help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Published ahead of print on April 28, 2005, doi:10.1165/rcmb.2004-0347OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supplement
Right arrow All Versions of this Article:
2004-0347OCv1
33/2/178    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Demoule, A.
Right arrow Articles by Petrof, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Demoule, A.
Right arrow Articles by Petrof, B. J.
American Journal of Respiratory Cell and Molecular Biology. Vol. 33, pp. 178-185, 2005
© 2005 American Thoracic Society
DOI: 10.1165/rcmb.2004-0347OC

Expression and Regulation of CC Class Chemokines in the Dystrophic (mdx) Diaphragm

Alexandre Demoule, Maziar Divangahi, Gawiyou Danialou, Dusanka Gvozdic, Gary Larkin, Weisheng Bao and Basil J. Petrof

Meakins-Christie Laboratories, McGill University, Montreal; and Respiratory Division, McGill University Health Centre, Montreal, Quebec, Canada

Correspondence and requests for reprints should be addressed to Basil J. Petrof, M.D., Respiratory Division, Room L411, Royal Victoria Hospital, 687 Pine Ave. West, Montreal, H3A 1A1, PQ Canada. E-mail: basil.petrof{at}mcgill.ca


   Abstract
Top
 Abstract
Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
In the murine (mdx) model of Duchenne muscular dystrophy, dystrophic changes are much more severe in the diaphragm than in limb muscles, and the diaphragm more closely resembles the human disease phenotype. Chemokines could play a central role in governing such phenotypic differences, as inflammation is an important disease modifier. Here we report that CC chemokine receptors (CCRs 1, 2, 3, 5) and ligands (macrophage inflammatory protein-1{alpha}, RANTES) are expressed at higher levels in dystrophic than in wild-type muscles across age groups (6, 12, and 24 wk). Moreover, chemokine ligand expression and muscle inflammation are significantly higher in dystrophic diaphragms than in limb muscles of the same animals. In vitro, CCR1 is constitutively expressed by cultured primary diaphragmatic myotubes. Stimulation of myotubes by proinflammatory cytokines (tumor necrosis factor-{alpha}, interleukin-1{alpha}, interferon-{gamma}) found within the in vivo dystrophic muscle environment, upregulates CCR1 in mdx and wild-type cultures, and also increases expression of its ligand RANTES to a significantly greater degree in the mdx group. Taken together, our results suggest that CC chemokines may play an important role in sustaining inflammation within the mdx diaphragm, which could help acount for its more severe phenotype and also offer a target for therapeutic intervention in Duchenne patients.

Key Words: chemokine receptors • Duchenne muscular dystrophy • inflammation • macrophage inflammatory protein-1{alpha} • RANTES • skeletal muscle


   Introduction
Top
 Abstract
 Introduction
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Duchenne muscular dystrophy (DMD) is caused by genetic defects leading to the absence of dystrophin, a 427-kD cytoskeletal protein found at the inner surface of the skeletal muscle surface membrane, or sarcolemma (1). Binding between dystrophin and its associated glycoprotein complex allows the intracellular cytoskeleton to be linked to laminin-2 molcules in the extracellular matrix. This confers important structural and signal transduction properties to the muscle fiber, the absence of which predisposes to muscle fiber necrosis (2, 3). The diaphragm and other respiratory muscles are also subject to this fate, and most patients with DMD die of respiratory muscle failure in early adulthood unless supported by mechanical ventilation.

It is important to recognize that muscle fiber necrosis is not an inevitable consequence of dystrophin deficiency. For example, the extraocular muscles of patients with DMD do not suffer this fate (4). Furthermore, in the naturally occurring murine model of DMD (the mdx mouse, which also lacks dystrophin), the limb muscles undergo an early phase of necrosis that then subsides, with relatively little necrosis or fiber loss thereafter until the late stages of life (5). In contrast, the mdx diaphragm is severely affected from an early age, and closely resembles the human phenotype with respect to fiber loss, fibrosis, and weakness (5). Therefore, it is clear that dystrophin deficiency is necessary, but not sufficient on its own, to fully account for the pathophysiology of DMD. Accordingly, secondary modifiers must play an important role in determining the ultimate fate of dystrophin-deficient fibers, and may also represent a useful target for therapeutic intervention. Among potential disease-modifying factors, one likely candidate is the inflammatory response within the diseased muscle (6–8).

The inflammatory cell infiltrate that characterizes a given disease is orchestrated in large part by chemokines expressed in the diseased tissue (9, 10). Chemokines are a large family of small molecular weight cytokines, which have been broadly divided into CC, CXC, C, and CX3C subgroups on the basis of the positioning of amino acids relative to the first two conserved cysteine residues (9, 10). The chemokines are diffusible molecules, which exert their biological effects by binding to G protein–coupled receptors (11). Recent studies using gene microarrays have demonstrated that dystrophic muscles are characterized by an inflammatory "molecular signature" (12, 13), in which CC chemokines are prominent (14, 15). In a similar fashion, CC chemokines are greatly upregulated in normal skeletal muscles after experimental injury (16).

The diaphragm and limb musculature of mdx mice both suffer from the same basic underlying genetic defect (i.e., lack of dystrophin), yet only the diaphragm demonstrates the severe weakness and fibrosis that is characteristically found in human DMD muscles. Therefore, insights into disease pathogenesis may be gained by comparing potential disease-modifying factors in the two types of muscle. In the present investigation, our primary hypothesis was that expression of CC chemokine receptors and their ligands would be higher in the more severely diseased dystrophic diaphragm than in dystrophic limb muscles. We also wished to determine if this would be associated with greater levels of inflammation in the diaphragm, and whether CC chemokine receptor/ligand expression and attendant inflammation would undergo modifications during the course of disease progression. Finally, we hypothesized that dystrophic diaphragmatic muscle cells might have an inherently greater propensity to upregulate CC chemokine receptors and/or their ligands when exposed to other proinflammatory cytokines found within the dystrophic diaphragm muscle microenvironment. Some of these data have been previously reported in the form of an abstract (17).


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 References
 
Animals
All animal procedures were approved by the institutional animal care and ethics committee, in accordance with the guidelines issued by the Canadian Council on Animal Care. Male wild-type (WT; C57BL/10ScSn) and dystrophic (mdx) mice were obtained from The Jackson Laboratories (Bar Harbor, ME). The mice were anesthetized with a mixture of ketamine (130 mg/kg) and xylazine (20 mg/kg) for killing at Postnatal Weeks 6, 12, and 24. Diaphragm and tibialis anterior (TA) muscles were removed bilaterally at the time of killing. For RNA extraction, the muscles were flash-frozen in liquid nitrogen. To perform histologic analysis, muscles were put into an embedding medium (Cryomatrix; Thermo Shandon, Pittsburg, PA) and quickly frozen in 2-methylbutane (Fisher, Fairlawn, NJ) before freezing in liquid nitrogen. All tissues were stored at –80°C.

Primary Cell Culture
Primary diaphragmatic muscle cell cultures were established essentially as described by Rosenblatt and coworkers (18), using single living muscle fibers to isolate adult myoblast precursors (also known as satellite cells). Briefly, excised diaphragm muscle strips from 6-wk-old WT and mdx mice were subjected to collagenase digestion (0.2% collagenase at 37°C for 60 min), followed by trituration with heat-polished Pasteur pipettes of decreasing bore size to liberate individual fibers. The individual fibers were washed in Dulbecco's modified Eagle's medium (DMEM) and phosphate-buffered saline, collected, and then transferred into Matrigel (Becton Dickinson, Franklin Lakes, NJ)-coated (1 mg/ml in DMEM) 6-well plates. All culture media contained 1% penicillin/streptomycin and 0.2% amphotericin B (Invitrogen, Carlsbad, CA). The cultures were maintained in DMEM with 10% horse serum and 0.5% chick embryo extract (MP Biomedicals, Aurora, OH) for 4 d, during which time myoblasts attached to the substratum. Diaphragmatic myoblasts were then expanded in growth medium (20% fetal bovine serum, 10% horse serum, 1% chick embryo extract in DMEM) until attaining ~ 75% confluence. At this point, the cultures were placed in differentiation medium (2% fetal bovine serum, 10% horse serum, 0.5% chick embryo extract in DMEM) to induce myoblast fusion into differentiated myotubes. All experiments were performed on the fifth day of maintenance in differentiation medium. Diaphragmatic myotubes were washed with DMEM before cytokine stimulation, which consisted of combined exposure to tumor necrosis factor (TNF)-{alpha} (1 ng/ml), interleukin (IL)-1{alpha} (5 U/ml), and interferon (IFN)-{gamma} (20 U/ml; R&D Systems, Mineapolis, MN) for 4 h.

RNase Protection Assay
Total RNA from tissues and cultures was extracted using TRIzol reagent (Invitrogen) according to the manufacturer's protocol. Twenty micrograms of RNA from tissues and 5 µg of RNA from cell cultures were used for each assay. Riboprobes were synthesized using T7 RNA polymerase and [32P]CTP (Amersham Biosciences, Piscataway, NJ), from two different mouse multiprobe sets (Riboquant; BD Pharmingen, San Diego, CA) containing templates for CC chemokine receptors and ligands. More specifically, expression levels of the following were studied: CCR1, CCR2, CCR3, CCR4, CCR5, macrophage inflammatory protein (MIP)-1{alpha}/CCL3, and regulated upon activation normal T cell expressed and secreted (RANTES)/CCL5. The [32P]-labeled riboprobes were hybridized with RNA samples overnight at 56°C and processed using the manufacturer's protocol. Protected RNA fragments were separated using a 5% acrylamide gel and analyzed by autoradiography (Kodak, Rochester, NY). The bands representing mRNA levels were quantified using an image analysis system (FluorChem; Alpha Innotech, San Leandro, CA), and the signals were normalized to the L32 housekeeping gene as a loading control. All values are expressed in arbitrary units.

Reverse Transcription–Polymerase Chain Reaction
Total RNA (2 µg) obtained from tissues or cultured cells was reverse transcribed using M-MLV reverse transcriptase (RT) and random primers (Promega, Madison, WI). Polymerase chain reaction (PCR) amplification of the resulting cDNA was performed for 35 cycles at 94°C for 45 s, 50–56°C for 45 s, and 2°C for 1 min. The following primers were used (5' to 3'): CAGAAGCCTACCCCACAACTAC (CCR1 sense), AATCAGAAGCCAGCAGAGAG (CCR1 antisense); CAATAATATGTTACCTCAGTTC (CCR2 sense), CATGACCCAAAGTAAGAACCAC (CCR2 antisense); GATTTTCAAGGGTCAGTTCC (CCR5 sense), CCAGTAGAAACTTCATGTTC (CCR5 antisense). The PCR products were electrophoresed on 1% agarose gels containing ethidium bromide for visualization.

Enzyme-Linked Immunosorbent Assay
An enzyme-linked immunosorbent assay (ELISA) kit for murine RANTES was purchased from R&D Systems, and assays were performed in duplicate on total protein samples extracted from individual muscles, in accordance with the manufacturer's instructions.

Morphometric Analysis and Immunostaining
Five cryosections (10 µm thick) from each muscle were obtained for hematoxylin and eosin staining. Randomly selected microscopic fields from each tissue section were then photographed using a digital camera, and the image was stored on a computer. To quantify the magnitude of inflammation, a standard point-counting technique was employed, and the area fraction of inflammation was determined as previously described (19). Briefly, a 100-point grid was superimposed onto each captured image using a stereology software package (Image-Pro Plus; Media Cybernetics, Silver Springs, MD). An abnormal point was defined as either falling upon an inflammatory cell or a myofiber invaded by such cells. The area fraction of inflammation was calculated by dividing the number of abnormal points by the total number of points falling on the tissue section. All values are expressed as a percentage. In a smaller number of mice, the same approach was combined with immunohistochemistry to identify and quantify different inflammatory cell subsets present within the muscle tissues. Cryosections were fixed in acetone and reacted with primary antibodies directed against macrophages (F4/80; Abcam Ltd., Cambridge, MA), CD4+ T lymphocytes (L3T4; BD Pharmingen), and CD8+ T lymphocytes (Ly 2; Cedarlane, Hornby, ON, Canada). This was followed by addition of the appropriate biotinylated secondary antibodies and detection using the Vectastain Elite ABC kit (Vector Laboratories, Burlingame, CA). Immunostaining for CCR1 was performed using a rabbit polyclonal antibody (Novus Biologicals, Littleton, CO), followed by reaction with a Cy3-conjugated secondary antibody.

Statistical Analysis
All data are expressed as group mean values ± SE. For in vivo data, muscles from four to six independent mice were used for each experimental condition. For in vitro data, six independent replicate analyses were performed for each experimental condition. Statistics were performed using a commercial software package (SigmaStat; SPSS, Chicago, IL). Within the same mouse strain (WT or mdx), values obtained for diaphragm and TA were compared using the Wilcoxon Signed Rank test. For the same type of muscle (diaphragm or TA), values obtained in the WT and mdx groups were compared using the Mann-Whitney Rank Sum test. Statistical significance was set at P < 0.05.


   RESULTS
Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 References
 
Expression of CC Chemokine Receptors
To determine whether expression levels of CC class chemokine receptors (CCRs) differ between mdx diaphragm and other muscles in vivo, total RNA extracted from mdx and WT muscle tissues was analyzed by RNase protection assay for the three age groups. The RNase protection probe panel was directed against CCRs 1–5, and representative data from the oldest age group (24 wk) are shown in Figure 1. As can be seen, CCRs 1, 2, 3, and 5 were expressed at the mRNA level by both diaphragm and TA muscles in vivo. In general, the expression levels of all receptors were significantly higher in the dystrophic group, but with no statistically significant differences between mdx diaphragm and TA. A similar pattern was also observed for the other age groups examined (see online supplement).



View larger version (52K):
[in this window]
[in a new window]
  		Figure 1. Upregulation of multiple chemokine receptor mRNAs in dystrophic muscles in vivo. A representative autoradiograph of RNase protection analysis for CC chemokine receptors at 24 wk of age in BL10 WT and mdx mice is demonstrated in A, whereas group mean values for the same data are shown in B. Expression levels were significantly higher in the dystrophic group for both diaphragm and TA (tibialis anterior). All data were normalized to L32 to control for loading across lanes. Open bars, TA; filled bars, diaphragm. {dagger}P < 0.05 for WT versus mdx within the same type of muscle (diaphragm or TA).

 
Chemokine receptor expression in vivo could arise from nonmuscle cell types (e.g., inflammatory cells infiltrating the muscles), or from the muscle fibers themselves. To ascertain whether CCRs can be expressed by muscle cells per se, RT-PCR was employed to evaluate expression levels of CCRs 1, 2, and 5 by cultured diaphragm muscle cells in vitro. Only CCR1 mRNA expression was found to be present in differentiated myotubes derived from mdx and WT diaphragms (Figure 2A). To determine whether CCR1 is also expressed by muscle fibers in vivo, immunostaining with anti-CCR1 antibody was performed (Figure 2B). There was strong immunoreactivity against CCR1 in many mdx fibers, whereas staining was weak to absent in muscle fibers of age-matched WT mice. In addition, CCR1 immunoreactivity was observed in inflammatory cells present within the mdx muscles.



View larger version (42K):
[in this window]
[in a new window]
  		Figure 2. Expression of CCR1 by muscle cells. (A) RT-PCR revealed the presence of CCR1 transcripts in cultured myotubes derived from both WT and mdx diaphragms. The positive control (+) consists of the RT-PCR product obtained from the dystrophic diaphragm in vivo. (B) In intact muscles, immunostaining with anti-CCR1 antibody revealed little or no staining of WT muscle fibers. In contrast, many mdx muscle fibers showed intense immunoreactivity (asterisk), and infiltrating inflammatory cells were also stained in dystrophic muscles (arrow).

 
Expression of CC Chemokine Ligands and Muscle Inflammation
Because RANTES and MIP-1{alpha} are primary ligands for CCR1, and also serve as chemoattractants for leukocyte populations that are typically found in dystrophic muscles (6), we measured mRNA levels of these two chemokines across age groups in the diaphragm and TA muscles. Figure 3A shows findings at 24 wk of age, at which time both chemokines were significantly upregulated at the mRNA level in mdx muscles as compared with WT controls. Furthermore, for all age groups studied (see Figure 3B), there was significantly greater RANTES mRNA expression in the mdx diaphragm than in the mdx TA. Greater MIP-1{alpha} mRNA expression was similarly observed in the dystrophic diaphragm at the earlier time points examined. To determine whether differences in mRNA expression were also reflected at the protein level, ELISA was performed to quantify RANTES in the diaphragm and TA muscles at 6, 12, and 24 wk of age. As shown in Figure 4A, RANTES protein levels were significantly elevated in the mdx diaphragm across age groups.



View larger version (35K):
[in this window]
[in a new window]
  		Figure 3. Upregulation of RANTES and MIP-1{alpha} mRNA in the dystrophic diaphragm in vivo. An autoradiograph of RNase protection analysis for RANTES and MIP-1{alpha} mRNA levels at 24 wk of age in BL10 WT and mdx mice is demonstrated in A, whereas group mean values for expression of these chemokines across age groups are shown in B. Expression levels were generally higher in the mdx diaphragm than in either mdx TA or WT muscles. All data were normalized to L32 to control for loading across lanes. Open bars, TA; filled bars, diaphragm. *P < 0.05 for diaphragm versus TA within the same mouse strain (WT or mdx); {dagger}P < 0.05 for WT versus mdx within the same type of muscle (diaphragm or TA).

 


View larger version (13K):
[in this window]
[in a new window]
  		Figure 4. Greater RANTES protein and inflammatory cell infiltration in the dystrophic diaphragm. (A) ELISA revealed greater levels of RANTES protein in the mdx diaphragm across age groups. Open bars, TA; filled bars, diaphragm. *P < 0.05 for diaphragm versus TA within the same mouse strain (WT or mdx); {dagger}P < 0.05 for WT versus mdx within the same type of muscle (diaphragm or TA). (B) Quantitative comparison of the level of inflammation between mdx diaphragm and TA at 6, 12, and 24 wk of age. *P < 0.05 for diaphragm versus TA.

 
In keeping with the finding of greater chemokine expression levels in the mdx diaphragm, there was also a persistently increased level of inflammation in the dystrophic diaphragm, as compared with the TA limb muscle in the same mice, throughout the time course of disease surveyed in this investigation (Figure 4B). To better define the nature of this inflammatory response, immunohistochemical analysis was performed in the intermediate (12 wk) age group. This revealed that the significantly greater inflammatory cell infiltration found in the mdx diaphragm, as compared with the mdx TA, included macrophages (7.98 ± 0.59% versus 4.22 ± 0.59%, P < 0.001), CD4+ T lymphocytes (2.44 ± 0.14% versus 1.47 ± 0.15%, P < 0.001), and CD8+ T lymphocytes (2.90 ± 0.13% versus 1.11 ± 0.18%, P < 0.001).

Effects of Proinflammatory Cytokines on CCR/Ligand Expression by Dystrophic Diaphragm Muscle Cells
Because the mdx diaphragm is characterized by a high level of ongoing inflammation, we next sought to determine whether proinflammatory cytokines could upregulate CCR and/or ligand expression by dystrophic diaphragm muscle cells. Therefore, we stimulated differentiated myotubes derived from mdx and WT diaphragms with a mixture of three proinflammatory cytokines (TNF-{alpha}, IL-1{alpha}, and IFN-{gamma}) that we have previously reported to be upregulated within the mdx diaphragm in vivo (17). Under nonstimulated baseline conditions, there was low-level expression of CCR1 in mdx as well as WT diaphragmatic myotubes (see Figure 5A), a finding which is consistent with the RT-PCR data presented in Figure 2. After 4 h of cytokine stimulation, there was a clear upregulation of CCR1 expression in diaphragmatic myotubes, which occurred to a similar degree in the mdx and WT groups (Figure 5B). In contrast, expression of the other receptors was not clearly present under the same stimulation conditions.



View larger version (34K):
[in this window]
[in a new window]
  		Figure 5. Upregulation of CCR1 expression in diaphragm muscle cells by proinflammatory cytokines. RNase protection analysis of chemokine receptor expression, in the absence (control) or presence (stimulated) of prior exposure to proinflammatory cytokines (TNF-{alpha}, IL-1{alpha}, and IFN-{gamma}), is demonstrated in A. Group mean values for CCR1 expression under the same conditions are shown in B. Expression levels of CCR1 in diaphragm myotubes were significantly higher after stimulation in both WT and mdx groups. All data were normalized to L32 to control for loading across lanes. *P < 0.05 for control versus stimulation conditions within each mouse strain.

 
Finally, to determine the effects of proinflammatory cytokines on expression of the CCR1 ligands RANTES and MIP-1{alpha}, diaphragmatic myotubes were once again exposed to the same stimulation paradigm. There was significant upregulation of RANTES, but not MIP-1{alpha}, in both mdx and WT diaphragmatic myotubes studied at 4 h after stimulation (Figure 6). Furthermore, we observed that the magnitude of RANTES upregulation was significantly greater in mdx than in WT muscle cells under the identical stimulation conditions.



View larger version (21K):
[in this window]
[in a new window]
  		Figure 6. Greater upregulation of RANTES expression by proinflammatory cytokines in dystrophic diaphragm muscle cells. Under the same experimental conditions outlined in Figure 5, RNase protection analysis revealed no sign of RANTES or MIP-1{alpha} expression in the absence of proinflammatory cytokine exposure (ND = not detectable). However, after being stimulated with proinflammatory cytokines, RANTES expression was induced in both WT and mdx diaphragm myotubes (filled bars). In addition, the magnitude of RANTES gene induction was greater in the dystrophic group. All data were normalized to L32 to control for loading across lanes. *P < 0.05 for control versus stimulation conditions within each mouse strain; {dagger}P < 0.05 for WT versus mdx.

 

   DISCUSSION
Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
References
 
The primary objective of our study was to determine whether the magnitude and timing of CC chemokine receptor and/or ligand expression would differ between dystrophic mdx limb muscle and the more severely diseased mdx diaphragm over an extended time course of disease progression. A secondary objective of our study was to ascertain whether intrinsic differences between dystrophic and wild-type muscle cells could be detected in vitro, which might differentially affect the regulation of chemokine receptors and/or ligands in the setting of inflammation. We focused our observations upon the mdx diaphragm for two major reasons. First, respiratory insufficiency is a major contributing factor to morbidity as well as mortality in DMD patients (20). Second, in the mdx mouse model of dystrophin deficiency, the diaphragm exhibits a histopathologic and functional picture that is phenotypically similar to human DMD, whereas the limb muscles are much less affected despite the same underlying genetic defect (5). Therefore, comparisons between diaphragm and limb musculature in the mdx model may offer valuable insights into secondary pathophysiological mechanisms involved in disease progression and adaptation.

Our major findings can be summarized as follows: (1) several CC class chemokine receptors (CCRs 1, 2, 3, and 5) were overexpressed at the mRNA level in dystrophic muscles (diaphragm and limb) relative to their WT counterparts; (2) CCR1 expression was readily detected by immunostaining in a substantial proportion of mdx muscle fibers, and CCR1 mRNA was also constitutively expressed by both dystrophic and wild-type differentiated myotubes in vitro; (3) the major CCR1 ligands, MIP-1{alpha}, and RANTES, were both significantly overexpressed in the mdx diaphragm as compared with the mdx TA or WT muscles over the entire time course of disease examined in our study; (4) In vitro stimulation with nonchemokine proinflammatory cytokines (TNF-{alpha}, IL-1{alpha}, and IFN-{gamma}) triggered increased mRNA expression of CCR1 and RANTES by both mdx and WT diaphragmatic myotubes. However, the magnitude of RANTES upregulation was significantly greater in the dystrophic muscle cells, suggesting intrinsic differences between dystrophic and WT muscle cells in their responses to proinflammatory cytokine stimulation.

Expression and Regulation of CCR in Dystrophic Diaphragms
There has been little study of chemokine receptor expression by skeletal muscle. In humans, CCR2 exists as two distinct isoforms (A and B), which arise from differential splicing of the same gene (21). Bartoli and coworkers (22) reported that CCR2A was expressed in inflammatory cells and vessel walls within human muscle biopsies, whereas CCR2B expression could be found in regenerating fibers as well as muscle satellite cells and end-plates. In mdx mouse hindlimb muscle, Porter and colleagues (15) also reported increased expression of CCRs 1, 2, and 5 by quantitative RT-PCR. Here we compared the pattern of CCR expression by skeletal muscles in vivo to that found in cultured primary skeletal muscle cells in vitro, for both WT and dystrophic mice. We found that CCRs 1, 2, 3, and 5 were all strongly expressed at the mRNA level by the mdx diaphragm in vivo. However, only CCR1 expression could be detected in differentiated diaphragmatic myotubes in vitro, and immunohistochemistry also revealed intense staining for CCR1 in many dystrophic muscle fibers in vivo.

To our knowledge, the present study is the first to demonstrate that CCR1 can be expressed by skeletal muscle cells per se. In addition, it is interesting to note that the preferential expression of CCR1 found in the mdx group in vivo was not observed in vitro, suggesting that environmental factors related to the in vivo situation were responsible for directing CCR1 upregulation. A plausible explanation for these findings is the presence of increased proinflammatory cytokine expression within dystrophic muscles (17). In support of this hypothesis, we found that CCR1 expression by muscle cells was significantly upregulated by exposure to such cytokines in vitro. It is also possible that CCR1 expression was increased in mdx muscle fibers due to the presence of muscle regeneration in the dystrophic group, since regenerating fibers have previously been reported to overexpress CCR2 (22).

CC Chemokine Ligand Expression and Muscle Inflammation in Dystrophic Diaphragms
Because our experiments indicated that only CCR1 was expressed by primary muscle cells in vitro, we directed our examination to two high-affinity ligands for this receptor, MIP-1{alpha} and RANTES. Importantly, we found that throughout the time course of disease progression in the mdx mouse up to 6 mo of age, there was a higher absolute level of MIP-1{alpha} and/or RANTES mRNA expression in the mdx diaphragm as compared with the mdx limb musculature. In addition, we confirmed by ELISA that increased RANTES mRNA levels in the mdx diaphragm were associated with significantly augmented RANTES protein expression within the muscle. There was also a greater level of ongoing inflammation in the mdx diaphragm, suggesting that CC chemokines may play an important role in sustaining the inflammatory process in dystrophic muscles. Indeed, to the extent that RANTES and MIP-1{alpha} are both potent chemoattractants for monocytes and lymphocytes (10), our findings of increased muscle infiltration by macrophages as well as CD4+ and CD8+ T lymphocytes in the mdx diaphragm are consistent with this hypothesis.

In a previous study which employed a microarray gene profiling approach, Porter and coworkers (23) concluded that expression of various inflammatory genes, including CC chemokines, were lower in the mdx diaphragm than in the mdx hindlimb muscle. The apparent contradiction with our own findings is likely related to the different methods of analysis employed in the two studies. Hence Porter and colleagues (23) based their conclusions upon the sum of relative fold changes from the WT condition in each muscle, rather than absolute values. Interestingly, if we had similarly expressed our mdx diaphragm and TA data in these terms, our conclusions might also be similar. However, this would not have been due to lower chemokine expression in the mdx diaphragm compared with the TA, but rather to the fact that baseline expression levels of both MIP-1{alpha} and RANTES were higher in WT diaphragm than in WT TA.

A particularly interesting finding in our study was that stimulation by proinflammatory cytokines triggered increased expression not only of CCR1, but also of its major ligand RANTES. Although CCR1 is reportedly capable of binding over 10 different chemokines, RANTES and MIP-1{alpha} are its primary ligands in terms of affinity for the receptor and biological efficacy (24–26). Increased expression levels of both RANTES and MIP-1{alpha} have also been reported in inflammatory myopathies (27). Intriguingly, in our study cytokine-driven upregulation of RANTES expression was greater in mdx than in WT diaphragm muscle cells. In addition, we have previously reported that the same proinflammatory cytokines used for in vitro stimulation in this study (i.e., TNF-{alpha}, IL-1{alpha}, and IFN-{gamma}), are upregulated within the mdx diaphragm in vivo (17), and these cytokines have also been implicated by others in dystrophic disease pathogenesis (28). Therefore, our findings suggest that increased RANTES expression in the mdx diaphragm may be explained by at least two factors: (1) a greater environmental exposure to proinflammatory cytokines; and (2) a greater inherent sensitivity of dystrophic muscle cells to cytokine stimulation. With regard to the latter, various cell signaling pathways have been found to respond abnormally in dystrophin-deficient muscle cells, including that involving NF-{kappa}B (29), which is involved in the regulation of RANTES expression (30).

Implications for Dystrophic Disease Pathogenesis and Therapy
There is increasing evidence that inflammation plays an important role in fostering disease progression in dystrophin deficiency (6). Spencer and coworkers (7, 31) found that depletion of either CD4+ or CD8+ T lymphocytes at a very early stage of the disease leads to a significant reduction in histopathologic features within mdx hindlimb muscles. Along these same lines, mdx mice which are crossed with T lymphocyte–deficient nu/nu mice show decreased fibrosis in the diaphragm compared with T lymphocyte–competent mdx mice (32). A role for perforin-mediated destruction of dystrophic muscle fibers by cytotoxic T lymphocytes is supported by the observation that mdx mice lacking perforin similarly demonstrate decreased dystrophic pathology (8, 31). Eosinophils (8) and mast cells (33) also have the potential to play a significant role in promoting muscle fiber necrosis in dystrophin deficiency.

Given the evidence that inflammation is likely to be an important disease-modifying factor in dystrophin deficiency, our findings suggest a potential avenue for therapeutic intervention. At the present time, the options for treatment of ventilatory muscle weakness in DMD are extremely limited, and consist primarily of supportive measures such as mechanical ventilation. Although gene therapy holds great promise for correcting the underlying genetic defect in the long term (34), many technical hurdles must be overcome before this approach can be successfully applied to the respiratory muscles in patients with DMD. Modulation of the inflammatory response within the dystrophic diaphragm would appear to offer a more immediate and clinically feasible option. Indeed, there is already evidence that corticosteroid therapy can slow the loss of muscle function in patients with DMD (35). Unfortunately, this improvement is not sustained over the long term, and the treatment is associated with serious adverse side effects that tend to negate benefits.

Recently developed chemokine ligand and receptor antagonists may offer a more targeted and less toxic approach (36). However, it is essential to recognize that in addition to attracting inflammatory cells to injured muscle tissue, chemokines could serve important homeostatic roles for muscle cells. This is strongly supported by our finding of CCR1 expression by muscle cells. In keeping with this idea, RANTES has been reported to be a chemotactic factor for myoblasts (37), and it has also been reported that muscle regeneration is impaired in CCR2-deficient mice (38). These findings suggest that CC chemokines may mediate important autocrine/paracrine effects on dystrophic muscle cells, which are likely to be amplified in the dystrophic diaphragm because there is dual upregulation of both CC chemokine ligands and their cognate receptors. Therefore, the ultimate impact of inhibiting CC chemokine functions in this setting is difficult to predict, because both beneficial (reduction of inflammation) and adverse (interference with homeostatic functions) consequences are possible. Further studies will be required to specifically examine the effects of inhibiting receptor–ligand interactions involving RANTES and/or MIP-1{alpha} on disease progression in the dystrophic diaphragm.


   Footnotes
 
This investigation was supported by grants from the Canadian Institutes of Health Research, the Fonds de la recherche en sante du Quebec, the Canadian Lung Association, and the Fondation pour la recherche medicale.

This article has an online supplement, which is accessible from this issue's table of contents at www.atsjournals.org

Conflict of Interest Statement: None of the authors have a financial relationship with a commercial entity that has an interest in the subject of this manuscript.

Received in original form November 8, 2004

Received in final form April 26, 2005


   References
Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 

  1. Hoffman EP, Brown RHJ, Kunkel LM. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell 1987;51:919–928.[CrossRef][Medline]
  2. Petrof BJ, Shrager JB, Stedman HH, Kelly AM, Sweeney HL. Dystrophin protects the sarcolemma from stresses developed during muscle contraction. Proc Natl Acad Sci USA 1993;90:3710–3714.[Abstract/Free Full Text]
  3. Petrof BJ. Molecular pathophysiology of myofiber injury in deficiencies of the dystrophin-glycoprotein complex. Am J Phys Med Rehabil 2002;81:S162–S174.[CrossRef][Medline]
  4. Khurana TS, Prendergast RA, Alameddine HS, Tomé FMS, Fardeau M, Arahata K, Sugita H, Kunkel LM. Absence of extraocular muscle pathology in Duchenne's muscular dystrophy: role for calcium homeostasis in extraocular muscle sparing. J Exp Med 1995;182:467–475.[Abstract/Free Full Text]
  5. Stedman HH, Sweeney HL, Shrager JB, Maguire HC, Panettieri RA, Petrof B, Narusawa M, Leferovich JM, Sladky JT, Kelly AM. The mdx mouse diaphragm reproduces the degenerative changes of Duchenne muscular dystrophy. Nature 1991;352:536–539.[CrossRef][Medline]
  6. Spencer MJ, Tidball JG. Do immune cells promote the pathology of dystrophin-deficient myopathies? Neuromuscul Disord 2001;11:556–564.[CrossRef][Medline]
  7. Spencer MJ, Montecino-Rodriguez E, Dorshkind K, Tidball JG. Helper (CD4(+)) and cytotoxic (CD8(+)) T cells promote the pathology of dystrophin-deficient muscle. Clin Immunol 2001;98:235–243.[CrossRef][Medline]
  8. Cai B, Spencer MJ, Nakamura G, Tseng-Ong L, Tidball JG. Eosinophilia of dystrophin-deficient muscle is promoted by perforin-mediated cytotoxicity by T cell effectors. Am J Pathol 2000;156:1789–1796.[Abstract/Free Full Text]
  9. Zlotnik A, Yoshie O. Chemokines: a new classification system and their role in immunity. Immunity 2000;12:121–127.[CrossRef][Medline]
  10. Rollins BJ. Chemokines. Blood 1997;90:909–928.[Free Full Text]
  11. Rossi D, Zlotnik A. The biology of chemokines and their receptors. Annu Rev Immunol 2000;18:217–242.[CrossRef][Medline]
  12. Chen YW, Zhao P, Borup R, Hoffman EP. Expression profiling in the muscular dystrophies: identification of novel aspects of molecular pathophysiology. J Cell Biol 2000;151:1321–1336.[Abstract/Free Full Text]
  13. Porter JD, Khanna S, Kaminski HJ, Rao JS, Merriam AP, Richmonds CR, Leahy P, Li J, Guo W, Andrade FH. A chronic inflammatory response dominates the skeletal muscle molecular signature in dystrophin-deficient mdx mice. Hum Mol Genet 2002;11:263–272.[Abstract/Free Full Text]
  14. Fang J, Shi GP, Vaghy PL. Identification of the increased expression of monocyte chemoattractant protein-1, cathepsin S, UPIX-1, and other genes in dystrophin-deficient mouse muscles by suppression subtractive hybridization. J Cell Biochem 2000;79:164–172.[CrossRef][Medline]
  15. Porter JD, Guo W, Merriam AP, Khanna S, Cheng G, Zhou X, Andrade FH, Richmonds C, Kaminski HJ. Persistent over-expression of specific CC class chemokines correlates with macrophage and T-cell recruitment in mdx skeletal muscle. Neuromuscul Disord 2003;13:223–235.[CrossRef][Medline]
  16. Hirata A, Masuda S, Tamura T, Kai K, Ojima K, Fukase A, Motoyoshi K, Kamakura K, Miyagoe-Suzuki Y, Takeda S. Expression profiling of cytokines and related genes in regenerating skeletal muscle after cardiotoxin injection: a role for osteopontin. Am J Pathol 2003;163:203–215.[Abstract/Free Full Text]
  17. Demoule A, Divangahi M, Matecki S, Bao W, Petrof BJ. Cytokine and chemokine expression levels are higher in diaphragm than in limb muscles of dystrophic (mdx) mice. Am J Respir Crit Care Med 2004;169:A244.
  18. Rosenblatt JD, Lunt AI, Parry DJ, Partridge TA. Culturing satellite cells from living single muscle fiber explants. In Vitro Cell Dev Biol Anim 1995;31:773–779.[Medline]
  19. Guibinga G-H, Lochmüller H, Massie B, Nalbantoglu J, Karpati G, Petrof BJ. Combinatorial blockade of calcineurin and CD28 signaling facilitates primary and secondary therapeutic gene transfer by adenovirus vectors in dystrophic (mdx) mouse muscles. J Virol 1998;72:4601–4609.[Abstract/Free Full Text]
  20. Phillips MF, Quinlivan RC, Edwards RH, Calverley PM. Changes in spirometry over time as a prognostic marker in patients with Duchenne muscular dystrophy. Am J Respir Crit Care Med 2001;164:2191–2194.[Abstract/Free Full Text]
  21. Charo IF, Myers SJ, Herman A, Franci C, Connolly AJ, Coughlin SR. Molecular cloning and functional expression of two monocyte chemoattractant protein 1 receptors reveals alternative splicing of the carboxyl-terminal tails. Proc Natl Acad Sci USA 1994;91:2752–2756.[Abstract/Free Full Text]
  22. Bartoli C, Civatte M, Pellissier JF, Figarella-Branger D. CCR2A and CCR2B, the two isoforms of the monocyte chemoattractant protein-1 receptor are up-regulated and expressed by different cell subsets in idiopathic inflammatory myopathies. Acta Neuropathol (Berl) 2001;102:385–392.[Medline]
  23. Porter JD, Merriam AP, Leahy P, Gong B, Feuerman J, Cheng G, Khanna S. Temporal gene expression profiling of dystrophin-deficient (mdx) mouse diaphragm identifies conserved and muscle group-specific mechanisms in the pathogenesis of muscular dystrophy. Hum Mol Genet 2004;13:257–269.[Abstract/Free Full Text]
  24. Neote K, DiGregorio D, Mak JY, Horuk R, Schall TJ. Molecular cloning, functional expression, and signaling characteristics of a C–C chemokine receptor. Cell 1993;72:415–425.[CrossRef][Medline]
  25. Tian Y, New DC, Yung LY, Allen RA, Slocombe PM, Twomey BM, Lee MM, Wong YH. Differential chemokine activation of CC chemokine receptor 1-regulated pathways: ligand selective activation of Galpha 14-coupled pathways. Eur J Immunol 2004;34:785–795.[CrossRef][Medline]
  26. Chou CC, Fine JS, Pugliese-Sivo C, Gonsiorek W, Davies L, Deno G, Petro M, Schwarz M, Zavodny PJ, Hipkin RW. Pharmacological characterization of the chemokine receptor, hCCR1 in a stable transfectant and differentiated HL-60 cells: antagonism of hCCR1 activation by MIP-1beta. Br J Pharmacol 2002;137:663–675.[CrossRef][Medline]
  27. Adams EM, Kirkley J, Eidelman G, Dohlman J, Plotz PH. The predominance of beta (CC) chemokine transcripts in idiopathic inflammatory muscle diseases. Proc Assoc Am Physicians 1997;109:275–285.[Medline]
  28. Gosselin LE, Barkley JE, Spencer MJ, McCormick KM, Farkas GA. Ventilatory dysfunction in mdx mice: impact of tumor necrosis factor-alpha deletion. Muscle Nerve 2003;28:336–343.[CrossRef][Medline]
  29. Kumar A, Boriek AM. Mechanical stress activates the nuclear factor-kappaB pathway in skeletal muscle fibers: a possible role in Duchenne muscular dystrophy. FASEB J 2003;17:386–396.[Abstract/Free Full Text]
  30. Moriuchi H, Moriuchi M, Fauci AS. Nuclear factor-{kappa}B potently up-regulates the promoter activity of RANTES, a chemokine that blocks HIV infection. J Immunol 1997;158:3483–3491.[Abstract]
  31. Spencer MJ, Walsh CM, Dorshkind KA, Rodriguez EM, Tidball JG. Myonuclear apoptosis in dystrophic mdx muscle occurs by perforin-mediated cytotoxicity. J Clin Invest 1997;99:2745–2751.[Medline]
  32. Morrison J, Lu QL, Pastoret C, Partridge T, Bou-Gharios G. T-cell-dependent fibrosis in the mdx dystrophic mouse. Lab Invest 2000;80:881–891.[Medline]
  33. Gorospe JR, Tharp M, Demitsu T, Hoffman EP. Dystrophin-deficient myofibers are vulnerable to mast cell granule-induced necrosis. Neuromuscul Disord 1994;4:325–333.[CrossRef][Medline]
  34. Matecki S, Dudley RW, Divangahi M, Gilbert R, Nalbantoglu J, Karpati G, Petrof BJ. Therapeutic gene transfer to dystrophic diaphragm by an adenoviral vector deleted of all viral genes. Am J Physiol Lung Cell Mol Physiol 2004;287:L569–L576.[Abstract/Free Full Text]
  35. Griggs RC, Moxley RT, Mendell JR, Fenichel GM, Brooke MH, Pestronk A, Miller JP, Clinical Investigation of Duchenne Dystrophy Group. Prednisone in Duchenne dystrophy. Arch Neurol 1991;48:383–388.[Abstract]
  36. Fernandez EJ, Lolis E. Structure, function, and inhibition of chemokines. Annu Rev Pharmacol Toxicol 2002;42:469–499.[CrossRef][Medline]
  37. Corti S, Salani S, Del Bo R, Sironi M, Strazzer S, D'Angelo MG, Comi GP, Bresolin N, Scarlato G. Chemotactic factors enhance myogenic cell migration across an endothelial monolayer. Exp Cell Res 2001;268:36–44.[CrossRef][Medline]
  38. Warren GL, Hulderman T, Mishra D, Gao X, Millecchia L, O'Farrell L, Kuziel WA, Simeonova PP. Chemokine receptor CCR2 involvement in skeletal muscle regeneration. FASEB J 2005;19:413–415.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
M. Divangahi, T. Yang, K. Kugathasan, S. McCormick, S. Takenaka, G. Gaschler, A. Ashkar, M. Stampfli, J. Gauldie, J. Bramson, et al.
Critical Negative Regulation of Type 1 T Cell Immunity and Immunopathology by Signaling Adaptor DAP12 during Intracellular Infection
J. Immunol., September 15, 2007; 179(6): 4015 - 4026.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
M. Divangahi, A. Demoule, G. Danialou, L. Yahiaoui, W. Bao, Z. Xing, and B. J. Petrof
Impact of IL-10 on Diaphragmatic Cytokine Expression and Contractility during Pseudomonas Infection
Am. J. Respir. Cell Mol. Biol., April 1, 2007; 36(4): 504 - 512.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
J. H. Boyd, M. Divangahi, L. Yahiaoui, D. Gvozdic, S. Qureshi, and B. J. Petrof
Toll-Like Receptors Differentially Regulate CC and CXC Chemokines in Skeletal Muscle via NF-{kappa}B and Calcineurin
Infect. Immun., December 1, 2006; 74(12): 6829 - 6838.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Crit. Care Med.Home page
A. Demoule, M. Divangahi, L. Yahiaoui, G. Danialou, D. Gvozdic, K. Labbe, W. Bao, and B. J. Petrof
Endotoxin Triggers Nuclear Factor-{kappa}B-dependent Up-regulation of Multiple Proinflammatory Genes in the Diaphragm
Am. J. Respir. Crit. Care Med., September 15, 2006; 174(6): 646 - 653.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supplement
Right arrow All Versions of this Article:
2004-0347OCv1
33/2/178    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Demoule, A.
Right arrow Articles by Petrof, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Demoule, A.
Right arrow Articles by Petrof, B. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2005 American Thoracic Society.