Published ahead of print on September 10, 2004, doi:10.1165/rcmb.2003-0422OC
© 2005 American Thoracic Society DOI: 10.1165/rcmb.2003-0422OC Pleiomorphic Adenoma GeneLike2, a Zinc Finger Protein, Transactivates the Surfactant ProteinC PromoterDepartment of Internal Medicine, Pulmonary and Critical Care Medicine, The University of Texas Southwestern Medical Center at Dallas; and Dallas Veterans Affairs Medical Center, Dallas, Texas Correspondence and requests for reprints should be addressed to Yih-Sheng Yang, Ph.D., Department of Internal Medicine, Pulmonary and Critical Care Medicine, UT Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390-9034. E-mail: Yih-Sheng.Yang{at}UTSouthwestern.edu
Expression of surfactant protein (SP)-C occurs principally in type II pneumocytes located in the distal lung alveolae. SP-C expression is thought to be primarily regulated by thyroid transcription factor (TTF)-1 and its associated proteins interacting with a previously defined promoter region between 197 and 158 in mice. We screened a human lung cDNA library using a modified yeast one-hybrid system and identified pleiomorphic adenoma genelike (PLAGL)2, a ubiquitously expressed zinc finger protein, as a transfactor of the SP-C promoter. The PLAGL2 DNA-binding site was located in the SP-C promoter proximal region close to the TTF-1 sites. This site was demonstrated to be functional by use of electrophoresis mobility shift assay, mutagenesis analysis, and transfection studies. PLAGL2 bound to DNA via its N-terminus zinc fingers and activated the SP-C promoter in a TTF-1independent manner. Both human and mouse SP-C promoters, but not the SP-B promoter, could be activated by PLAGL2 in transfected human embryonic kidney293 (HEK293) cells as well as in murine type II (MLE12) cells. The expression of PLAGL2 in isolated human embryonic lung type II cells and its transactivation activity on the SP-C promoter suggest that PLAGL2 may modulate SP-C expression during lung development.
Key Words: gene expression PLAGL2 SP-C TTF-1 zinc finger protein
Pulmonary surfactant containing phospholipids and specific surfactant proteins (SPs) is present in the alveolar space. The hydrophobic SP-B and SP-C reduce alveolar surface tension by enhancing the adsorption and spreading of surfactant phospholipid onto the airliquid interface. They are essential for respiratory function and pulmonary homeostasis. Deficiencies in these proteins caused by premature birth, lung injury, or gene mutations can result in respiratory failure or chronic lung disease. Reports have shown that patients with some lung diseases harbor various mutations in either SP-B or SP-C genes (1, 2). Aside from the mutated polypeptides, aberrant expression of SPs by alteration of their promoter activities via unidentified proteins or modifiers may also lead to lung abnormalities (2). Over- or underexpression of SP-C is associated with lung diseases (2). Both SP-B and SP-C pro-proteins are transported through a secretory pathway via the endoplasmic reticulum, Golgi, and plasma membrane for secretion. Overexpression of SP-C can cause proSP-C aggregation in the secretory pathway and lead to type II cell injury in mice (3). In humans, mutations of the SP-C gene are found associated with sporadic and familial interstitial lung disease or with idiopathic pulmonary fibrosis (46). Mutations in the SP-C coding region caused by the alternation of splice-site (4), mis-sense, and frame-shift translation (5), or transversion/point mutations (6), may produce misfolded polypeptides and subsequently block the functionally coupled processing, folding, and routing pathways inside the type II cells. Therefore, overexpression and accumulation of SP-C polypeptides inside the cells can eventually lead to cell cytotoxicity and injury (7, 8). Transgenic mice overexpressing SP-C peptide in type II cells die shortly after birth (3). The phenomenon coincided well with the theory that aggregated SP-C polypeptide in the secretory pathway of type II cells could block and damage normal cellular functions. Under a converse condition under which SP-C expression is eliminated in vivo, some mouse strains developed emphysema (9). The results from these animal studies suggest that aberrant expression of SP-C in vivo could lead to various chronic pulmonary diseases. The finding of correlations between SP-C expression and various lung diseases (36, 9) prompted us to search for factors that could specifically modulate SP-C promoter activity but not affect expression of other SPs. SP-B and SP-C are expressed in alveolar type II cells with additional expression of SP-B in Clara cells. Their cell typespecific expression is thought to be mediated through thyroid transcription factor (TTF)-1, a homeodomain transcription factor expressed in thyroid, lung, and pituitary gland (10). In the lung, TTF-1 binds to consensus elements CAAG, located at the promoter regions of many lung cell typespecific genes (1114). Given the fact that TTF-1 is expressed in multiple tissues and is also required for the expression of many lung-specific genes, TTF-1 alone cannot fully account for the differential expression of SP-B and SP-C in the alveolar epithelial cells. A network of regulatory molecules involving TTF-1 and its associated protein complexes may be necessary for the specific expression of each individual gene in vivo (15). The SP-B and SP-C gene promoters have been well characterized. Both promoters have a unique proximal region to confer the cell typespecific expression in lung: 118 to 64 of human SP-B (12), 197 to 158 of mouse SP-C (13), and within the 215 region of human SP-C promoters (16). Previously, by integrating the SP-B promoter proximal region into a yeast one-hybrid system to screen a human lung cDNA library in yeast, 26 kD TTF-1associated protein (TAP26) was identified as a TTF-1associated factor to synergistically transactivate the SP-B promoter in the transfected human embryonic kidney (HEK)293 cells (1719). Aside from TAP26, GATA-6 and transcriptional co-activator with PDZ-binding motif (TAZ) are the other two TTF-1associated proteins that can synergistically activate the SP-C promoter (20, 21). In addition, TAP26 appears to stimulate TTF-1dependent activity of the SP-C promoter as well (unpublished data). Pleiomorphic adenoma genelike (PLAGL) 2 is a member of the zinc fingercontaining PLAG gene family, the function of which remains poorly defined (22). All three PLAG proteins (PLAG1, PLAGL1, and PLAGL2) are highly homologous, especially in their N-terminal zinc finger DNAbinding domain. PLAGL2 can bind to the consensus of PLAG1 binding site, a core (GRGGC, R:A or G) and a cluster sequence (RGGK, K: A, G or T) separated by seven random nucleotides (23, 24). This consensus sequence is different from that of PLAGL1 DNAbinding site (ACGGGGGGCCCCTTTA) (25). In this study, when the proximal promoter region of SP-C was used to screen for interacting factors, PLAGL2 was recovered as a putative transfactor of the promoter. We demonstrate that PLAGL2 can preferentially transactivate the SP-C promoter through direct binding to a PLAGL2 consensus element within the proximal region of the SP-C promoter. Unlike GATA-6, TAZ, and TAP26, PLAGL2 is unique in that it transactivates the SP-C promoter independent of TTF-1.
Yeast Analyses Plasmid pHISi-SPCP, a reporter plasmid of yeast one-hybrid system, was constructed to have the yeast HIS3 gene expression controlled by a mouse SP-C promoter fragment (197 to 158). This plasmid was linearized at Xho1 site and integrated into the his3 locus of the Y187 yeast strain, which harbored a Gal4-responsive LacZ reporter, via homologous recombination. The resulting yeast strain was then cotransformed with GBT-TTF1HD (GBTTTF-1 homeodomain) and a human lung cDNA library fused with a GAL4 activation domain (BD Bioscience Clontech, Palo Alto, CA). Yeast transformants were plated on the selection medium without leucine, tryptophan, and histidine (SD/LWH). To reduce the nonspecific background, 45 mM 3-aminotriazole was added to medium during the selection. For a more stringent library selection, a ß-galactosidase filter-lifted (blue color) assay was further performed to eliminate those nonresponsive clones. The DNA-binding activity of identified candidates was confirmed in vivo by using yeast one-hybrid analysis as described by the manufacturer. DNA of the potential yeast candidate clones was prepared and transformed into XL1-bluecompetent cells by electroporation to recover the carried plasmids. Plasmid DNAs were further amplified and purified from bacteria for sequence analysis.
Plasmid Construction Plasmid pHISi-SPCP was constructed by blunt-end ligation of oligonucleotide containing the SP-C promoter sequence (mouse 197 to 158) into the Sma I site of pHISi vector (BD Bioscience Clontech). Plasmids pHISi-SPBP and pGL3-SPBP are prepared as described previously (17). Plasmids, pGL3-hSPCP and pGL3-mSPCP, were constructed by inserting a 320 bp (320 to +1) of human and mouse SP-C promoter fragment into Bgl II/Hind III-digested pGL3 vector (Promega, Madison, WI), respectively. These SP-C promoter fragments were generated by polymerase chain reaction (PCR) amplification using human or mouse genomic DNA as templates. The primers used for these reactions were: 5'SPCP(-320)(Nhe1/Bgl II) GCTAGCAGATCTGGGGCAGGTGCCAGC AAG; 3'SPCP(+1) (Xho I/Hind III) ATCTAGAAGCTTCTCTCCTCTCCTC(A/C)TC. All of the constructed reporter gene promoter sequences were confirmed by DNA sequence analysis.
Site-Directed Mutagenesis
Transient Transfection and Luciferase Reporter Gene Assay
Electrophoresis Mobility Shift Assay
Western Blot Analysis Cellular proteins obtained from an equal volume of cell lysates (800 ng of expressing plasmid DNA) used in the luciferase assay were fractionated on a 10% sodium dodecyl sulfatepolyacrylamide gel electrophoresis gel and then transferred to a polyvinylidene difluoride membrane for Western blot analysis. The membrane was probed with anti-Flag antibody (M2, 1:1,000) (Sigma, St. Louis, MO) followed by rabbit anti-mouse antibody conjugated with horseradish peroxidase (1:3,000) for transfected protein detection. The bound antibody probe was detected and developed with Supersignal West Pico Chemiluminescent substrate (Pierce, Rockford, IL).
Reverse TranscriptasePCR Analysis
PLAGL2 Binds to the Sequence in the Proximal Region of SP-C Promoter A 40-bp fragment (197 to 158) located at the proximal region of mouse SP-C promoter has been identified that contains essential cis-elements for SP-C expression in the lung type II cells (13). The DNA sequence within this region is very similar in human and mouse SP-C promoters (Figure 1A). Using the mouse sequence of this region as bait in a modified yeast one- and two-hybrid system, a human lung cDNA library was screened in the presence of TTF-1 homeodomain (pGBT-TTF1HD) to search for proteinDNA as well as proteinprotein interacting complexes. A total of 32 out of 5 x 106 colonies screened grew on the selection medium lacking histidine, indicating that polypeptides encoded from those clones were able to bind to the specific SP-C promoter fragment. Three of these clones, which were also positive in lacZ gene expression (indicating the activation of an additional reporter gene [data not shown]), were further isolated and their plasmids were recovered and passaged through Escherichia coli. DNA sequence analysis of all three clones revealed library inserts from PLAGL2. The consensus sequence of a PLAGL2 binding site was then identified on the SP-C promoter proximal region where multiple TTF-1 binding sites exist (Figure 1A). To determine if this SP-C promoter region could be a target for PLAGL2 binding, yeast one-hybrid analysis was performed. The result indicates that PLAGL2 interacts with the DNA sequence obtained from the SP-C promoter but not with that from the SP-B promoter (118 to 64) from the same region (data not shown). To further demonstrate that PLAGL2 could directly interact with the SP-C promoter fragment, electrophoresis mobility shift assay (EMSA) analysis was performed. As shown in Figure 1B, in vitrotranslated PLAGL2 formed a retarded complex with DNA probe containing the expected PLAGL2 binding site (lane 2). The interaction was unique for PLAGL2, as lysates programmed with TAP26 did not show the same proteinDNA complex (lane 5). In addition, zinc fingers 6 and 7 were necessary for binding, because mutated PLAGL2, with either the 6 or 7 finger eliminated, did not bind to the probe (lanes 3 and 4). Oligo duplexes with mutated PLAGL2 binding site (mComCl) did not compete off the interaction (lanes 8 and 9), whereas oligos with intact PLAGL2 binding sitewild type (lanes 10 and 11) or TTF-1 sites mutated (mT4mT5, lanes 6 and 7)competed off the interactions in vitro. Thus, PLAGL2 appears to interact with the SP-C promoter at the core and cluster region in a manner dependent upon zinc fingers 6 and 7.
PLAGL2 Message Is Actively Expressed in Isolated Fetal Lung Type II Pneumocytes
PLAGL2 is mainly regulated during embryogenesis (22). By real-time PCR analysis, PLAGL2 expression occurs in the lung as early as the 6-wk-old embryo (6W). It is also expressed in the isolated human fetal lung type II cells (D0) (28). Within these cells, the steady-state level of PLAGL2 transcripts is higher than TTF-1 (Table 2). As shown in Table 2, the threshold cycle differences between the gene of interest and GAPDH, the housekeeping gene, which indicates expression differences between the gene of interest and the housekeeping gene GAPDH (estimated 1,200 copies/cell) (29), suggests a low expression of TTF-1 within these cells. Interestingly, SP-C transcripts are relatively abundant in spite of low TTF-1 expression, consistent with PLAGL2-dependent expression. Data from our conventional RT-PCR analysis are also concordant with the results obtained from the real-time PCR study (Figure 2B). By real-time PCR analysis, the pattern of SP-B and SP-C expression in D0 cells resembles that observed in freshly isolated adult and young rat type II cells (30). Unlike these cells, more TTF-1 than PLAGL2 is present in MLE12 cells, and the steady-state level of SP-B message is relatively increased in parallel to TTF-1.
PLAGL2 Transactivates both Human and Mouse SP-C Promoters The presence of PLAGL2 in type II cells and its binding to the SP-C promoter prompted the hypothesis that PLAGL2 could be a direct transactivator of the SP-C promoter. To explore this possibility, we tested the transactivation activity of PLAGL2 on the human SP-C promoter. Expression plasmids containing either PLAGL2 or TTF-1 were cotransfected with pGL3-hSPCP or pGL3-hSPBP into HEK293 cells. Because HEK293 cells do not express TTF-1 or other potential lung cellspecific factors that may contribute to the activation of those SP promoters, they are a suitable host to study independent effects of transcription factors. As shown in Figure 3A, the SP-C promoter is activated by PLAGL2 or TTF-1 independently, and the activation is more efficiently upregulated by PLAGL2 than TTF-1, and is PLAGL2 concentrationdependent (Figure 3B). Both human and murine SP-C promoters can be activated by PLAGL2 in transfected HEK293 cells. The activation of the SP-C promoter by PLAGL2 is significantly greater than the activation of the SP-B promoter (P < 0.001). Thus, there is a robust and selective activation of the SP-C promoter by PLAGL2.
The PLAGL2 Binding Site on the SP-C Promoter Is Required for PLAGL2-Dependent Activity To demonstrate that the identified binding site on the SP-C promoter is functional, mutated promoters, with the PLAGL2 binding site altered, were created. When the core site sequence was mutated by the GC AT change, the PLAGL2-dependent transactivation was reduced to 50% of that of the wild type (Figure 4A). Double mutations with both core and cluster sequences altered (mComCl) resulted in a more than 75% reduction in activity. Thus, this data strongly suggests that the identified PLAGL2 binding sequence is functional for the activation of SP-C promoter. The cluster sequence contributes less than 25% of the intact promoter activity. The mutated promoter (mComCl) does not lose its TTF-1dependent activity in transfected H441 cells (data not shown). In addition, neither T4 nor T5 of the TTF-1 binding site (mT4 or mT5) are required for PLAGL2-dependent activation (Figure 4B). All TTF-1 binding sitemutated promotersmT4, mT5, and mT4mT5 (double mutations)retain a similar PLAGL2 dependent activity as the wild-type promoter (Figure 4B and data not shown).
Transactivation Activity of PLAGL2 Requires both Zinc Finger and CTD As shown in Figure 5, PLAGL2 can also transactivate the SP-C promoter in MLE12 cells. However, neither the zinc finger (pCIN-PLAGL2-N249, N189) nor the CTD (pCIN-PLAGL2-CTD) domains alone transactivate the promoter. The zinc finger domain (N249) alone functions as a dominant suppressor to repress PLAGL2-dependent SP-C promoter activity (Figure 6A). These data suggest the presence of a transactivation domain within the C-terminus of PLAGL2.
Fingers 6 and 7 of PLAG1 are known to be responsible for its DNA binding activity (23). To map the DNA binding domain of PLAGL2, several mutants of PLAGL2 with altered fingers 4, 6, or 7 were generated for analysis. Point mutations on zinc finger 6 (mF6, H209A) or 7 (mF7, H233A) of PLAGL2 completely aborted the activities on the SP-C promoter (Figure 6B), whereas a mutation of finger 4 (mF4, H145A) (data not shown) had no impact on transactivation activity. This result further mapped PLAGL2 DNAbinding activity to fingers 6 and 7. To confirm that lost activity was not due to low protein expression, equal amounts of cell lysates used in the luciferase assays were examined for mF6, mF7, and wild-type PLAGL2 expression. Western blot analysis showed that all exogenous proteins were equally expressed in transfected cells (Figure 6B, right panel). Thus, the binding of PLAGL2 via fingers 6 and 7 to its binding site on the SP-C promoter is necessary for PLAGL2-dependent activation of the SP-C promoter.
SP-C Promoter without TTF-1 Sites in the Proximal Region Remains Active in MLE12 Cells
Though TTF-1 is indispensable for both SP-B and SP-C expression in the lung type II cells, their cell typespecific expression is not solely due to the presence of TTF-1 in vivo. For example, in Clara cells and its derived cell line, H441, SP-B is expressed, but not SP-C, in spite of the presence of TTF-1. During lung development, SP-C expression occurs when the primordial lung appears at the early developmental, pseudoglandular stage, whereas SP-A and SP-B expression occurs later at the canalicular stage. Furthermore, in recent transgenic mouse studies, the exogenous SP-C promoter could be activated at an earlier time during embryogenesis than the endogenous SP-C promoter (31). Therefore, these observations suggest that factors other than TTF-1 may be involved in differential regulation of SP-C expression in vivo. Other factors have been identified to mediate SP-C promoter activity through directly binding to the cis elements of the promoter, such as NF1 (32), or to indirectly modulate SP-C expression via proteinprotein interaction with TTF-1 to form a complex, such as GATA-6 (20). TAP26, a TTF-1associated protein that forms a complex with TTF-1 and promotes TTF-1 activity on the SP-B promoter (17), also stimulates SP-C promoter activity (unpublished data). In this study, we document a factor PLAGL2, which can work as a transfactor of the SP-C promoter in transfected HEK293 and MLE12 cells in a TTF-1independent manner. PLAGL2 is a zinc finger protein containing seven finger repeats, but the first two repeats do not bear the conserved C2H2 domain structure. This protein originally was thought to be mainly expressed during embryonic development (22). However, in adult mice, its expression is also detected in various tissues with elevated expression in the lung, spleen, and testis (27). Based on the real-time PCR quantitative study, our data indicate that PLAGL2 expression is higher than that of TTF-1 in the fetal lungs as well as in the type II cells isolated from fetal tissue. It is reasonable to expect low TTF-1 in the lung because not all cells in the lung express TTF-1. However, it is surprising to find that the estimated copy number of TTF-1 is low in the isolated, uninduced fetal lung type II cells (D0). When these cells were induced by Bt2cAMP (D5), SP-B expression escalated alone with TTF-1, but SP-C expression remained relatively constant, as in D0 (Table 2 and Figure 2B). Though mRNA instability might contribute to the low level of TTF-1 detected in D0 cells, the induced TTF-1 in Bt2cAMP-treated cells (D5) indicates that TTF-1 expression was not optimal in those D0 cells. In TTF-1 transgenic mice with moderately increased TTF-1 expression in the lung alveolar epithelium, SP-B expression is increased, but not SP-C (33). Thus, SP-C expression, at least in some instances, is independent of TTF-1. Because PLAGL2 expression is high in those embryonic cells, it is reasonable to suspect PLAGL2 of being an endogenous positive regulator of the SP-C promoter in those developing lung cells.
The PLAGL2 binding site contains a bipartite elementcore and cluster sequences (23, 24). The core site (GGGGC) is conserved in both human and mouse SP-C promoters (Figure 1A). The cluster element, which is preserved in the human SP-C promoter (GGGG), is degenerated in the mouse promoter (GCTG). Site-directed mutagenesis studies suggest that the core sequence is essential in the interaction with PLAGL2. Different from the SP-C promoter, SP-B promoter carries a G There are nine recognizable TTF-1 DNAbinding consensus sequences (CAAG) within the human and mouse SP-C promoters (320 to +1). Among these nine sites, T4 and T5 sites play the most important role in TTF-1dependent SP-C promoter activity (13). DNA sequence alignment shows that both TTF-1 and PLAGL2 DNAbinding sites reside in close vicinity to the proximal promoter region. The T5 site is juxtaposed to the 5' end of the PLAGL2 DNA-binding consensus (Figure 1A). When T4, T5 (Figure 4), or both (data not shown) binding sites were eliminated, there was no impact on the activation of those mutated promoters by PLAGL2. In contrast, SP-C promoters lacking core or core and cluster sequences significantly reduced their activation by PLAGL2 in transfected HEK293 cells (Figure 4A). Therefore, activation of the SP-C promoter by PLAGL2 does not require a TTF-1 complex at this promoter site. In fact, in MLE12 cells, the SP-C promoter mutated at the TTF-1 sites (mT4mT5) has the same degree of activity as the wild type (Figure 7, P > 0.05). This implies that the binding of PLAGL2 to the SP-C promoter can replace the function associated with nearby T4 and T5 complexes to activate the SP-C promoter. As mentioned in the previous section, other TTF-1 sites further upstream of the promoter may contribute to the activity of the T4 and T5 mutated promoter. However, this scenario appears less likely, because the T2 and T3 sites alone have only minimal promoter activity in TTF-1transfected MLE15 and HeLa cells (13). Given the fact that a single change of the first histidine in zinc finger 6 (mF6) or 7 (mF7) of PLAGL2 abolishes promoter activity, whereas a change in finger 4 (mF4) has no impact, our results suggest a direct interaction between the fingers 6 and 7 of PLAGL2 and the SP-C promoter. Via the binding of PLAGL2 to the promoter, PLAGL2 can transactivate the SP-C promoter independent of TTF-1. In addition to DNA-binding activity, the transactivation domain is also required for the activation of SP-C promoter (Figure 6). Unlike TTF-1 and NF1 that have multiple DNA-binding sites on the SP-C promoter (13, 32), there is only one DNA consensus element identified for PLAGL2 binding. This site contributes to more than 75% of PLAGL2-activated promoter activity. Aside from this site, there are few noticeable GC-rich sequences around other TTF-1 binding sites. These GC-rich regions have a sequence similar to the core consensus of PLAGL2 sites. We suspect that these regions may have low affinity for PLAGL2 binding, thus accounting for the remaining < 25% of PLAGL2-dependent activity. Within the proximal region of the SP-C promoter, the PLAGL2 binding site overlaps with a common sequence motif of (G/A)(G/T)GCTCT, which is critical for the expression of lung- and thyroid-specific genes (13). This motif is present within both human and mouse SP-B and SP-C promoters (GGGCTCT) (Figure 1A). The finding that PLAGL2 preferentially transactivates the SP-C but not SP-B promoter suggests that this motif is not functionally responsible for PLAGL2 binding. SP-C promoter activity can be activated by TTF-1 (13) as well as by nuclear factor I (NFI) (32). Both factors' DNA-binding, dimerization, or transactivation activities on the thyroglobulin promoter are known to be redox-regulated (34, 35). Their redox responses may be mediated by the cysteine residues at amino acid 87 and 363 of TTF-1 and 427 of NFI. These sensors can respond to H2O2 treatment or glutathione depletion, and interact with redox effector factor-1 (36). Interestingly, many zinc fingers are also known to be redox-regulated by intracellular reactive oxygen species (37). Here, we report that PLAGL2 could be another zinc fingercontaining regulator of the SP-C promoter. PLAGL2 is also involved in the activation of iron-deficient and hypoxia-induced gene expression in mouse cell lines (27). Thus, we suspect that the SP-C promoter may be redox-sensitive as well, because many of its regulators have the potential to be redox-modulated in vivo.
The authors greatly appreciate Aaron Aldape and Chia-Chi (Virginia) Liu for their excellent technical assistance.
Supported by National Heart, Lung, and Blood Institute (NHLBI) grant R01HL63525 (to Y.S.Y.), the Will Rogers Institute and the James M. Collins Center for Biomedical Research (to J.C.W.), and the Veterans Administration and the NHLBI (to L.S.T.). Received in original form November 20, 2003 Received in final form September 7, 2004
This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||