mutants (mF6 and mF7) were tested in the EMSA analysis to examine their DNA-binding capability and sequence specificity. A 5-µl aliquot of PLAGL2-, mF6-, mF7-, or TAP26-programmed lysates was used to examine their binding capability (lanes 2–5). Oligo duplexes with TTF-1 (mT4mT5) or PLAGL2 (mComCl) binding sites mutated were used as sequence-specific competitor to block protein–DNA interactions. A total of 25 ng (125x, lanes 6, 8, and 10) or 50 ng (250x, lanes 7, 9, and 11) mT4mT5 (lanes 6 and 7), mComCl (lanes 8 and 9), and cold probe alone (lanes 10 and 11) duplexes were added into reactions as competitor. The sequences of mT4mT5 and mComCl are as depicted. Closed arrow, specific PLAGL2 binding band; open arrows, nonspecific bands; free probe is as labeled.

 
Western Blot Analysis
Cellular proteins obtained from an equal volume of cell lysates (800 ng of expressing plasmid DNA) used in the luciferase assay were fractionated on a 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis gel and then transferred to a polyvinylidene difluoride membrane for Western blot analysis. The membrane was probed with anti-Flag antibody (M2, 1:1,000) (Sigma, St. Louis, MO) followed by rabbit anti-mouse antibody conjugated with horseradish peroxidase (1:3,000) for transfected protein detection. The bound antibody probe was detected and developed with Supersignal West Pico Chemiluminescent substrate (Pierce, Rockford, IL).

Reverse Transcriptase–PCR Analysis
Total RNA isolated from the human fetal lung type II cells at midgestation stage (gift from Dr. Mendelson, The University of Texas Southwestern Medical Center [UTSWMC]), from human lungs of 6-wk-old embryo (Genotech, St. Louis, MO), and from MLE12 cells were subjected to produce cDNA by using the SMART (Switching Mechanism At 5' end of RNA Template) protocol, per manufacturer's description (BD Biosciences Clontech). Human multiple-tissue cDNAs were purchased from Clontech (BD Biosciences Clontech). All of the primers used in the PCR analysis are designed to amplify across exon and intron junctions to distinguish the amplification of cDNA from genomic DNA. To prevent the variations of PCR amplification efficiency, all amplicons were designed to have ~ 150 bp in length. Aliquots of amplified samples were collected every 3 cycles from each sample at the indicated cycles of amplification and subsequently analyzed on 1.5–2% agarose gel. For quantitative measurement of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), SP-C, SP-B, TTF-1, TAP26, and PLAGL2 transcripts real-time PCR analysis was employed by incorporating Syber-green in the amplification reaction and cycled on iCycler (Bio-Rad, Hercules, CA). The melting curve, correlation coefficiency, and amplification efficiency of all the samples analyzed were individually examined to verify that the amplification did truly indicate the expressed messages in those samples. Primers used for the real-time and reverse transcriptase (RT)–PCR analyses are listed in Table 1.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Primer sequences for polymerase chain reaction amplification

 

    RESULTS
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
PLAGL2 Binds to the Sequence in the Proximal Region of SP-C Promoter
A 40-bp fragment (–197 to –158) located at the proximal region of mouse SP-C promoter has been identified that contains essential cis-elements for SP-C expression in the lung type II cells (13). The DNA sequence within this region is very similar in human and mouse SP-C promoters (Figure 1A). Using the mouse sequence of this region as bait in a modified yeast one- and two-hybrid system, a human lung cDNA library was screened in the presence of TTF-1 homeodomain (pGBT-TTF1HD) to search for protein–DNA as well as protein–protein interacting complexes. A total of 32 out of 5 x 106 colonies screened grew on the selection medium lacking histidine, indicating that polypeptides encoded from those clones were able to bind to the specific SP-C promoter fragment. Three of these clones, which were also positive in lacZ gene expression (indicating the activation of an additional reporter gene [data not shown]), were further isolated and their plasmids were recovered and passaged through Escherichia coli. DNA sequence analysis of all three clones revealed library inserts from PLAGL2. The consensus sequence of a PLAGL2 binding site was then identified on the SP-C promoter proximal region where multiple TTF-1 binding sites exist (Figure 1A). To determine if this SP-C promoter region could be a target for PLAGL2 binding, yeast one-hybrid analysis was performed. The result indicates that PLAGL2 interacts with the DNA sequence obtained from the SP-C promoter but not with that from the SP-B promoter (–118 to –64) from the same region (data not shown).

To further demonstrate that PLAGL2 could directly interact with the SP-C promoter fragment, electrophoresis mobility shift assay (EMSA) analysis was performed. As shown in Figure 1B, in vitro–translated PLAGL2 formed a retarded complex with DNA probe containing the expected PLAGL2 binding site (lane 2). The interaction was unique for PLAGL2, as lysates programmed with TAP26 did not show the same protein–DNA complex (lane 5). In addition, zinc fingers 6 and 7 were necessary for binding, because mutated PLAGL2, with either the 6 or 7 finger eliminated, did not bind to the probe (lanes 3 and 4). Oligo duplexes with mutated PLAGL2 binding site (mComCl) did not compete off the interaction (lanes 8 and 9), whereas oligos with intact PLAGL2 binding site—wild type (lanes 10 and 11) or TTF-1 sites mutated (mT4mT5, lanes 6 and 7)—competed off the interactions in vitro. Thus, PLAGL2 appears to interact with the SP-C promoter at the core and cluster region in a manner dependent upon zinc fingers 6 and 7.

PLAGL2 Message Is Actively Expressed in Isolated Fetal Lung Type II Pneumocytes
PLAGL2 is expressed in most tissues of adult mice, particularly in spleen, lung, and testis (27). Our RT-PCR analysis also demonstrates that higher PLAGL2 expression is observed in human lung tissues than in other human tissues (Figure 2A).



View larger version (68K):
[in this window]
[in a new window]
 
Figure 2. PLAGL2 is expressed in all tissues. (A) Equal amounts of multiple tissue cDNAs (BD Bioscience Clontech) were used as templates to examine the expression of PLAGL2 in various human tissues by PCR amplification analysis. Aliquots of PCR sample were collected at the amplification cycles indicated on top. (B) Total RNA from type II cells isolated from fetal lung explants (D0) as well as Bt2cAMP-treated type II cells (D5) were used to generate cDNA by the SMART protocol. One nanogram of each cDNA was applied for PCR analysis using specific primer sets for PLAGL2, TTF-1, TAP26, SP-B, SP-C, and G3PDH messages. Aliquots from various amplification cycles were collected and analyzed in agarose gel.

 
PLAGL2 is mainly regulated during embryogenesis (22). By real-time PCR analysis, PLAGL2 expression occurs in the lung as early as the 6-wk-old embryo (6W). It is also expressed in the isolated human fetal lung type II cells (D0) (28). Within these cells, the steady-state level of PLAGL2 transcripts is higher than TTF-1 (Table 2). As shown in Table 2, the threshold cycle differences between the gene of interest and GAPDH, the housekeeping gene, which indicates expression differences between the gene of interest and the housekeeping gene GAPDH (estimated 1,200 copies/cell) (29), suggests a low expression of TTF-1 within these cells. Interestingly, SP-C transcripts are relatively abundant in spite of low TTF-1 expression, consistent with PLAGL2-dependent expression. Data from our conventional RT-PCR analysis are also concordant with the results obtained from the real-time PCR study (Figure 2B). By real-time PCR analysis, the pattern of SP-B and SP-C expression in D0 cells resembles that observed in freshly isolated adult and young rat type II cells (30). Unlike these cells, more TTF-1 than PLAGL2 is present in MLE12 cells, and the steady-state level of SP-B message is relatively increased in parallel to TTF-1.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Real-time polymerase chain reaction analyses of surfactant protein–c, surfactant protein–b, thyroid transcription FACTOR–1, and pleiomorphic adenoma gene–LIKE–2 mRNA expression in the fetal lung and MLE12 cells

 
PLAGL2 Transactivates both Human and Mouse SP-C Promoters
The presence of PLAGL2 in type II cells and its binding to the SP-C promoter prompted the hypothesis that PLAGL2 could be a direct transactivator of the SP-C promoter. To explore this possibility, we tested the transactivation activity of PLAGL2 on the human SP-C promoter. Expression plasmids containing either PLAGL2 or TTF-1 were cotransfected with pGL3-hSPCP or pGL3-hSPBP into HEK293 cells. Because HEK293 cells do not express TTF-1 or other potential lung cell–specific factors that may contribute to the activation of those SP promoters, they are a suitable host to study independent effects of transcription factors. As shown in Figure 3A, the SP-C promoter is activated by PLAGL2 or TTF-1 independently, and the activation is more efficiently upregulated by PLAGL2 than TTF-1, and is PLAGL2 concentration–dependent (Figure 3B). Both human and murine SP-C promoters can be activated by PLAGL2 in transfected HEK293 cells. The activation of the SP-C promoter by PLAGL2 is significantly greater than the activation of the SP-B promoter (P < 0.001). Thus, there is a robust and selective activation of the SP-C promoter by PLAGL2.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 3. (A) PLAGL2 transactivates the SP-C promoter in transfected HEK293 cells. Cultured HEK293 cells (2 x 104 in 24-well culture plates) were cotransfected with DNA containing 200 ng Flag-PLAGL2 or Flag–TTF-1, 50 ng pGL3-hSPBP (black bars) (–500/+41) or 100 ng pGL3-hSPCP (white bars) (–320/+1) promoter-driven luciferase reporter gene, and 10 ng pRL-TK to monitor the transfection. Luciferase activities were measured 48 h after the initial transfection, and data were plotted as fold increases over the control that contains the reporter gene and empty expression vector. All data points represent three individual experiments with duplicates (n = 6). (B) The activation of SP-C promoter by PLAGL2 is dependent on the Flag-PLAGL2 concentration. Various amounts of Flag-PLAGL2 plasmid DNA were cotransfected with pGL3-hSPBP (diamonds), -hSPCP (squares), or -mSPCP (triangles) into HEK293 cells. Plasmid of vector alone (pCIN-Flag) was added to complement the DNA concentration variations. Three individual experiments with duplicates were performed for each reporter activity data collection. The P value of the t test (n = 6) between the hSP-C and hSP-B promoters was calculated at the concentration of 800 ng of PLAGL2.

 
The PLAGL2 Binding Site on the SP-C Promoter Is Required for PLAGL2-Dependent Activity
To demonstrate that the identified binding site on the SP-C promoter is functional, mutated promoters, with the PLAGL2 binding site altered, were created. When the core site sequence was mutated by the GC->AT change, the PLAGL2-dependent transactivation was reduced to 50% of that of the wild type (Figure 4A). Double mutations with both core and cluster sequences altered (mComCl) resulted in a more than 75% reduction in activity. Thus, this data strongly suggests that the identified PLAGL2 binding sequence is functional for the activation of SP-C promoter. The cluster sequence contributes less than 25% of the intact promoter activity. The mutated promoter (mComCl) does not lose its TTF-1–dependent activity in transfected H441 cells (data not shown). In addition, neither T4 nor T5 of the TTF-1 binding site (mT4 or mT5) are required for PLAGL2-dependent activation (Figure 4B). All TTF-1 binding site–mutated promoters—mT4, mT5, and mT4mT5 (double mutations)—retain a similar PLAGL2 dependent activity as the wild-type promoter (Figure 4B and data not shown).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 4. (A) PLAGL2 transactivates the SP-C promoter. HEK293 cells were cotransfected with various amounts of PLAGL2 expression plasmid as well as 100 ng of reporter gene driven by a human SP-C promoter–bearing wild type (diamonds), mutated core (mCore) (squares), or mutated core and cluster (mComCl) (circles) of DNA-binding sequence of PLAGL2. Cells were harvested for luciferase activity analysis 48 h after transfection, as described in the previous figure legends. The differences between wild-type and mCore promoter activities were significant (P < 0.01 with 800 ng of PLAGL2; n = 9). (B) The binding sites of TTF-1 at close vicinity to the expected PLAGL2 binding site are not required for PLAGL2 and the SP-C promoter interactions. T4 or T5 binding site–mutated SP-C promoter (mT4, mT5; 100 ng) was cotransfected with PLAGL2 into HEK293 cells and the reporter activity was measured as described previously. The differences of promoter activity between the wild-type and mutant promoters were statistically analyzed, and both P values > 0.05. At least three individual experiments were performed for each data point collected (n = 11). Triangles, hSP-C (mT5); diamonds, hSP-C; squares, hSP-C (mT4).

 
Transactivation Activity of PLAGL2 Requires both Zinc Finger and CTD
As shown in Figure 5, PLAGL2 can also transactivate the SP-C promoter in MLE12 cells. However, neither the zinc finger (pCIN-PLAGL2-N249, N189) nor the CTD (pCIN-PLAGL2-CTD) domains alone transactivate the promoter. The zinc finger domain (N249) alone functions as a dominant suppressor to repress PLAGL2-dependent SP-C promoter activity (Figure 6A). These data suggest the presence of a transactivation domain within the C-terminus of PLAGL2.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 5. Both DNA-binding and activation domains of PLAGL2 are required for the activation of SP-C promoter. Various amounts of plasmids containing the wild-type PLAGL2, PLAGL2-N189 (third to fifth finger), PLAGL2-N249 (third to seventh finger), and PLAGL2-CTD (C-terminus domain) were cotransfected with 100 ng pGL3-hSPCP into MLE12 cells to determine their ability to transactivate the SP-C promoter. The mean of reporter activities was analyzed and plotted. Data were collected from samples representing three experiments with triplicates (n = 9). Diamonds, FLAG-PLAGL2; squares, PLAGL2-N249; triangles, PLAGL2-N189; circles, PLAGL2-CTD.

 


View larger version (20K):
[in this window]
[in a new window]
 
Figure 6. The contact between PLAGL2 and the promoter is required for transcriptional activity. (A) The N-terminus domain of PLAGL2 containing the DNA-binding zinc fingers (PLAGL2-N249) can occupy the PLAGL2 binding site on the promoter and suppress PLAGL2 transactivation activity on the SP-C promoter. Various amounts of PLAGL2 N-terminus domain (N249) (black bars) or C-terminus domain (CTD) (white bars) plasmids were cotransfected with pGL3-hSPCP (100 ng) and Flag-PLAGL2 (200 ng) into HEK293 cells in 24-well plates. Cells were harvested 48 h after transfection for luciferase analysis. Data were collected from four experiments for statistical analysis (n = 12). The difference between PLAGL2-N249 at 800 ng of DNA concentration versus the control without PLAGL2-N249 was significant (P < 0.01). (B) Both zinc fingers 6 and 7 of PLAGL2 are required for the activation of SP-C promoter. Plasmids containing the wild type (diamonds), mF6 (squares), and mF7 (triangles) of PLAGL2, as described in MATERIALS AND METHODS, were cotransfected with pGL3-hSPCP into HEK293 cells. The reporter activity was measured, statistically analyzed, and plotted (P < 0.001 with 800 ng of PLAGL2; n = 6). The overexpressed proteins harvested from the HEK293 cell lysates transfected with Flag-PLAGL2, mF6, mF7, or Flag-alone plasmids (800 ng) for the luciferase analysis were monitored by Western blot analysis using anti-Flag monoclonal antibody. The expressed protein level is shown in the right panel.

 
Fingers 6 and 7 of PLAG1 are known to be responsible for its DNA binding activity (23). To map the DNA binding domain of PLAGL2, several mutants of PLAGL2 with altered fingers 4, 6, or 7 were generated for analysis. Point mutations on zinc finger 6 (mF6, H209A) or 7 (mF7, H233A) of PLAGL2 completely aborted the activities on the SP-C promoter (Figure 6B), whereas a mutation of finger 4 (mF4, H145A) (data not shown) had no impact on transactivation activity. This result further mapped PLAGL2 DNA–binding activity to fingers 6 and 7. To confirm that lost activity was not due to low protein expression, equal amounts of cell lysates used in the luciferase assays were examined for mF6, mF7, and wild-type PLAGL2 expression. Western blot analysis showed that all exogenous proteins were equally expressed in transfected cells (Figure 6B, right panel). Thus, the binding of PLAGL2 via fingers 6 and 7 to its binding site on the SP-C promoter is necessary for PLAGL2-dependent activation of the SP-C promoter.

SP-C Promoter without TTF-1 Sites in the Proximal Region Remains Active in MLE12 Cells
EMSA and in vitro transfection studies show that PLAGL2 can bind to and transactivate the SP-C promoter (Figure 4). When a promoter with T4 and T5 sites eliminated from the proximal region of the SP-C promoter was tested in MLE12 cells, the promoter was as active as the wild-type promoter (Figure 7). This result implies that other factors aside from T4 and T5 complexes can also interact and activate the promoter in MLE12 cells. Although it is possible that other upstream TTF-1 sites (e.g., T2 and T3) can contribute to the activity in the absence of T4 and T5 complexes, a more likely interpretation is the presence of a PLAGL2 complex acting on the promoter and then, consequently, initiating transcriptional activity.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 7. Mutated SP-C promoter without the proximal region TTF-1 sites (mT4mT5) remained active in MLE12 cells. Reporter DNA containing the SP-C promoter, with both TTF-1 sites in the proximal region deleted (mT4mT5), was transfected into MLE12 cells to determine the mutated promoter activity. Transfected cells were harvested and luciferase activity was measured, analyzed, and plotted as described previously. The t test P value of the wild-type (diamonds) and the mT4mT5 (squares) promoters is P > 0.05 (n = 16).

 

    DISCUSSION
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Though TTF-1 is indispensable for both SP-B and SP-C expression in the lung type II cells, their cell type–specific expression is not solely due to the presence of TTF-1 in vivo. For example, in Clara cells and its derived cell line, H441, SP-B is expressed, but not SP-C, in spite of the presence of TTF-1. During lung development, SP-C expression occurs when the primordial lung appears at the early developmental, pseudoglandular stage, whereas SP-A and SP-B expression occurs later at the canalicular stage. Furthermore, in recent transgenic mouse studies, the exogenous SP-C promoter could be activated at an earlier time during embryogenesis than the endogenous SP-C promoter (31). Therefore, these observations suggest that factors other than TTF-1 may be involved in differential regulation of SP-C expression in vivo. Other factors have been identified to mediate SP-C promoter activity through directly binding to the cis elements of the promoter, such as NF1 (32), or to indirectly modulate SP-C expression via protein–protein interaction with TTF-1 to form a complex, such as GATA-6 (20). TAP26, a TTF-1–associated protein that forms a complex with TTF-1 and promotes TTF-1 activity on the SP-B promoter (17), also stimulates SP-C promoter activity (unpublished data). In this study, we document a factor PLAGL2, which can work as a transfactor of the SP-C promoter in transfected HEK293 and MLE12 cells in a TTF-1–independent manner.

PLAGL2 is a zinc finger protein containing seven finger repeats, but the first two repeats do not bear the conserved C2H2 domain structure. This protein originally was thought to be mainly expressed during embryonic development (22). However, in adult mice, its expression is also detected in various tissues with elevated expression in the lung, spleen, and testis (27). Based on the real-time PCR quantitative study, our data indicate that PLAGL2 expression is higher than that of TTF-1 in the fetal lungs as well as in the type II cells isolated from fetal tissue. It is reasonable to expect low TTF-1 in the lung because not all cells in the lung express TTF-1. However, it is surprising to find that the estimated copy number of TTF-1 is low in the isolated, uninduced fetal lung type II cells (D0). When these cells were induced by Bt2cAMP (D5), SP-B expression escalated alone with TTF-1, but SP-C expression remained relatively constant, as in D0 (Table 2 and Figure 2B). Though mRNA instability might contribute to the low level of TTF-1 detected in D0 cells, the induced TTF-1 in Bt2cAMP-treated cells (D5) indicates that TTF-1 expression was not optimal in those D0 cells. In TTF-1 transgenic mice with moderately increased TTF-1 expression in the lung alveolar epithelium, SP-B expression is increased, but not SP-C (33). Thus, SP-C expression, at least in some instances, is independent of TTF-1. Because PLAGL2 expression is high in those embryonic cells, it is reasonable to suspect PLAGL2 of being an endogenous positive regulator of the SP-C promoter in those developing lung cells.

The PLAGL2 binding site contains a bipartite element—core and cluster sequences (23, 24). The core site (GGGGC) is conserved in both human and mouse SP-C promoters (Figure 1A). The cluster element, which is preserved in the human SP-C promoter (GGGG), is degenerated in the mouse promoter (GCTG). Site-directed mutagenesis studies suggest that the core sequence is essential in the interaction with PLAGL2. Different from the SP-C promoter, SP-B promoter carries a G->A change, which eradicates the predicted core binding site, and no cluster sequence has been found. Thus, the lack of PLAGL2 binding site on the promoter could account for the nonresponsiveness of SP-B promoter to PLAGL2 induction.

There are nine recognizable TTF-1 DNA–binding consensus sequences (CAAG) within the human and mouse SP-C promoters (–320 to +1). Among these nine sites, T4 and T5 sites play the most important role in TTF-1–dependent SP-C promoter activity (13). DNA sequence alignment shows that both TTF-1 and PLAGL2 DNA–binding sites reside in close vicinity to the proximal promoter region. The T5 site is juxtaposed to the 5' end of the PLAGL2 DNA-binding consensus (Figure 1A). When T4, T5 (Figure 4), or both (data not shown) binding sites were eliminated, there was no impact on the activation of those mutated promoters by PLAGL2. In contrast, SP-C promoters lacking core or core and cluster sequences significantly reduced their activation by PLAGL2 in transfected HEK293 cells (Figure 4A). Therefore, activation of the SP-C promoter by PLAGL2 does not require a TTF-1 complex at this promoter site. In fact, in MLE12 cells, the SP-C promoter mutated at the TTF-1 sites (mT4mT5) has the same degree of activity as the wild type (Figure 7, P > 0.05). This implies that the binding of PLAGL2 to the SP-C promoter can replace the function associated with nearby T4 and T5 complexes to activate the SP-C promoter. As mentioned in the previous section, other TTF-1 sites further upstream of the promoter may contribute to the activity of the T4 and T5 mutated promoter. However, this scenario appears less likely, because the T2 and T3 sites alone have only minimal promoter activity in TTF-1–transfected MLE15 and HeLa cells (13).

Given the fact that a single change of the first histidine in zinc finger 6 (mF6) or 7 (mF7) of PLAGL2 abolishes promoter activity, whereas a change in finger 4 (mF4) has no impact, our results suggest a direct interaction between the fingers 6 and 7 of PLAGL2 and the SP-C promoter. Via the binding of PLAGL2 to the promoter, PLAGL2 can transactivate the SP-C promoter independent of TTF-1. In addition to DNA-binding activity, the transactivation domain is also required for the activation of SP-C promoter (Figure 6).

Unlike TTF-1 and NF1 that have multiple DNA-binding sites on the SP-C promoter (13, 32), there is only one DNA consensus element identified for PLAGL2 binding. This site contributes to more than 75% of PLAGL2-activated promoter activity. Aside from this site, there are few noticeable GC-rich sequences around other TTF-1 binding sites. These GC-rich regions have a sequence similar to the core consensus of PLAGL2 sites. We suspect that these regions may have low affinity for PLAGL2 binding, thus accounting for the remaining < 25% of PLAGL2-dependent activity.

Within the proximal region of the SP-C promoter, the PLAGL2 binding site overlaps with a common sequence motif of (G/A)(G/T)GCTCT, which is critical for the expression of lung- and thyroid-specific genes (13). This motif is present within both human and mouse SP-B and SP-C promoters (GGGCTCT) (Figure 1A). The finding that PLAGL2 preferentially transactivates the SP-C but not SP-B promoter suggests that this motif is not functionally responsible for PLAGL2 binding.

SP-C promoter activity can be activated by TTF-1 (13) as well as by nuclear factor I (NFI) (32). Both factors' DNA-binding, dimerization, or transactivation activities on the thyroglobulin promoter are known to be redox-regulated (34, 35). Their redox responses may be mediated by the cysteine residues at amino acid 87 and 363 of TTF-1 and 427 of NFI. These sensors can respond to H2O2 treatment or glutathione depletion, and interact with redox effector factor-1 (36). Interestingly, many zinc fingers are also known to be redox-regulated by intracellular reactive oxygen species (37). Here, we report that PLAGL2 could be another zinc finger–containing regulator of the SP-C promoter. PLAGL2 is also involved in the activation of iron-deficient and hypoxia-induced gene expression in mouse cell lines (27). Thus, we suspect that the SP-C promoter may be redox-sensitive as well, because many of its regulators have the potential to be redox-modulated in vivo.


    Acknowledgments
 
The authors greatly appreciate Aaron Aldape and Chia-Chi (Virginia) Liu for their excellent technical assistance.


    Footnotes
 
Supported by National Heart, Lung, and Blood Institute (NHLBI) grant R01HL63525 (to Y.S.Y.), the Will Rogers Institute and the James M. Collins Center for Biomedical Research (to J.C.W.), and the Veterans Administration and the NHLBI (to L.S.T.).

Received in original form November 20, 2003

Received in final form September 7, 2004


    References
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 

  1. Weaver TE, Conkright JJ. Function of surfactant proteins B and C. Annu Rev Physiol 2001;63:555–578.[CrossRef][Medline]
  2. Whitsett JA, Weaver TE. Hydrophobic surfactant proteins in lung function and disease. N Engl J Med 2002;347:2141–2148.[Free Full Text]
  3. Conkright JJ, Na CL, Weaver TE. Overexpression of surfactant protein–C mature peptide causes neonatal lethality in transgenic mice. Am J Respir Cell Mol Biol 2002;26:85–90.[Abstract/Free Full Text]
  4. Nogee LM, Dunbar AE, Wert SE, Askin F, Hamvas A, Whitsett JA. A mutation in the surfactant protein C gene associated with familial interstitial lung disease. N Engl J Med 2001;344:573–579.[Free Full Text]
  5. Nogee LM, Dunbar AE, Wert S, Askin F, Hamvas A, Whitsett JA. Mutations in the surfactant protein C gene associated with interstitial lung disease. Chest 2002;121:20S–21S.[Free Full Text]
  6. Thomas AQ, Lane K, Phillips J, Prince M, Markin C, Speer M, Schwartz DA, Gaddipati R, Marney A, Johnson J, et al. Heterozygosity for a surfactant protein C gene mutation associated with usual interstitial pneumonitis and cellular nonspecific interstitial pneumonitis in one kindred. Am J Respir Crit Care Med 2002;165:1322–1328.[Abstract/Free Full Text]
  7. Whitsett JA. Genetic basis of familial interstitial lung disease: misfolding or function of surfactant protein C? Am J Respir Crit Care Med 2002;165:1201–1202.[Free Full Text]
  8. Nogee LM. Abnormal expression of surfactant protein C and lung disease. Am J Respir Cell Mol Biol 2002;26:641–644.[Free Full Text]
  9. Glasser SW, Detmer EA, Ikegami M, Na CL, Stahlman MT, Whitsett JA. Pneumonitis and emphysema in SP-C gene targeted mice. J Biol Chem 2003;278:14291–14298.[Abstract/Free Full Text]
  10. Bingle CD. Thyroid transcription factor-1. Int J Biochem Cell Biol 1997;29:1471–1473.[CrossRef][Medline]
  11. Li J, Gao E, Seidner SR, Mendelson CR. Differential regulation of baboon SP-A1 and SP-A2 genes: structural and functional analysis of 5'-flanking DNA. Am J Physiol 1998;275:L1078–L1088.
  12. Bohinski RJ, Di Lauro R, Whitsett JA. The lung-specific surfactant protein B gene promoter is a target for thyroid transcription factor 1 and hepatocyte nuclear factor 3, indicating common factors for organ-specific gene expression along the foregut axis. Mol Cell Biol 1994;14:5671–5681.[Abstract/Free Full Text]
  13. Kelly SE, Bachurski CJ, Burhans MS, Glasser SW. Transcription of the lung-specific surfactant protein C gene is mediated by thyroid transcription factor 1. J Biol Chem 1996;271:6881–6888.[Abstract/Free Full Text]
  14. Zhang L, Whitsett JA, Stripp BR. Regulation of Clara cell secretory protein gene transcription by thyroid transcription factor-1. Biochim Biophys Acta 1997;1350:359–367.[Medline]
  15. Korfhagen TR, Whitsett JA. Transcriptional control in the developing lung. The Parker B. Francis lectureship. Chest 1997;111:83S–88S.[Free Full Text]
  16. Glasser SW, Burhans MS, Eszterhas SK, Bruno MD, Korfhagen TR. Human SP-C gene sequences that confer lung epithelium–specific expression in transgenic mice. Am J Physiol Lung Cell Mol Physiol 2000;278:L933–L945.[Abstract/Free Full Text]
  17. Yang YS, Yang MC, Wang B, Weissler JC. BR22, a novel protein, interacts with thyroid transcription factor-1 and activates the human surfactant protein B promoter. Am J Respir Cell Mol Biol 2001;24:30–37.[Abstract/Free Full Text]
  18. Yang MC, Wang B, Weissler JC, Margraf LR, Yang YS. BR22, a 26 kDa thyroid transcription factor-1 associated protein (TAP26), is expressed in human lung cells. Eur Respir J 2003;22:28–34.[Abstract/Free Full Text]
  19. Bousquet WJJ. Understanding the regulation of surfactant gene expression. Eur Respir J 2003;22:6–7.[Free Full Text]
  20. Liu C, Glasser SW, Wan H, Whitsett JA. GATA-6 and thyroid transcription factor-1 directly interact and regulate surfactant protein–C gene expression. J Biol Chem 2002;277:4519–4525.[Abstract/Free Full Text]
  21. Park KS, Whitsett JA, Di Palma T, Hong JH, Yaffe MB, Zannini M. TAZ interacts with TTF-1 and regulates expression of surfactant protein–C. J Biol Chem 2004;279:17384–17390.[Abstract/Free Full Text]
  22. Kas K, Voz ML, Hensen K, Meyen E, Van de Ven WJ. Transcriptional activation capacity of the novel PLAG family of zinc finger proteins. J Biol Chem 1998;273:23026–23032.[Abstract/Free Full Text]
  23. Voz ML, Agten NS, Van de Ven WJ, Kas K. PLAG1, the main translocation target in pleomorphic adenoma of the salivary glands, is a positive regulator of IGF-II. Cancer Res 2000;60:106–113.[Abstract/Free Full Text]
  24. Hensen K, Van Valckenborgh IC, Kas K, Van de Ven WJ, Voz ML. The tumorigenic diversity of the three PLAG family members is associated with different DNA binding capacities. Cancer Res 2002;62:1510–1517.[Abstract/Free Full Text]
  25. Varrault A, Ciani E, Apiou F, Bilanges B, Hoffmann A, Pantaloni C, Bockaert J, Spengler D, Journot L. hZAC encodes a zinc finger protein with antiproliferative properties and maps to a chromosomal region frequently lost in cancer. Proc Natl Acad Sci USA 1998;95:8835–8840.[Abstract/Free Full Text]
  26. Yang YS, Watson WJ, Tucker PW, Capra JD. Construction of recombinant DNA by exonuclease recession. Nucleic Acids Res 1993;21:1889–1893.[Abstract/Free Full Text]
  27. Furukawa T, Adachi Y, Fujisawa J, Kambe T, Yamaguchi-Iwai Y, Sasaki R, Kuwahara J, Ikehara S, Tokunaga R, Taketani S. Involvement of PLAGL2 in activation of iron-deficient and hypoxia-induced gene expression in mouse cell lines. Oncogene 2001;20:4718–4727.[CrossRef][Medline]
  28. Alcorn JL, Smith ME, Smith JF, Margraf LR, Mendelson CR. Primary cell culture of human type II pneumonocytes: maintenance of a differentiated phenotype and transfection with recombinant adenoviruses. Am J Respir Cell Mol Biol 1997;17:672–682.[Abstract/Free Full Text]
  29. Lalli E, Gibellini D, Santi S, Facchini A. In situ hybridization in suspension and flow cytometry as a tool for the study of gene expression. Anal Biochem 1992;207:298–303.[CrossRef][Medline]
  30. Bates SR, Gonzales LW, Tao JQ, Rueckert P, Ballard PL, Fisher AB. Recovery of rat type II cell surfactant components during primary cell culture. Am J Physiol Lung Cell Mol Physiol 2002;282:L267–L276.[Abstract/Free Full Text]
  31. Perl AK, Wert SE, Nagy A, Lobe CG, Whitsett JA. Early restriction of peripheral and proximal cell lineages during formation of the lung. Proc Natl Acad Sci USA 2002;99:10482–10487.[Abstract/Free Full Text]
  32. Bachurski CJ, Kelly SE, Glasser SW, Currier TA. Nuclear factor I family members regulate the transcription of surfactant protein–C. J Biol Chem 1997;272:32759–32766.[Abstract/Free Full Text]
  33. Wert SE, Dey CR, Blair PA, Kimura S, Whitsett JA. Increased expression of thyroid transcription factor–1 (TTF-1) in respiratory epithelial cells inhibits alveolarization and causes pulmonary inflammation. Dev Biol 2002;242:75–87.[CrossRef][Medline]
  34. Arnone MI, Zannini M, Di Lauro R. The DNA binding activity and the dimerization ability of the thyroid transcription factor I are redox regulated. J Biol Chem 1995;270:12048–12055.[Abstract/Free Full Text]
  35. Morel Y, Barouki R. The repression of nuclear factor I/CCAAT transcription factor (NFI/CTF) transactivating domain by oxidative stress is mediated by a critical cysteine (Cys-427). Biochem J 2000;348:235–240.
  36. Tell G, Pines A, Paron I, D'Elia A, Bisca A, Kelley MR, Manzini G, Damante G. Redox effector factor-1 regulates the activity of thyroid transcription factor 1 by controlling the redox state of the N-transcriptional activation domain. J Biol Chem 2002;277:14564–14574.[Abstract/Free Full Text]
  37. Baldwin MA, Benz CC. Redox control of zinc finger proteins. Methods Enzymol 2002;353:54–69.[Medline]
  38. Kumar AS, Gonzales LW, Ballard PL. Transforming growth factor-beta(1) regulation of surfactant protein B gene expression is mediated by protein kinase–dependent intracellular translocation of thyroid transcription factor-1 and hepatocyte nuclear factor 3. Biochim Biophys Acta 2000;1492:45–55.[Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Y.-S. Yang, M.-C. W. Yang, Y. Guo, O. W. Williams, and J. C. Weissler
PLAGL2 expression-induced lung epithelium damages at bronchiolar alveolar duct junction in emphysema: bNip3- and SP-C-associated cell death/injury activity
Am J Physiol Lung Cell Mol Physiol, September 1, 2009; 297(3): L455 - L466.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Besnard, S. E. Wert, M. T. Stahlman, A. D. Postle, Y. Xu, M. Ikegami, and J. A. Whitsett
Deletion of Scap in Alveolar Type II Cells Influences Lung Lipid Homeostasis and Identifies a Compensatory Role for Pulmonary Lipofibroblasts
J. Biol. Chem., February 6, 2009; 284(6): 4018 - 4030.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. C. B. Ammons, D. W. Siemsen, L. K. Nelson-Overton, M. T. Quinn, and K. A. Gauss
Binding of Pleomorphic Adenoma Gene-like 2 to the Tumor Necrosis Factor (TNF)-{alpha}-responsive Region of the NCF2 Promoter Regulates p67phox Expression and NADPH Oxidase Activity
J. Biol. Chem., June 15, 2007; 282(24): 17941 - 17952.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Hoffmann, T. Barz, and D. Spengler
Multitasking C2H2 Zinc Fingers Link Zac DNA Binding to Coordinated Regulation of p300-Histone Acetyltransferase Activity.
Mol. Cell. Biol., July 1, 2006; 26(14): 5544 - 5557.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2003-0422OCv1
32/1/35    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, M.-C. W.
Right arrow Articles by Yang, Y.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, M.-C. W.
Right arrow Articles by Yang, Y.-S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2005 American Thoracic Society.