help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published ahead of print on December 30, 2004, doi:10.1165/rcmb.2004-0322OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-0322OCv1
32/4/319    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bahadduri, P. M.
Right arrow Articles by Swaan, P. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bahadduri, P. M.
Right arrow Articles by Swaan, P. W.
American Journal of Respiratory Cell and Molecular Biology. Vol. 32, pp. 319-325, 2005
© 2005 American Thoracic Society
DOI: 10.1165/rcmb.2004-0322OC

Functional Characterization of the Peptide Transporter PEPT2 in Primary Cultures of Human Upper Airway Epithelium

Praveen M. Bahadduri, Vanessa M. D'Souza, Julia K. Pinsonneault, Wolfgang Sadée, Shenying Bao, Daren L. Knoell and Peter W. Swaan

Department of Pharmaceutical Sciences, University of Maryland, Baltimore, Maryland; Department of Pharmacology, Program in Pharmacogenomics, and Department of Pharmacy and Internal Medicine, The Ohio State University, Columbus, Ohio

Correspondence and requests for reprints should be addressed to Peter W. Swaan, Department of Pharmaceutical Sciences, University of Maryland, Health Sciences Facility II, 20 Penn Street, Baltimore, MD 21201. E-mail: pswaan{at}rx.umaryland.edu


    Abstract
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
This study characterizes the expression and function of the peptide transporter hPepT2 (SLC15A2) in differentiated primary cultures of human upper airway lung epithelia obtained from six human donors. Genotype analysis of a SNP in exon 15 of hPepT2 genotypes in six donors revealed an expected distribution of the two main variants present at similar frequency (two AA homozygotes, two BB homozygotes, and two AB heterozygotes). Real-time PCR analysis of the hPepT2 mRNA message revealed no significant differences among genotypes. hPEPT2 was expressed on the apical membrane in all donor specimens, demonstrated by cell surface biotinylation and Western analysis (104 kD). We then compared transepithelial transport of the prototypical substrate 3H-glycylsarcosine in all donor cultures in the absence and presence of known inhibitors of hPEPT2 to ascertain the phenotype of functionally expressed hPepT2 in the upper airway epithelium. An array of inhibitors included dipeptides, ß-lactam antibiotics, bestatin, and ACE inhibitors. hPEPT2 exhibited saturable Michaelis-Menten–type kinetic parameters for GlySar, corroborating previously reported values for KT and Jmax. Donor-to-donor variation of transport for different substrates did not correlate with hPepT2 haplotypes in this sample cohort. These findings demonstrate functional hPEPT2 transporter expression in primary cultures of human lung epithelial cells. hPEPT2-mediated transport could serve as a strategy for noninvasive systemic delivery of peptides and peptidomimetics drugs.

Key Words: peptide transport • genotype • polymorphism • drug transport


    Introduction
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Inhalation methods are commonly used to deliver medications directly to the lung with the intent to produce a localized therapeutic effect. This treatment strategy is convenient, efficient, and potentially cost-effective based on the relatively high drug concentrations that can be achieved. However, the potential to deliver medications via inhalation for systemic effect is currently limited and remains to be fully appreciated. Targeted drug delivery across the lung that takes advantage of endogenously expressed transport systems has great potential but is also limited by a relative lack of characterization. Based on the large surface area of the lung (70–140 m2) and relative ease of access to the systemic compartment, and avoidance of first-pass metabolism, one can readily envision the utilization of transporters in the lung as a preferred method for noninvasive systemic administration of medications.

Drug transport across the lung was originally thought to occur via simple passive diffusion; however, solute transporter proteins have recently been identified to play a major role in facilitating drug absorption (1). The lung epithelium lines the entire respiratory tract and constitutes the essential barrier that prevents passive diffusion and systemic absorption of medications. Therefore, the characterization and exploitation of endogenous transport systems expressed by the lung epithelium provides a viable opportunity to circumvent this physical barrier and achieve systemic delivery via targeted drug transport. The exact repertoire of transporter systems expressed in pulmonary tissue remains poorly characterized; however, consistent with other tissues such as the intestine and the kidney, it is likely that multiple transporters are expressed throughout the lung epithelium (2). For example, work in this area has identified that type II pneumocytes express transporter proteins including MRP1 (3), ATP-binding cassette transporter A1 (ABCA1) (4), antioxidant (glutathione) transporter (5), SGLT1 (6), and the cystic fibrosis transmembrane conductance regulator (CFTR) (7).

PepT2, a member of the solute carrier (SLC) family (SLC15A2), is a proton-dependent transporter that mediates the active translocation of peptides across epithelial tissues, including the lung. The natural substrates for PEPT2 include di- and tripeptides, and this transporter has relatively flexible molecular affinity requirements. As a result, PEPT2 transports a broad range of conventional therapeutic compounds that possess peptidomimetic features. Therefore, PEPT2 is a very attractive target for inhaled delivery strategies.

PEPT2 expression has been demonstrated in humans in situ in bronchial, bronchiolar, and alveolar type II epithelial cells as well as the endothelium of small vessels, thereby providing evidence to pursue this as an attractive platform for targeted drug delivery strategies. Recently, two primary genetic variants of the PEPT2 transporter protein with different kinetic profiles have been identified (8, 9), indicating that differences in drug transport may exist among individuals across the population. The implication is that if profound differences do exist, future therapeutic strategies that involve PEPT2 transport may require patient screening to optimize therapeutic outcome. Therefore, we conducted this investigation to provide a detailed characterization of PEPT2 expression and function in primary human airway epithelial cells from different donors. We report for the first time functional comparative studies performed with a diverse set of PEPT2 substrates and nonsubstrates to ascertain the activity and relative expression of PEPT2 transporter protein in different primary isolates of human lung epithelial cells. Isolates from six individual donor subjects were genotyped and we observed the three most prevalent haplotypes distributed in a predictable fashion among subjects. Differences in transport for selected classes of substrate existed between the different donors, but these differences could not be predicted as a function of patient haplotype alone. Future drug delivery strategies that use PepT2 may be applicable to the majority of patients and not restricted by patient genotype.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Materials
All reagents used for the study were of highest chemical purity available commercially. 3H-GlySar (4Ci/mmol) and 14C-mannitol (53 mCi/mmol) was purchased from Moravek Chemicals (Brea, CA). The inhibitors tested were purchased from Sigma Chemical Co. (St. Louis, MO). EZ link Sulfo-NHS-LC-Biotin (Succinimidyl-6-(biotinamido) hexanoate) for cell surface biotinylation was obtained from Pierce Biotechnology Inc. (Rockford, IL). Anti-PEPT2 antibody was a kind gift from Dr. David Smith, University of Michigan (Ann Arbor, MI). LLC-PK1 cells stably transfected with ratPepT2 was a kind gift from Dr. Ken-ichi Inui, Kyoto University, Kyoto, Japan.

Lung Cell Isolation and Cell Culture
Human donor lungs were collected with approval from The Ohio State University Institutional Review Board. Primary human lung epithelial cells (hLECs) were isolated from the trachea, bronchi, and bronchioles of adult donor lungs, seeded onto collagen-coated, semipermeable membranes (0.6 cm2; Millicell-HA, Millipore, Bedford, MA) and grown at an air–liquid interface as previously described (10, 11). Forty-eight to 96 h after seeding, the airway cells form a confluent culture with electrically tight junctions. Between Days 3 and 14, the epithelial cells differentiate into a predominantly ciliated phenotype (12). hLECs are maintained in a 1:1 mixture of Dulbecco's modified Eagle's medium (DMEM) and Ham's F12 media (DMEM/F12; Cellgro-Mediatech, Herndon, VA), supplemented with 2% Ultroser G (BioSepra; Villeneuve, La Garenne, France) and antibiotics at 37°C, and 5% CO2. Culture antibiotics used are penicillin (100 U/ml), streptomycin (100 µg/ml), gentamycin (50 µg/ml), fluconazole (2 µg/ml), and amphotericin-B (1.25 µg/ml). Medium is exchanged on a weekly basis. LLC-PK1 cells stably transfected with rat PepT2 (rPepT2-PK1) were used as control. rPepT2-PK1 cells were cultured in DMEM (Gibco, Carlsbad, CA) supplemented with 10% FBS, 250 U/ml penicillin-G, and streptomycin. Selection pressure on cells was maintained by using 1% genetecin (G-418) antibiotic.

Single Nucleotide Primer Extension Assay
Genomic DNA was isolated from hLEC according to the manufacturer's protocol (Genomic DNA Purification Kit; Gentra Systems, Minneapolis, MN). Total RNA was isolated using the RNeasy Mini Kit (Qiagen, Valencia, CA). A stretch of genomic DNA (~ 70 bp) was amplified by polymerase chain reaction (PCR). hPepT2 exon 14 amplification primer pairs: forward primer, AGGAAAATGGCTGTTGGTATGATC; reverse primer, CGCAACTGCAAATGCCAG. Standard PCR conditions were used on 15-µl reactions. Amplification conditions consisted of 35 cycles of denaturation at 95°C for 30 s, then primer annealing at 60°C for 1 min, followed by extension at 72°C for 1 min. After amplification, the reaction products were treated with exonuclease I and bacterial Antarctic alkaline phosphatase (New England Biolabs, Beverly, MA). For the primer extension, a gene-specific primer was designed with its 3'-end one base from the SNP position (hPepT2 exon 14 extension primer: GCTGTTGGTATGATCCTAGC). Single nucleotide primer extension (SNaPshot) reagent (Applied Biosystems, Foster City, CA) was used to incorporate a single fluorescently labeled dideoxynucleotide to the 3' end of the primer in a template-dependent manner. The final primer extension reactions were analyzed using an ABI 3730 (Applied Biosystems) capillary electrophoresis DNA instrument, and calculated with Gene Mapper 3.0 (ABI) software. The data for each incorporated fluorescently labeled nucleotide was measured as a peak area, which is directly proportional to the patient genotype. Homozygous samples exhibit a single labeled peak, whereas heterozygous samples exhibit two labeled peaks, each representative of a different allele. Samples that possess the nucleotide guanine (G) in the SNP exon 14 (at amino acid position 387) are designated allele "A," whereas samples with an adenosine (A) substituted at the same position are designated as allele "B" (*1 is the B allele and *2 is the A allele). Both alleles have previously been shown with similar frequency across the North American population (8).

Allele-Specific Analysis
The SNaPshot procedure described above is also used to quantify allele-specific mRNA. Genomic DNA, obtained from each patient at the same time of mRNA isolation, provides an internal control that we use to quantify RT-PCR products. Because different fluorophores modulate nucleotide incorporation and migration rates, the peak areas are typically not identical between two alleles present in equal abundance. Therefore, peak area ratios of genomic DNA obtained from each patient and present in equal amounts (ratio = 1) are used to normalize average genomic and cDNA ratios of heterozygous samples. The mRNA results are presented as the averages of five separate experiments and normalized to genomic DNA. Ratios are derived by dividing peak areas of each of the two alleles of hPepT2 (A/B). Deviations from unity in the normalized peak area ratios between alleles in the cDNA are attributed to differences in allele-specific mRNA levels.

Real-Time PCR
The mRNA levels of both PepT2 and ß-actin (control) were measured as cDNA and quantified with SyberGreen on an ABI 7000 thermal cycler (Applied Biosystems). For each sample, PepT2 cDNA was measured four times, ß-actin cDNA was measured three times, and cycle thresholds (CT) for each sample were averaged. Cycle thresholds represent the number of PCR cycles required for a sample to reach a concentration threshold, where a 1 CT difference is a 2-fold difference in concentration. PepT2 cDNA measurements were normalized to ß-actin for each sample by subtracting the average ß-actin CT from the average PepT2 CT, resulting in {Delta}CT. Relative mRNA levels, expressed as arbitrary units, were determined arithmetically by the following equation: Quantity = 2-{Delta}CT.

Cell Surface Biotinylation and Immunolocalization
Cell surface biotinylation was performed as described previously (9). Briefly, the apical surface of each donor culture was exposed to Sulfo-NHS-LC biotin followed by cell lysis. Cells on the inserts were dislodged by incubating at 37°C for 30 min with Cellstripper (Mediatech-Cellgro), collected using a cell scraper, and washed three to four times with D-PBS (pH 7.4). Biotinylated PEPT2 protein was immunoprecipitated with anti-PepT2 antibody and purified before resolving on a 10% Tris-HCl gel (Bio-Rad, Hercules, CA). rPepT2-PK1 cells were used as a positive control and treated identically. An equal amount of immunoprecipitant was loaded for each sample. The resolved proteins were then transferred to a PVDF membrane, and detected with horseradish peroxidase–conjugated streptavidin (Amersham Biosciences, Piscataway, NJ).

Randomization Schedule and Transport Analysis
After harvesting, primary cells from each individual were plated on ten separate Transwell inserts and labeled 1–10. During each series of transport experiments, a minimum of three inserts were assigned as control to study the uptake of 3H-GlySar in the absence of inhibitor, and the remaining seven inserts were designated for transport studies involving PEPT2 substrates. The data from each donor and each substrate were normalized with the matching control of the set of inserts (% control). The randomization schedule was designed to cover each individual insert as matching (day-to-day) control. After a transport assay was completed, inserts were reequilibrated for 4 d with daily medium change until radioisotope tracer levels were below 70 dpm. The procedure was repeated for all compounds in each donor culture. The set of 10 inserts for each individual donor was used not more than five times for inhibition studies. The transport data for the experiments was represented as mean ± SEM of all determinations.

All transport experiments were performed at 37°C. The inserts were washed three times and conditioned overnight with 400 µl sterile basal transport buffer (BL) (DMEM/F-12 w/o phenol red, 50:50 mix, pH 7.9; Cellgro-Mediatech). The inserts were then washed once with BL buffer and incubated with 200 µl sterile apical transport buffer (AP) (DMEM/F-12 w/o phenol red, 50:50 mix, pH 6.5) on apical side and 400 µl of BL buffer on basolateral side for 30 min. For competitive inhibition studies, the apical chamber received 200 µl mix of 100-fold excess inhibitor (12.5 µM) and radioactive tracers (3H-GlySar [0.5 µCi/ml; 0.125 µM] and 14C-mannitol [5 µl/ml, 53 mCi/mmol]). Samples (50 µl) were withdrawn from the BL chamber every 15 min over a 2-h period and BL buffer was replenished to maintain sink conditions. To calculate mass balance, a sample (20 µl) was withdrawn from the apical reservoir at 0 and 120 min. The net accumulation of 3H-GlySar in the receiver chamber was corrected for the volume of receiver chamber and plotted as a function of time. The apparent permeability was calculated using the steady-state rate constant (Eq. 1):

(1)
where Papp is the apparent permeability (cm/s), J the solute flux (dpm/min), A the effective growth area (cm2), and C0 the initial dosing concentration (dpm/ml).

Kinetic Studies
Concentration-dependent transport of 3H-GlySar was determined at various concentrations (0.01–10 mM) of unlabeled GlySar to determine Michaelis-Menten-type parameters KT and Jmax. At least three inserts per subject were prepared for the affinity assay in a similar manner as described above (Randomization Schedule and Transport Analysis). The apical chamber received 200 µl 0.01 mM unlabeled GlySar prepared in AP buffer (pH 6.5). The basolateral chamber received 400 µl 0.01 mM unlabeled GlySar prepared in BL buffer (pH 7.9). The plates were incubated for 30 min at 37°C. The apical side received a fixed volume of 3H-GlySar (3 µl) and 14C-mannitol (5 µl). Samples (50 µl) were withdrawn every 15 min for up to 60 min from the basolateral chamber, and the extracted volume was replaced with incubation buffer to maintain sink conditions. The procedure was repeated for each of the remaining seven concentrations. The Gly-Sar flux was expressed as pmol/cm2·min. The concentration-dependent transport of 3H-GlySar was fitted to the Michaelis-Menten-type transport equation using GraphPad (version 4.0) software:

(2)
where J represents the total rate of transport (pmol/cm2·min), Jmax is the maximum rate of transport for the transporter-mediated process (pmol/cm2·min), KT is the permeant concentration at half maximal rate (mM) and C is the permeant concentration (mM) (13). All other calculations and graphing was performed using Prism GraphPad (version 4.0) software (San Diego, CA).

Cell Monolayer Viability and Integrity
Cell monolayer viability was evaluated by transepithelial resistance measurements (TEER) and integrity was measured using permeability assays with the paracellular marker, 14C-mannitol (14). TEER values for each cell monolayer were measured using a EVOM-voltohmmeter and Endohm electrodes (World Precision Instruments, Sarasota, FL). The resistance was expressed as mean value k{Omega} · cm2 ±SEM of three determinations after correction for background (15, 16). 14C-mannitol was spiked in each of the transport assays and the Papp,mannitol for each individual insert was determined. Data are represented as mean value ±SE of all the inserts used per subject.

Statistical Analysis
Statistical significance was calculated using two-sample Student's t test and one-way ANOVA. Group means are compared for significant differences (P < 0.001, extremely significant; P < 0.01, very significant; and P < 0.05, significant) using one-way ANOVA with the Newman-Keuls multiple comparison test for post hoc pairwise comparison test (Prism; GraphPad Software, San Diego, CA).


    RESULTS
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Genotyping
Because the three nonsynonymous and two synonymous SNPs previously identified in the cDNA of hPepT2 are in near-complete linkage disequilibrium (8), measuring a single SNP allowed us to determine the two main haplotypes present in near-equal proportion in a previous study population. Six different human isolates of lung epithelium were genotyped at exon 14 with an expected equal occurrence of an A or G at this position. Genotype analysis revealed equal distribution of both alleles within donor subjects including two homozygous samples for each variant (designated AA or BB) as well as two heterozygous samples (designated AB) (Table 1). The heterozygous samples QA and QCX were subjected to allele-specific mRNA analysis to determine whether one allele was expressed more than the other. Sample QA did not have an allelic ratio that was significantly different from 1.0, suggesting that there is no difference in expression of the two alleles in those samples. Sample QCX, had an allelic mRNA ratio of 1.30 and expressed more A than B allele; however, the average (n = 5) A allele frequency is not significantly different from the B allele (n = 5; %A, 0.55 ± 0.09). Six subjects were thus classified into alleles AA (subject ID QCM and QCQ), AB (subject ID QA and QCX) and BB (subject ID QBB and QDM) (two subjects per allele) and were used to further study PepT2 transporter characteristics.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Lung sample genotype analysis

 
Real-time PCR analysis of hPepT2 cDNA relative to ß-actin reveals no significant difference in mRNA message between the individual donors (Table 2, Figure 1).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Real-time polymerase chain reaction of PEPT2 and ß-actin mrna*

 


View larger version (61K):
[in this window]
[in a new window]
 
Figure 1. (A) Gel electrophoresis of RT-PCR products. The top panel represents the PepT2 band, whereas the bottom panel visualizes ß-actin cDNA. Both cDNA bands run at their predicted sizes of less than 100 base-pairs. Lane 1, QCM; lane 2, QCQ; lane 3, QA; lane 4, QCX; lane 5, QBB; lane 6, QDM; lane 7, no template control. (B) Relative PepT2 mRNA levels normalized to ß-actin mRNA.

 
Cell Surface Biotinylation and Immunoblotting
Surface labeling of PEPT2 protein was performed using EZ link Sulfo-NHS-LC-Biotin, followed by immunoprecipitation with anti-PepT2 antibody and streptavidin blotting. rPepT2-PK1 cells were used as control in the biotinylation process. Consistent with levels of mRNA expression, we observed a very consistent level of PEPT2 protein expression on the apical surface of each donor sample. Densitometry analysis of PEPT2 for each specimen was normalized to ß-tubulin and confirmed similar levels of protein expression independent of allelic distribution (Figure 2).



View larger version (39K):
[in this window]
[in a new window]
 
Figure 2. (A) Cell surface biotinylation and Western blotting. The cells were surface biotinylated with EZ link Sulfo-NHS-LC Biotin. The proteins after immunoprecipitation were resolved on 10% acrylamide gel, immunoblotted with antiPEPT2 antibody. The control for the experiment was ratPepT2-transfected LLC-PK1 cell line (lane C). The subjects were grouped according to their genotypes: AA alleles (subject QCM, lane 1; subject QCQ, lane 2), AB alleles (subject QA, lane 3; subject QCX, lane 4), and BB alleles (subject QBB, lane 5; subject QDM, lane 6). ß-Tubulin was used as internal control. (B) For densitometry analysis, protein expression was compared against ß–tubulin expression, and revealed consistent expression of the transporter protein.

 
Transport Studies
A total of ten inserts were randomized as described in MATERIALS AND METHODS. The apparent permeability coefficients (Papp) of the paracellular marker, 14C-mannitol for each subject (Figure 3) was generally constant (data not shown). In addition, cell monolayer viability was determined by monitoring TEER (Figure 3). The TEER value for each insert ranged between 0.67 ± 0.03 and 1.43 ± 0.13 k{Omega}·cm2 and was indicative of restricted ion flux across the cell monolayers due to the formation of functional tight junctions. This was taken as further proof of the structural integrity and viability of the hLEC monolayer. Inserts were excluded from further analysis in strict observation of both the mannitol flux and TEER value criteria. Overall, a minimum of 8 to a maximum of 10 inserts per subject was used for transport assays.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. Comparison of TEER values (open bars) and Papp values (solid bars) among the different study subjects. Values are represented as means ± SEM of all determinations (n = 10).

 
Inhibition potencies of different compounds grouped into dipeptides, penicillins, cephalosporins, ACE inhibitors, and bestatin were determined to assess the substrate specificities of the peptide transporter expressed in hLECs (Figure 4). Of the compounds tested, Gly-Sar, a prototypical substrate of the peptide transporter, revealed statistically significant inhibition of transporter function (P < 0.05) in almost all haplotypes with the exception of subject QA (haplotype AB) and subject QDM (haplotype BB). Another dipeptide (Gly-Leu), however, revealed insignificant inhibition of PEPT2-mediated 3H-GlySar transport activity irrespective of the genotype. Of the penicillin derivatives tested, ampicillin showed a significant inhibitory response in alleles AA and AB but failed to elicit any effect on the transporter activity in allele BB. Surprisingly, subject QDM (haplotype BB) 3H-GlySar transport was significantly inhibited in the presence of amoxicillin, but this compound only modestly affected haplotypes AA and AB (<= 10% inhibition). Overall, the cephalosporin-mediated inhibition of PEPT2 transport activity was less potent compared with penicillins. In general, cefaclor exerted a greater effect on PEPT2-mediated 3H-GlySar transport than cefadroxil, but the effect was variable from subject to subject. These results suggest that the transporter is preferentially responsive to the ß-lactam antibiotics, i.e., penicillins and cephalosporins. As expected, the ACE inhibitors (captopril and enalapril) and bestatin did not significantly affect substrate transport across all haplotypes evaluated. This is in accordance with previous reports that suggest ACE inhibitors are not true substrates for PEPT2 (17).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 4. Comparison of transport inhibition potencies of different substrates amongst different alleles. (A) Allele AA (subjects QCM and QCQ); (B) Allele AB (subjects QA and QCX); (C) Allele BB (subjects QBB and QDM).

 
Affinity Studies
Further characterization PEPT2 function was performed by kinetic assessment of transporter activity in the presence of increasing concentrations of Gly-Sar. Three inserts from one representative of the three haplotype populations were analyzed (i.e., QCQ from haplotype AA, QCX from haplotype AB, and QBB from haplotype BB). 3H-GlySar flux data (J) were fitted to the general expression for transporter kinetics (Eq. 2) (Figure 5). Nonlinear regression analysis identified an active transport system in all haplotypes studied (Table 3). Subject QCX (allele AB) had the highest affinity toward Gly-Sar and was significantly different amongst the subjects tested. Subjects QCQ (allele AA) and QBB (allele BB) have highly similar KT and Jmax values (P > 0.05). For subject QCX, the significantly lower Jmax value indicates that transporter capacity is reduced. Interestingly, the relative protein expression of PEPT2 (Figure 2) is identical in all three subjects, suggesting that changes in kinetic data may be due to haplotype-specific effects on protein function. Our data are not consistent with those reported by Pinsonneault and colleagues (8), who found distinctly higher KT values for haplotype AA with respect to BB, but did not report on AB.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 5. Concentration dependent transport of Gly-Sar across hLEC monolayers. One representative member from each haplotype was selected for the determination of kinetic transport parameters (QCQ, squares; QCX, circles; QBB, triangles). The goodness of fit (r2) was calculated with respect to Equation 2, and the average for all curves was 0.83 ± 0.07. All values are mean ± SEM of all determinations.

 

View this table:
[in this window]
[in a new window]
 
TABLE 3. Comparison of michaelis-menten–type affinity parameters across different allelic variants

 

    DISCUSSION
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
This study was conducted to investigate the functional expression of the small peptide transporter, PEPT2, in primary human lung epithelial cell monolayers obtained from multiple human donors. Characterization of PEPT2 expression and function in the human lung is of considerable interest to the field of pharmaceutics and pulmonary drug delivery. This is clinically relevant because many current and future medications are peptides or peptidomimetics, and are therefore potential substrates for transporter-mediated uptake. For example, in case of bacterial pneumonia the PEPT2 transporter system can be targeted for the pulmonary delivery of antibiotics. Aerosolized formulations of this class of therapeutics help deposition at the site of infection and allow the achievement of therapeutic concentration levels. The application has been discussed in detail in a recent review by Groneberg and colleagues (18). Furthermore, antiviral and antineoplastic drugs such as valganciclovir and bestatin, both substrates for hPEPT2, can be targeted to this transporter in the treatment of viral pneumonia or pulmonary carcinoma, respectively (19, 20). In addition, genetic variability exists within the PepT2 coding region, and experimental models have demonstrated that polymorphisms may alter PEPT2 transport function (8). Currently there exists no information regarding the interindividual variation of PEPT2 transporter expression and function in the human lung epithelium, the critical barrier that medications must transit for systemic absorption. In the present study, we report for the first time the genotype and functional expression of PepT2 in multiple human subjects.

We previously demonstrated that the PepT2 gene has a > 6-kb sequence block with at least 10 abundant polymorphisms in almost complete linkage disequilibrium. As a result, only two main PepT2 variants exist, designated PepT2*1 (B) or PepT2*2 (A), with several phased amino acid substitutions, present in similar frequencies in all ethnic groups. Both of the haplotype variants are distributed roughly equally in the general population at ~ 44–47%. Using an experimental overexpression model for both variants, we observed alteration of biochemical function, suggesting that differences in transport function may exist across the population. We also observed that functional differences may occur as a consequence of translational processing and differences in mRNA levels. Based on these previous observations we conducted haplotype analysis on primary lung cells isolated from six donor subjects. This revealed an expected haplotype distribution among subjects designated as QCM and QCQ homozygous for allele A, subjects QA and QCX heterozygous for allele A and B, and subjects QBB and QDM homozygous for allele B. Thus, all haplotype variants were equally represented in our study. To ensure a nonbiased approach during functional characterization, samples were coded and genotype designation was withheld from the study until transport and protein expression data analysis was complete.

We confirmed surface expression of PEPT2 protein levels using cell surface biotinylation. The biotinylation process followed by Western analysis revealed a prominent band at 104 kD in all subjects tested (Figure 2A). A band of identical molecular weight was detected in rPepT2-PK1 control cells. Densitometry analysis (Figure 2B) revealed the consistent expression of the transporter protein on the apical surface under normal culture conditions in all subjects. There was no appreciable quantitative difference in PEPT2 protein expression between the six individual donor subjects. This corroborates results obtained from quantitative RT-PCR analysis. Although our sample size is small, these results suggest that of the single nucleotide polymorphisms (SNPs) that constitute both variants, differences in transport function are not the result of substantial differences secondary to translational or post-translational processing of PEPT2. Therefore, measurable differences in PEPT2 may likely be the result of nonsynonymous SNPs that confer changes in protein transport function at the cell surface.

Posthaplotype analysis was conducted to compare transport function among the major allelic variants that exist in humans. To simplify data analysis, compounds were distributed in therapeutic classes, i.e., penicillins (ampicillin and amoxicillin), cephalosporins (cefaclor and cefadroxil), ACE inhibitors (captopril and enalapril), and bestatin. Although statistical differences between haplotype variants and different drug class were not observed, we noted an overall trend in the inhibitory potency of the compounds under study between the three haplotypes in the following order: AA > AB > BB. We believe that differences in the inhibition patterns are likely attributed to differential affinity of the compounds tested toward the transporter. It should be noted, however, that we cannot rule out the influence of additional, low prevalence SNPs in our samples that may contribute to the observed variability in our data. Overall, in our experimental conditions the homozygous AA cultures, possessed the highest inhibitory capacity for Gly-Sar, ampicillin, and cefadroxil when compared with both the BB homozygous and AB heterozygous cultures. For the heterozygous allele AB, ampicillin demonstrated maximum inhibition of 3H-Gly-Sar transport. In normal and cystic fibrosis lung samples, Groneberg and colleagues showed that cefadroxil had the highest affinity for PEPT2 among a panel of tested substrates (21). This was consistent with data in rat PepT2-transfected LLC-PK1 cells (22). Captopril and enalapril have been demonstrated to be very low- or no-affinity substrates for the PEPT2 transporter (17, 21, 23), and our data are in good agreement with these findings.

It should be noted that PEPT2 is a proton-dependent co-transporter and that changes in microenvironmental pH may affect transporter function. In our study, the contribution of pH on transport activity was minimized by maintaining a constant pH of 6.5. Previous studies with CHO cells expressing protein variant hPepT2*1 (BB) and hPepT2*2 (AA) have shown no significant differences in Gly-Sar transport at pH 6.5, whereas studies performed at pH 6.0 show significant differences in transporter activity (8). The Michaelis-Menten type kinetic parameters strengthen the fact that hLECs express high-affinity, low-capacity transporter PEPT2. The Jmax values for the AA and BB haplotype transporter variants expressed in hLECs correlated well with those transfected in CHO cells (8). We do observe significant differences in KT values, however, and these may be attributed to the intrinsic discrepancies between a complex primary cell system (hLECs) when compared with a cell line overexpressing a single transporter species.

In summary, we report for the first time, the functional expression of the high-affinity peptide transporter, PEPT2 in primary human lung cells obtained from multiple donor subjects. Based on our results from this relatively small sample size, we conclude that the genetic variability of PEPT2 transporter function and expression in the general population does not significantly affect substrate recognition. Thus, the genetic variability that exists across the population in PepT2 does not appear to be a major obstacle in the successful delivery of peptides and peptidomimetics to the human lung. In fact, our findings suggest that PEPT2 expression and function is relatively stable, at least in the upper airway, thereby further substantiating the role of PEPT2 as an important target in future drug delivery strategies. We intend to conduct additional studies with primary human alveolar lung epithelial cells to verify the prospect of targeted transport across the entire respiratory tract. We believe this investigation has significant implications in the design of aerosolized drug formulations and the pharmacokinetics and pharmacodynamics of drug absorption across the lung epithelium.


    Acknowledgments
 
The authors acknowledge Dr. David E. Smith (University of Michigan, Ann Arbor, MI) for the kind donation of PEPT2 antisera and Dr. Ken-ichi Inui (Kyoto University, Kyoto, Japan) for his kind gift of the stably transfected LLC-PK1 rat-PepT2 cell line.


    Footnotes
 
Conflict of Interest Statement: P.M.B. has no declared conflicts of interest; V.M.D. has no declared conflicts of interest; J.K.P. has no declared conflicts of interest; W.S. has no declared conflicts of interest; S.B. has no declared conflicts of interest; D.L.K. has been reimbursed (approximately $3,000) by Merck, Sharpe, and Dohme for participating in scientific forums supported by the company, and he serves as a speaker/advisor for Genentech, for which he received approximately $15,000 in speaker honoraria during 2003–2004; and P.W.S. has no declared conflicts of interest.

Received in original form October 8, 2004

Received in final form December 7, 2004


    References
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 

  1. Zhang EY, Knipp GT, Ekins S, Swaan PW. Structural biology and function of solute transporters: implications for identifying and designing substrates. Drug Metab Rev 2002;34:709–750.[CrossRef][Medline]
  2. Smith PL. Peptide delivery via pulmonary route: a valid approach for local and systemic delivery. J Control Release 1997;46:99–106.[CrossRef]
  3. Lehmann T, Kohler C, Weidauer E, Taege C, Foth H. Expression of MRP1 and related transporters in human lung cells in culture. Toxicology 2001;167:59–72.[CrossRef][Medline]
  4. Bortnick AE, Favari E, Tao JQ, Francone OL, Reilly M, Zhang Y, Rothblat GH, Bates SR. Identification and characterization of rodent ABCA1 in isolated type II pneumocytes. Am J Physiol Lung Cell Mol Physiol 2003;285:L869–L878.[Abstract/Free Full Text]
  5. Bai C, Brown LA, Jones DP. Glutathione transport by type II cells in perfused rat lung. Am J Physiol 1994;267:L447–L455.
  6. Devaskar SU, deMello DE. Cell-specific localization of glucose transporter proteins in mammalian lung. J Clin Endocrinol Metab 1996;81:4373–4378.[Abstract]
  7. Cozens AL, Yezzi MJ, Kunzelmann K, Ohrui T, Chin L, Eng K, Finkbeiner WE, Widdicombe JH, Gruenert DC. CFTR expression and chloride secretion in polarized immortal human bronchial epithelial cells. Am J Respir Cell Mol Biol 1994;10:38–47.[Abstract]
  8. Pinsonneault JK, Nielsen CU, Sadee W. Genetic variants of the human H+/dipeptide transporter PEPT2: analysis of haplotype functions. J Pharmacol Exp Ther 2004;311:1088–1096.[Abstract/Free Full Text]
  9. Zhang EY, Phelps MA, Banerjee A, Khantwal CM, Chang C, Helsper F, Swaan PW. Topology scanning and putative three-dimensional structure of the extracellular binding domains of the apical sodium-dependent bile acid transporter (SLC10A2). Biochemistry 2004;43:11380–11392.[CrossRef][Medline]
  10. Smith JJ, Travis SM, Greenberg EP, Welsh MJ. Cystic fibrosis airway epithelia fail to kill bacteria because of abnormal airway surface fluid. Cell 1996;85:229–236.[CrossRef][Medline]
  11. Yamaya M, Finkbeiner WE, Chun SY, Widdicombe JH. Differentiated structure and function of cultures from human tracheal epithelium. Am J Physiol 1992;262:L713–L724.
  12. Karp PH, Moninger TO, Weber SP, Nesselhauf TS, Launspach JL, Zabner J, Welsh MJ. An in vitro model of differentiated human airway epithelia: methods for establishing primary cultures. Methods Mol Biol 2002;188:115–137.[Medline]
  13. Von Winkle L. Transport kinetics. In: Von Winkle L, editor. Biomembrane transport. San Diego, CA: Academic Press; 1995. pp. 65–132.
  14. Ranaldi G, Islam K, Sambuy Y. Epithelial cells in culture as a model for the intestinal transport of antimicrobial agents. Antimicrob Agents Chemother 1992;36:1374–1381.[Abstract/Free Full Text]
  15. Mathia NR, Timoszyk J, Stetsko PI, Megill JR, Smith RL, Wall DA. Permeability characteristics of calu-3 human bronchial epithelial cells: in vitro-in vivo correlation to predict lung absorption in rats. J Drug Target 2002;10:31–40.[CrossRef][Medline]
  16. Yoo JW, Kim YS, Lee SH, Lee MK, Roh HJ, Jhun BH, Lee CH, Kim DD. Serially passaged human nasal epithelial cell monolayer for in vitro drug transport studies. Pharm Res 2003;20:1690–1696.[CrossRef][Medline]
  17. Zhu T, Chen XZ, Steel A, Hediger MA, Smith DE. Differential recognition of ACE inhibitors in Xenopus laevis oocytes expressing rat PEPT1 and PEPT2. Pharm Res 2000;17:526–532.[CrossRef][Medline]
  18. Groneberg DA, Fisher A, Fan Chung K, Daniel H. Molecular mechanisms of pulmonary peptidomimetic drug and peptide transport. Am J Respir Cell Mol Biol 2004;30:251–260.[Abstract/Free Full Text]
  19. Gonzalez DE, Covitz KM, Sadee W, Mrsny RJ. An oligopeptide transporter is expressed at high levels in the pancreatic carcinoma cell lines AsPc-1 and Capan-2. Cancer Res 1998;58:519–525.[Abstract/Free Full Text]
  20. Sugawara M, Huang W, Fei YJ, Leibach FH, Ganapathy V, Ganapathy ME. Transport of valganciclovir, a ganciclovir prodrug, via peptide transporters PEPT1 and PEPT2. J Pharm Sci 2000;89:781–789.[CrossRef][Medline]
  21. Groneberg DA, Eynott PR, Doring F, Thai Dinh Q, Oates T, Barnes PJ, Chung KF, Daniel H, Fischer A. Distribution and function of the peptide transporter PEPT2 in normal and cystic fibrosis human lung. Thorax 2002;57:55–60.[Abstract/Free Full Text]
  22. Terada T, Saito H, Mukai M, Inui K. Recognition of beta-lactam antibiotics by rat peptide transporters, PEPT1 and PEPT2, in LLC-PK1 cells. Am J Physiol 1997;273:F706–F711.
  23. Boll M, Herget M, Wagener M, Weber WM, Markovich D, Biber J, Clauss W, Murer H, Daniel H. Expression cloning and functional characterization of the kidney cortex high-affinity proton-coupled peptide transporter. Proc. Natl. Acad. Sci. USA 1996;93:284–289.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J Clin PharmacolHome page
D. R. Foster, S. Yee, B. E. Bleske, P. L. Carver, M. J. Shea, S. S. Menon, C. Ramachandran, L. S. Welage, and G. L. Amidon
Lack of Interaction Between the Peptidomimetic Substrates Captopril and Cephradine
J. Clin. Pharmacol., March 1, 2009; 49(3): 360 - 367.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
S. V. Dhuria, L. R. Hanson, and W. H. Frey II
Novel Vasoconstrictor Formulation to Enhance Intranasal Targeting of Neuropeptide Therapeutics to the Central Nervous System
J. Pharmacol. Exp. Ther., January 1, 2009; 328(1): 312 - 320.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
P. W. Swaan, T. Bensman, P. M. Bahadduri, M. W. Hall, A. Sarkar, S. Bao, C. M. Khantwal, S. Ekins, and D. L. Knoell
Bacterial Peptide Recognition and Immune Activation Facilitated by Human Peptide Transporter PEPT2
Am. J. Respir. Cell Mol. Biol., November 1, 2008; 39(5): 536 - 542.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Sala-Rabanal, D. D. F. Loo, B. A. Hirayama, and E. M. Wright
Molecular mechanism of dipeptide and drug transport by the human renal H+/oligopeptide cotransporter hPEPT2
Am J Physiol Renal Physiol, June 1, 2008; 294(6): F1422 - F1432.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Bao and D. L. Knoell
Zinc modulates cytokine-induced lung epithelial cell barrier permeability
Am J Physiol Lung Cell Mol Physiol, December 1, 2006; 291(6): L1132 - L1141.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Bao and D. L. Knoell
Zinc modulates airway epithelium susceptibility to death receptor-mediated apoptosis
Am J Physiol Lung Cell Mol Physiol, March 1, 2006; 290(3): L433 - L441.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-0322OCv1
32/4/319    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bahadduri, P. M.
Right arrow Articles by Swaan, P. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bahadduri, P. M.
Right arrow Articles by Swaan, P. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2005 American Thoracic Society.